Starting /dee2/code/volunteer_pipeline.sh SRR12670978 current disk space = 3051997655040 free memory = 1517119564 SRR12670978 SRAfilesize 913d2345e8e6cfbed73c5216c230ff9e SRR12670978.sra SRR12670978.sra file validated SRR12670978 is paired end SRR12670978 is conventional basespace SRR12670978 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670978_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.40375 37.0 37.0 37.0 37.0 37.0 2 36.4705 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.5505 37.0 37.0 37.0 37.0 37.0 5 36.6515 37.0 37.0 37.0 37.0 37.0 6 36.592 37.0 37.0 37.0 37.0 37.0 7 36.4805 37.0 37.0 37.0 37.0 37.0 8 36.5655 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.6212 37.0 37.0 37.0 37.0 37.0 15-19 36.554700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5327 37.0 37.0 37.0 37.0 37.0 25-29 36.512 37.0 37.0 37.0 37.0 37.0 30-34 36.4867 37.0 37.0 37.0 37.0 37.0 35-39 36.5121 37.0 37.0 37.0 37.0 37.0 40-44 36.4769 37.0 37.0 37.0 37.0 37.0 45-49 36.447700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4283 37.0 37.0 37.0 37.0 37.0 55-59 36.3911 37.0 37.0 37.0 37.0 37.0 60-64 36.3823 37.0 37.0 37.0 37.0 37.0 65-69 36.3426 37.0 37.0 37.0 37.0 37.0 70-74 36.3954 37.0 37.0 37.0 37.0 37.0 75-79 36.32719999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2838 37.0 37.0 37.0 37.0 37.0 85-89 36.246500000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2907 37.0 37.0 37.0 37.0 37.0 95-99 36.26389999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2212 37.0 37.0 37.0 37.0 37.0 105-109 36.1788 37.0 37.0 37.0 37.0 37.0 110-114 36.1908 37.0 37.0 37.0 37.0 37.0 115-119 36.098 37.0 37.0 37.0 37.0 37.0 120-124 36.031 37.0 37.0 37.0 37.0 37.0 125-129 36.1069 37.0 37.0 37.0 37.0 37.0 130-134 35.902499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9692 37.0 37.0 37.0 37.0 37.0 140-144 35.9153 37.0 37.0 37.0 37.0 37.0 145-149 35.7209 37.0 37.0 37.0 37.0 37.0 150-151 35.6225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 4.0 26 2.0 27 9.0 28 15.0 29 24.0 30 39.0 31 32.0 32 53.0 33 75.0 34 106.0 35 254.0 36 2748.0 37 634.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.20880220055014 10.427606901725431 6.726681670417604 47.63690922730683 2 18.375 10.725 39.375 31.525 3 18.2 14.7 27.450000000000003 39.65 4 23.7 21.925 22.475 31.900000000000002 5 23.275000000000002 29.15 25.525 22.05 6 20.225 33.225 23.35 23.200000000000003 7 15.024999999999999 26.700000000000003 41.0 17.275 8 16.375 26.1 33.45 24.075 9 17.075000000000003 23.474999999999998 36.325 23.125 10-14 19.695 29.509999999999998 27.735 23.06 15-19 19.845 28.17 28.275 23.71 20-24 20.185 27.939999999999998 28.02 23.855 25-29 19.57 28.660000000000004 27.785 23.985 30-34 19.705000000000002 28.244999999999997 27.76 24.29 35-39 20.119999999999997 28.515 27.38 23.985 40-44 20.3 27.99 27.85 23.86 45-49 19.935 28.475 27.975 23.615 50-54 19.845 28.144999999999996 27.725 24.285 55-59 19.835 28.115000000000002 27.37 24.68 60-64 20.04 28.199999999999996 27.750000000000004 24.01 65-69 19.830000000000002 27.534999999999997 28.71 23.925 70-74 20.169999999999998 28.360000000000003 27.3 24.169999999999998 75-79 19.53 27.045 28.970000000000002 24.455 80-84 19.845 28.720000000000002 27.595 23.84 85-89 19.830000000000002 27.965 27.68 24.525 90-94 19.915 28.305000000000003 27.634999999999998 24.145 95-99 20.27 28.03 27.389999999999997 24.310000000000002 100-104 20.525 28.470000000000002 27.450000000000003 23.555 105-109 20.445 28.005000000000003 27.900000000000002 23.65 110-114 20.880000000000003 27.72 27.815 23.585 115-119 20.11 28.57 27.134999999999998 24.185000000000002 120-124 20.155 28.285 27.61 23.95 125-129 20.41 27.01 28.02 24.560000000000002 