Starting /dee2/code/volunteer_pipeline.sh SRR12670977 current disk space = 3052521250816 free memory = 1470217636 SRR12670977 SRAfilesize fd8baa57d272c356c7ecd8457574b00d SRR12670977.sra SRR12670977.sra file validated SRR12670977 is paired end SRR12670977 is conventional basespace SRR12670977 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670977_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38975 37.0 37.0 37.0 37.0 37.0 2 36.412 37.0 37.0 37.0 37.0 37.0 3 36.598 37.0 37.0 37.0 37.0 37.0 4 36.5835 37.0 37.0 37.0 37.0 37.0 5 36.6 37.0 37.0 37.0 37.0 37.0 6 36.59 37.0 37.0 37.0 37.0 37.0 7 36.5615 37.0 37.0 37.0 37.0 37.0 8 36.637 37.0 37.0 37.0 37.0 37.0 9 36.694 37.0 37.0 37.0 37.0 37.0 10-14 36.6264 37.0 37.0 37.0 37.0 37.0 15-19 36.594 37.0 37.0 37.0 37.0 37.0 20-24 36.5599 37.0 37.0 37.0 37.0 37.0 25-29 36.5283 37.0 37.0 37.0 37.0 37.0 30-34 36.486399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.520799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.477199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4295 37.0 37.0 37.0 37.0 37.0 50-54 36.4222 37.0 37.0 37.0 37.0 37.0 55-59 36.410399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3903 37.0 37.0 37.0 37.0 37.0 65-69 36.3393 37.0 37.0 37.0 37.0 37.0 70-74 36.338 37.0 37.0 37.0 37.0 37.0 75-79 36.3028 37.0 37.0 37.0 37.0 37.0 80-84 36.2581 37.0 37.0 37.0 37.0 37.0 85-89 36.23649999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2645 37.0 37.0 37.0 37.0 37.0 95-99 36.1337 37.0 37.0 37.0 37.0 37.0 100-104 36.20819999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1462 37.0 37.0 37.0 37.0 37.0 110-114 36.163 37.0 37.0 37.0 37.0 37.0 115-119 36.034800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9705 37.0 37.0 37.0 37.0 37.0 125-129 36.0077 37.0 37.0 37.0 37.0 37.0 130-134 35.8801 37.0 37.0 37.0 37.0 37.0 135-139 35.8098 37.0 37.0 37.0 37.0 37.0 140-144 35.8131 37.0 37.0 37.0 37.0 37.0 145-149 35.6826 37.0 37.0 37.0 37.0 37.0 150-151 35.31999999999999 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 7.0 27 10.0 28 10.0 29 24.0 30 36.0 31 42.0 32 45.0 33 91.0 34 131.0 35 263.0 36 2650.0 37 685.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.211802950737685 10.75268817204301 5.351337834458614 36.68417104276069 2 20.150000000000002 11.899999999999999 36.55 31.4 3 17.95 15.15 28.499999999999996 38.4 4 24.2 21.975 24.925 28.9 5 24.625 30.775000000000002 23.65 20.95 6 20.9 32.550000000000004 23.575 22.975 7 14.95 26.200000000000003 42.025 16.825000000000003 8 16.5 24.925 34.075 24.5 9 16.0 24.125 35.55 24.325 10-14 19.575 29.525000000000002 27.66 23.24 15-19 19.955000000000002 27.529999999999998 28.199999999999996 24.315 20-24 19.845 28.965000000000003 27.42 23.77 25-29 19.62 27.935 28.194999999999997 24.25 30-34 19.525000000000002 28.410000000000004 27.99 24.075 35-39 19.994999999999997 28.125 28.04 23.84 40-44 20.565 28.854999999999997 27.334999999999997 23.244999999999997 45-49 20.305 28.055000000000003 27.615000000000002 24.025 50-54 20.505000000000003 28.199999999999996 27.985 23.31 55-59 20.044999999999998 28.599999999999998 27.685 23.669999999999998 60-64 20.325 28.1 27.87 23.705000000000002 65-69 20.74 27.825 27.865000000000002 23.57 70-74 20.23 28.43 27.97 23.369999999999997 75-79 20.26 28.34 27.825 23.575 80-84 20.474999999999998 28.025 27.63 23.87 85-89 19.900000000000002 28.24 28.244999999999997 23.615 90-94 20.419999999999998 28.225 27.63 23.724999999999998 95-99 20.215 28.4 27.71 23.674999999999997 100-104 20.674999999999997 29.075 27.384999999999998 22.865 105-109 21.105 27.985 27.74 23.169999999999998 110-114 20.424999999999997 28.23 28.255000000000003 23.09 115-119 20.615 28.025 27.71 23.65 120-124 20.52 27.884999999999998 27.465 24.13 125-129 20.885 27.650000000000002 27.534999999999997 23.93 130-134 20.945 28.275 27.145000000000003 23.635 135-139 20.735 28.235 27.065 23.965 140-144 20.935000000000002 28.415000000000003 27.034999999999997 23.615 145-149 20.91709170917092 28.11781178117812 26.94769476947695 24.01740174017402 150-151 21.25 27.425 27.462500000000002 23.