130-134 20.185 28.560000000000002 27.800000000000004 23.455000000000002 135-139 20.674999999999997 27.565 27.725 24.035 140-144 20.544999999999998 27.650000000000002 27.71 24.095 145-149 20.692069206920692 27.97779777977798 27.747774777477748 23.582358235823584 150-151 20.0625 28.012500000000003 27.6 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 1.0 23 2.5 24 3.5 25 5.0 26 5.5 27 6.5 28 9.5 29 10.0 30 17.0 31 21.5 32 21.5 33 35.0 34 49.0 35 71.5 36 91.5 37 104.0 38 128.5 39 153.0 40 185.0 41 216.0 42 226.5 43 230.5 44 253.5 45 274.5 46 268.0 47 246.5 48 233.5 49 211.0 50 170.5 51 138.5 52 125.5 53 115.0 54 90.0 55 63.5 56 51.5 57 47.0 58 31.0 59 24.5 60 20.0 61 10.5 62 8.5 63 5.5 64 3.0 65 2.0 66 1.0 67 1.5 68 1.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81669394435352 84.15 2 7.337697763229678 13.450000000000001 3 0.7910529187124932 2.175 4 0.027277686852154936 0.1 5 0.027277686852154936 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9875 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACAGT 10 0.006830828 145.0 1 >>END_MODULE SRR12670978 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670978_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3615 37.0 37.0 37.0 37.0 37.0 2 36.4325 37.0 37.0 37.0 37.0 37.0 3 36.375 37.0 37.0 37.0 37.0 37.0 4 36.3975 37.0 37.0 37.0 37.0 37.0 5 36.3995 37.0 37.0 37.0 37.0 37.0 6 36.485 37.0 37.0 37.0 37.0 37.0 7 36.487 37.0 37.0 37.0 37.0 37.0 8 36.4905 37.0 37.0 37.0 37.0 37.0 9 36.4955 37.0 37.0 37.0 37.0 37.0 10-14 36.5018 37.0 37.0 37.0 37.0 37.0 15-19 36.484 37.0 37.0 37.0 37.0 37.0 20-24 36.4179 37.0 37.0 37.0 37.0 37.0 25-29 36.4012 37.0 37.0 37.0 37.0 37.0 30-34 36.3695 37.0 37.0 37.0 37.0 37.0 35-39 36.421800000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.334 37.0 37.0 37.0 37.0 37.0 45-49 36.3914 37.0 37.0 37.0 37.0 37.0 50-54 36.3255 37.0 37.0 37.0 37.0 37.0 55-59 36.3212 37.0 37.0 37.0 37.0 37.0 60-64 36.308400000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.296 37.0 37.0 37.0 37.0 37.0 70-74 36.2183 37.0 37.0 37.0 37.0 37.0 75-79 36.199799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.26610000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.175 37.0 37.0 37.0 37.0 37.0 90-94 36.1663 37.0 37.0 37.0 37.0 37.0 95-99 36.185700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1884 37.0 37.0 37.0 37.0 37.0 105-109 36.1102 37.0 37.0 37.0 37.0 37.0 110-114 36.0986 37.0 37.0 37.0 37.0 37.0 115-119 36.07245 37.0 37.0 37.0 37.0 37.0 120-124 36.041999999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0022 37.0 37.0 37.0 37.0 37.0 130-134 35.9363 37.0 37.0 37.0 37.0 37.0 135-139 35.9384 37.0 37.0 37.0 37.0 37.0 140-144 35.940650000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7363 37.0 37.0 37.0 37.0 37.0 150-151 35.519999999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 0.0 14 3.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 1.0 23 3.0 24 1.0 25 7.0 26 8.0 27 13.0 28 14.0 29 19.0 30 20.0 31 31.0 32 36.0 33 72.0 34 109.0 35 316.0 36 2718.0 37 622.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.275 22.95 11.175 32.6 2 25.4 27.750000000000004 32.0 14.85 3 20.525 26.674999999999997 32.35 20.45 4 23.150000000000002 34.0 23.65 19.2 5 25.575 36.525 21.75 16.150000000000002 6 20.075000000000003 39.95 22.325 17.65 7 18.9 22.0 39.550000000000004 19.55 8 20.474999999999998 24.275 30.325000000000003 24.925 9 22.425 23.125 31.35 23.1 10-14 23.015 28.945 27.279999999999998 20.76 15-19 23.315 27.675 27.505000000000003 21.505 20-24 22.88 28.49 27.22 21.41 25-29 22.395 28.62 27.915 21.07 30-34 22.814999999999998 27.88 28.435 20.87 35-39 23.044999999999998 28.1 27.650000000000002 21.205 40-44 23.195 27.810000000000002 27.72 21.275 45-49 22.575 27.755000000000003 27.994999999999997 21.675 50-54 23.285 27.634999999999998 27.750000000000004 21.33 55-59 23.04 28.16 28.15 20.65 60-64 23.005 27.85 28.110000000000003 21.035 65-69 22.939999999999998 27.47 28.355000000000004 21.235 70-74 23.205000000000002 27.975 27.310000000000002 21.51 75-79 23.23 27.615000000000002 27.905 21.25 80-84 23.28 27.845 27.18 21.695 85-89 23.345 28.360000000000003 27.185 21.11 90-94 23.125 27.96 27.91 21.005 95-99 23.43 27.865000000000002 27.565 21.14 100-104 23.375 28.345 26.939999999999998 21.34 105-109 23.165 27.61 27.88 21.345 110-114 23.615 28.28 27.029999999999998 21.075 115-119 23.971198559928 27.60638031901595 27.646382319115958 20.776038801940096 120-124 23.425 28.34 27.700000000000003 20.535 125-129 23.875 28.63 27.334999999999997 20.16 130-134 23.69 28.12 26.775 21.415 135-139 23.49 28.095 27.800000000000004 20.615 140-144 23.651182559127957 27.68638431921596 28.10140507025351 20.56102805140257 145-149 24.2 28.139999999999997 26.955000000000002 20.705000000000002 150-151 24.5125 28.825 27.250000000000004 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 1.5 23 0.5 24 1.0 25 4.0 26 7.5 27 6.0 28 6.5 29 12.0 30 15.5 31 16.5 32 22.0 33 36.0 34 49.5 35 69.5 36 91.5 37 109.5 38 133.5 39 161.5 40 202.0 41 217.5 42 233.5 43 251.0 44 270.0 45 285.0 46 257.5 47 240.5 48 228.5 49 199.5 50 173.0 51 141.5 52 117.0 53 104.5 54 83.0 55 58.5 56 38.5 57 33.5 58 27.0 59 20.0 60 19.5 61 14.0 62 9.5 63 9.0 64 3.5 65 0.5 66 0.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41137855579868 83.55 2 7.850109409190371 14.35 3 0.6564551422319475 1.7999999999999998 4 0.08205689277899343 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAGAC 10 0.006830828 145.0 7 AGTCAAG 10 0.006830828 145.0 6 >>END_MODULE Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra Read 568684 spots for SRR12670978.sra Written 568684 spots for SRR12670978.sra Read 568674 spots for SRR12670978.sra Written 568674 spots for SRR12670978.sra SRR ids: ['SRR12670978.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__xqk3orh SRR12670978.sra spots: 11373490 blocks: [[1, 568674], [568675, 1137348], [1137349, 1706022], [1706023, 2274696], [2274697, 2843370], [2843371, 3412044], [3412045, 3980718], [3980719, 4549392], [4549393, 5118066], [5118067, 5686740], [5686741, 6255414], [6255415, 6824088], [6824089, 7392762], [7392763, 7961436], [7961437, 8530110], [8530111, 9098784], [9098785, 9667458], [9667459, 10236132], [10236133, 10804806], [10804807, 11373490]] SRR12670978 file size 3843509 SRR12670978 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670978 SRR12670978_1.fastq SRR12670978_2.fastq Input file: SRR12670978_1.fastq Paired file: SRR12670978_2.fastq trimmed: SRR12670978-trimmed-pair1.fastq, SRR12670978-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:20:04 2025 >> started Tue Feb 11 11:20:21 2025 >> done (17.067s) 11373490 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 554 ( 0.00%) empty read pairs filtered out after trimming by size control 11372915 (99.99%) read pairs available; of these: 480463 ( 4.22%) trimmed read pairs available after processing 10892452 (95.