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.0 20 1.5 21 2.5 22 1.0 23 1.0 24 4.5 25 4.0 26 4.0 27 6.0 28 9.0 29 13.0 30 17.5 31 24.5 32 30.5 33 38.5 34 54.0 35 72.0 36 83.5 37 90.5 38 116.5 39 148.0 40 171.5 41 208.0 42 248.5 43 266.5 44 269.5 45 276.0 46 264.0 47 238.5 48 227.0 49 216.0 50 187.5 51 146.0 52 116.0 53 102.5 54 74.5 55 55.5 56 56.0 57 43.5 58 31.5 59 27.5 60 19.0 61 9.5 62 6.5 63 4.0 64 1.0 65 3.0 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.94165045846069 80.925 2 9.141428174492914 16.45 3 0.7502083912197832 2.025 4 0.1667129758266185 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.9000000000000004 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.2125 0.0 0.0 0.0 0.0 136-137 7.612500000000001 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTCA 10 0.006830828 145.0 7 TTGCTTT 10 0.006830828 145.0 3 >>END_MODULE SRR12670977 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670977_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0215 37.0 37.0 37.0 37.0 37.0 2 36.122 37.0 37.0 37.0 37.0 37.0 3 36.277 37.0 37.0 37.0 37.0 37.0 4 36.1895 37.0 37.0 37.0 37.0 37.0 5 36.3925 37.0 37.0 37.0 37.0 37.0 6 36.3665 37.0 37.0 37.0 37.0 37.0 7 36.374 37.0 37.0 37.0 37.0 37.0 8 36.31 37.0 37.0 37.0 37.0 37.0 9 36.3905 37.0 37.0 37.0 37.0 37.0 10-14 36.3921 37.0 37.0 37.0 37.0 37.0 15-19 36.3882 37.0 37.0 37.0 37.0 37.0 20-24 36.387299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.33 37.0 37.0 37.0 37.0 37.0 30-34 36.2904 37.0 37.0 37.0 37.0 37.0 35-39 36.2241 37.0 37.0 37.0 37.0 37.0 40-44 36.2376 37.0 37.0 37.0 37.0 37.0 45-49 36.2194 37.0 37.0 37.0 37.0 37.0 50-54 36.227199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.158699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1837 37.0 37.0 37.0 37.0 37.0 65-69 36.1868 37.0 37.0 37.0 37.0 37.0 70-74 36.1404 37.0 37.0 37.0 37.0 37.0 75-79 36.083299999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0804 37.0 37.0 37.0 37.0 37.0 85-89 36.0233 37.0 37.0 37.0 37.0 37.0 90-94 36.0333 37.0 37.0 37.0 37.0 37.0 95-99 36.0906 37.0 37.0 37.0 37.0 37.0 100-104 36.009100000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.961499999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.9416 37.0 37.0 37.0 37.0 37.0 115-119 35.88245 37.0 37.0 37.0 37.0 37.0 120-124 35.843399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.724399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.654399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.57769999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.42295 37.0 37.0 37.0 37.0 37.0 145-149 35.1999 37.0 37.0 37.0 27.4 37.0 150-151 34.927499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 2.0 17 0.0 18 2.0 19 0.0 20 1.0 21 0.0 22 4.0 23 2.0 24 6.0 25 9.0 26 12.0 27 7.0 28 17.0 29 20.0 30 31.0 31 41.0 32 59.0 33 95.0 34 206.0 35 376.0 36 2575.0 37 531.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.824999999999996 23.799999999999997 9.125 23.25 2 27.675 25.15 31.85 15.325 3 20.575 26.575 33.75 19.1 4 24.55 34.525 22.675 18.25 5 25.224999999999998 37.425000000000004 22.225 15.125 6 20.375 38.4 23.125 18.099999999999998 7 19.625 22.5 39.1 18.775 8 19.85 26.075 29.549999999999997 24.525 9 21.099999999999998 23.974999999999998 31.900000000000002 23.025000000000002 10-14 22.74 30.025000000000002 26.77 20.465 15-19 22.8 28.310000000000002 27.944999999999997 20.945 20-24 23.35 28.165000000000003 28.08 20.405 25-29 22.96 28.189999999999998 28.005000000000003 20.845 30-34 22.665 27.744999999999997 28.444999999999997 21.145 35-39 22.485 28.194999999999997 28.12 21.2 40-44 22.725 28.355000000000004 28.03 20.89 45-49 22.525000000000002 29.075 27.37 21.029999999999998 50-54 22.085 28.68 27.950000000000003 21.285 55-59 