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 1 0.00% 23 6 0.00% 24 2 0.00% 25 1 0.00% 26 5 0.00% 27 4 0.00% 28 6 0.00% 29 7 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 3 0.00% 34 6 0.00% 35 12 0.00% 36 6 0.00% 37 7 0.00% 38 7 0.00% 39 5 0.00% 40 9 0.00% 41 4 0.00% 42 10 0.00% 43 16 0.00% 44 11 0.00% 45 7 0.00% 46 8 0.00% 47 16 0.00% 48 12 0.00% 49 17 0.00% 50 18 0.00% 51 23 0.00% 52 32 0.00% 53 27 0.00% 54 24 0.00% 55 32 0.00% 56 26 0.00% 57 40 0.00% 58 35 0.00% 59 38 0.00% 60 72 0.00% 61 57 0.00% 62 77 0.00% 63 81 0.00% 64 86 0.00% 65 77 0.00% 66 103 0.00% 67 119 0.00% 68 122 0.00% 69 131 0.00% 70 159 0.00% 71 155 0.00% 72 218 0.00% 73 275 0.00% 74 268 0.00% 75 302 0.00% 76 327 0.00% 77 319 0.00% 78 405 0.00% 79 470 0.00% 80 491 0.00% 81 587 0.01% 82 637 0.01% 83 732 0.01% 84 743 0.01% 85 894 0.01% 86 997 0.01% 87 1075 0.01% 88 1177 0.01% 89 1270 0.01% 90 1374 0.01% 91 1430 0.01% 92 1545 0.01% 93 1700 0.01% 94 1804 0.02% 95 2051 0.02% 96 2089 0.02% 97 2280 0.02% 98 2301 0.02% 99 2505 0.02% 100 2689 0.02% 101 2836 0.02% 102 2946 0.03% 103 3011 0.03% 104 3322 0.03% 105 3556 0.03% 106 3748 0.03% 107 3912 0.03% 108 3959 0.03% 109 4392 0.04% 110 4454 0.04% 111 4659 0.04% 112 4828 0.04% 113 4938 0.04% 114 5192 0.05% 115 5530 0.05% 116 5818 0.05% 117 6058 0.05% 118 6288 0.06% 119 6399 0.06% 120 7075 0.06% 121 7201 0.06% 122 7353 0.06% 123 7601 0.07% 124 7842 0.07% 125 8085 0.07% 126 8427 0.07% 127 8711 0.08% 128 9227 0.08% 129 9280 0.08% 130 9803 0.09% 131 9928 0.09% 132 10336 0.09% 133 10412 0.09% 134 10818 0.10% 135 11240 0.10% 136 11588 0.10% 137 11814 0.10% 138 12147 0.11% 139 12993 0.11% 140 13349 0.12% 141 13716 0.12% 142 13949 0.12% 143 14496 0.13% 144 14507 0.13% 145 14914 0.13% 146 15497 0.14% 147 16226 0.14% 148 16588 0.15% 149 17045 0.15% 150 17745 0.16% 151 10892452 95.78% 11372915 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=20.50 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=CATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=28 prefix-density=0.72 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=35.67 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCAAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAG SRR12670978 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:21:06 Started mapping on | Feb 11 11:21:06 Finished on | Feb 11 11:22:50 Mapping speed, Million of reads per hour | 393.68 Number of input reads | 11372915 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 10526835 Uniquely mapped reads % | 92.56% Average mapped length | 298.89 Number of splices: Total | 10707504 Number of splices: Annotated (sjdb) | 10488922 Number of splices: GT/AG | 10500644 Number of splices: GC/AG | 168591 Number of splices: AT/AC | 6962 Number of splices: Non-canonical | 31307 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286931 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 169426 % of reads mapped to too many loci | 1.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559149 559149 559149 N_multimapping 286931 286931 286931 N_noFeature 453965 10350923 501565 N_ambiguous 201387 846 72565 UnstrandedReadsAssigned:9871483 PositiveStrandReadsAssigned:175066 NegativeStrandReadsAssigned:9952705 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670978 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670978-trimmed-pair1.fastq SRR12670978-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,372,915 reads, 9,998,003 reads pseudoaligned [quant] estimated average fragment length: 289.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR12670978.ke.tsv 34699 SRR12670978.se.tsv 87100 total ==> SRR12670978.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.09 495 23.2582 Potri.005G024800.1.v4.1 1035 746.088 194 21.1252 Potri.004G059700.1.v4.1 961 672.323 0 0 Potri.007G009000.2.v4.1 1416 1127.09 0 0 Potri.003G141000.2.v4.1 2943 2654.09 607.974 18.6105 Potri.016G087400.1.v4.1 270 68.4387 520 617.291 Potri.015G069301.1.v4.1 564 291.248 0 0 Potri.010G195200.1.v4.1 1773 1484.09 109 5.96699 Potri.012G127500.1.v4.1 977 688.204 39 4.60401 ==> SRR12670978.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670978 completed mapping pipeline successfully