23.135 28.26 27.875 20.73 60-64 23.195 27.755000000000003 27.650000000000002 21.4 65-69 23.080000000000002 27.950000000000003 27.49 21.48 70-74 23.395 28.18 27.169999999999998 21.255 75-79 22.575 27.965 28.310000000000002 21.15 80-84 22.189999999999998 28.79 27.32 21.7 85-89 23.61 28.24 27.515 20.635 90-94 23.369999999999997 27.725 27.175 21.73 95-99 23.345 28.165000000000003 27.515 20.974999999999998 100-104 23.31 27.505000000000003 28.044999999999998 21.14 105-109 23.22 27.939999999999998 28.294999999999998 20.544999999999998 110-114 23.974999999999998 27.83 27.85 20.345 115-119 23.851192559627982 27.961398069903492 27.881394069703486 20.306015300765036 120-124 24.48 27.765 27.639999999999997 20.115 125-129 24.38 28.305000000000003 26.200000000000003 21.115000000000002 130-134 24.73 27.875 27.725 19.67 135-139 25.275 27.224999999999998 27.24 20.26 140-144 25.896294814740738 26.79133956697835 27.256362818140907 20.056002800140007 145-149 26.26 27.905 26.32 19.515 150-151 25.974999999999998 28.0625 26.9125 19.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.0 22 1.5 23 3.0 24 3.5 25 3.5 26 5.5 27 9.0 28 9.0 29 10.5 30 16.5 31 25.5 32 31.5 33 43.0 34 61.5 35 75.0 36 86.0 37 109.0 38 144.5 39 169.5 40 199.0 41 229.5 42 231.0 43 251.0 44 270.0 45 262.5 46 256.5 47 250.5 48 239.0 49 207.0 50 166.5 51 130.0 52 105.5 53 87.5 54 78.5 55 62.5 56 37.5 57 29.5 58 24.5 59 16.0 60 14.0 61 11.5 62 7.0 63 5.0 64 2.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.325 #Duplication Level Percentage of deduplicated Percentage of total 1 90.47882646000554 81.72500000000001 2 8.690838638250762 15.7 3 0.5812344312205923 1.575 4 0.19374481040686412 0.7000000000000001 5 0.02767783005812344 0.125 6 0.0 0.0 7 0.02767783005812344 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.275 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.3875 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.887499999999999 0.0 0.0 0.0 0.0 130-131 6.3875 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698389 spots for SRR12670977.sra Written 698389 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra Read 698376 spots for SRR12670977.sra Written 698376 spots for SRR12670977.sra SRR ids: ['SRR12670977.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1v3dhtjy SRR12670977.sra spots: 13967533 blocks: [[1, 698376], [698377, 1396752], [1396753, 2095128], [2095129, 2793504], [2793505, 3491880], [3491881, 4190256], [4190257, 4888632], [4888633, 5587008], [5587009, 6285384], [6285385, 6983760], [6983761, 7682136], [7682137, 8380512], [8380513, 9078888], [9078889, 9777264], [9777265, 10475640], [10475641, 11174016], [11174017, 11872392], [11872393, 12570768], [12570769, 13269144], [13269145, 13967533]] SRR12670977 file size 4725078 SRR12670977 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670977 SRR12670977_1.fastq SRR12670977_2.fastq Input file: SRR12670977_1.fastq Paired file: SRR12670977_2.fastq trimmed: SRR12670977-trimmed-pair1.fastq, SRR12670977-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:00:12 2025 >> started Tue Feb 11 11:00:28 2025 >> done (16.087s) 13967533 read pairs processed; of these: 139 ( 0.00%) short read pairs filtered out after trimming by size control 8877 ( 0.06%) empty read pairs filtered out after trimming by size control 13958517 (99.94%) read pairs available; of these: 1444414 (10.35%) trimmed read pairs available after processing 12514103 (89.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 6 0.00% 21 7 0.00% 22 12 0.00% 23 13 0.00% 24 9 0.00% 25 23 0.00% 26 20 0.00% 27 14 0.00% 28 26 0.00% 29 15 0.00% 30 16 0.00% 31 16 0.00% 32 19 0.00% 33 21 0.00% 34 23 0.00% 35 12 0.00% 36 17 0.00% 37 27 0.00% 38 27 0.00% 39 15 0.00% 40 14 0.00% 41 27 0.00% 42 28 0.00% 43 35 0.00% 44 27 0.00% 45 48 0.00% 46 32 0.00% 47 41 0.00% 48 46 0.00% 49 54 0.00% 50 64 0.00% 51 75 0.00% 52 74 0.00% 53 73 0.00% 54 83 0.00% 55 93 0.00% 56 79 0.00% 57 113 0.00% 58 122 0.00% 59 143 0.00% 60 184 0.00% 61 210 0.00% 62 231 0.00% 63 264 0.00% 64 283 0.00% 65 308 0.00% 66 375 0.00% 67 396 0.00% 68 490 0.00% 69 510 0.00% 70 602 0.00% 71 656 0.00% 72 804 0.01% 73 846 0.01% 74 1057 0.01% 75 1121 0.01% 76 1191 0.01% 77 1396 0.01% 78 1571 0.01% 79 1724 0.01% 80 1892 0.01% 81 2175 0.02% 82 2317 0.02% 83 2832 0.02% 84 2995 0.02% 85 3379 0.02% 86 3680 0.03% 87 3799 0.03% 88 4419 0.03% 89 4409 0.03% 90 5158 0.04% 91 5472 0.04% 92 5752 0.04% 93 6396 0.05% 94 7032 0.05% 95 7509 0.05% 96 8106 0.06% 97 8612 0.06% 98 8834 0.06% 99 9566 0.07% 100 10079 0.07% 101 10488 0.08% 102 11093 0.08% 103 11668 0.08% 104 12268 0.09% 105 13072 0.09% 106 13611 0.10% 107 14097 0.10% 108 14950 0.11% 109 15162 0.11% 110 15516 0.11% 111 16717 0.12% 112 16975 0.12% 113 17266 0.12% 114 18488 0.13% 115 19128 0.14% 116 19833 0.14% 117 20873 0.15% 118 21696 0.16% 119 21946 0.16% 120 22978 0.16% 121 23265 0.17% 122 23839 0.17% 123 24658 0.18% 124 25542 0.18% 125 25487 0.18% 126 27137 0.19% 127 27388 0.20% 128 28215 0.20% 129 28620 0.21% 130 29591 0.21% 131 29453 0.21% 132 30547 0.22% 133 31153 0.22% 134 31624 0.23% 135 32259 0.23% 136 33206 0.24% 137 33866 0.24% 138 34662 0.25% 139 35871 0.26% 140 36295 0.26% 141 36651 0.26% 142 37165 0.27% 143 37380 0.27% 144 38091 0.27% 145 39028 0.28% 146 39468 0.28% 147 40212 0.29% 148 41472 0.30% 149 41528 0.30% 150 42664 0.31% 151 12514103 89.65% 13958517 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=29 prefix-density=0.42 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=569.05 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=18.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=28 prefix-density=1.05 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=57.87 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.7 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12670977 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:01:14 Started mapping on | Feb 11 11:01:14 Finished on | Feb 11 11:02:43 Mapping speed, Million of reads per hour | 564.61 Number of input reads | 13958517 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13170139 Uniquely mapped reads % | 94.35% Average mapped length | 295.60 Number of splices: Total | 13107331 Number of splices: Annotated (sjdb) | 12824391 Number of splices: GT/AG | 12844345 Number of splices: GC/AG | 212071 Number of splices: AT/AC | 7576 Number of splices: Non-canonical | 43339 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316665 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 42570 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471713 471713 471713 N_multimapping 316665 316665 316665 N_noFeature 536206 12973533 606880 N_ambiguous 207142 712 80878 UnstrandedReadsAssigned:12426791 PositiveStrandReadsAssigned:195894 NegativeStrandReadsAssigned:12482381 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670977 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670977-trimmed-pair1.fastq SRR12670977-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,958,517 reads, 12,439,579 reads pseudoaligned [quant] estimated average fragment length: 259.283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12670977.ke.tsv 34699 SRR12670977.se.tsv 87100 total ==> SRR12670977.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.72 434 17.8955 Potri.005G024800.1.v4.1 1035 776.717 280 26.1572 Potri.004G059700.1.v4.1 961 702.969 2 0.206438 Potri.007G009000.2.v4.1 1416 1157.72 0 0 Potri.003G141000.2.v4.1 2943 2684.72 935.644 25.2876 Potri.016G087400.1.v4.1 270 85.0032 480 409.734 Potri.015G069301.1.v4.1 564 320.874 0 0 Potri.010G195200.1.v4.1 1773 1514.72 164.908 7.89962 Potri.012G127500.1.v4.1 977 718.821 181 18.2706 ==> SRR12670977.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 109 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12670977 completed mapping pipeline successfully