Starting /dee2/code/volunteer_pipeline.sh SRR12670979 current disk space = 3052636844032 free memory = 1235842620 SRR12670979 SRAfilesize 54699096c591102a47625d4fee7ed40d SRR12670979.sra SRR12670979.sra file validated SRR12670979 is paired end SRR12670979 is conventional basespace SRR12670979 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670979_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4685 37.0 37.0 37.0 37.0 37.0 2 36.42 37.0 37.0 37.0 37.0 37.0 3 36.542 37.0 37.0 37.0 37.0 37.0 4 36.59 37.0 37.0 37.0 37.0 37.0 5 36.6565 37.0 37.0 37.0 37.0 37.0 6 36.5645 37.0 37.0 37.0 37.0 37.0 7 36.577 37.0 37.0 37.0 37.0 37.0 8 36.646 37.0 37.0 37.0 37.0 37.0 9 36.5485 37.0 37.0 37.0 37.0 37.0 10-14 36.6092 37.0 37.0 37.0 37.0 37.0 15-19 36.603300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5438 37.0 37.0 37.0 37.0 37.0 25-29 36.517199999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4448 37.0 37.0 37.0 37.0 37.0 35-39 36.4709 37.0 37.0 37.0 37.0 37.0 40-44 36.4822 37.0 37.0 37.0 37.0 37.0 45-49 36.417100000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.412699999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.337799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.345800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3374 37.0 37.0 37.0 37.0 37.0 70-74 36.370000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.321200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.267900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2614 37.0 37.0 37.0 37.0 37.0 90-94 36.216699999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1652 37.0 37.0 37.0 37.0 37.0 100-104 36.1639 37.0 37.0 37.0 37.0 37.0 105-109 36.09680000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.132400000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0372 37.0 37.0 37.0 37.0 37.0 120-124 35.993900000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.00449999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8703 37.0 37.0 37.0 37.0 37.0 135-139 35.9108 37.0 37.0 37.0 37.0 37.0 140-144 35.8331 37.0 37.0 37.0 37.0 37.0 145-149 35.719500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.538 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 0.0 23 3.0 24 2.0 25 6.0 26 2.0 27 7.0 28 11.0 29 27.0 30 36.0 31 42.0 32 62.0 33 85.0 34 109.0 35 241.0 36 2645.0 37 719.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.672336168084044 10.355177588794398 6.353176588294147 38.61930965482742 2 19.05 10.6 40.65 29.7 3 17.825 16.05 29.275000000000002 36.85 4 23.25 22.525000000000002 23.35 30.875000000000004 5 23.075000000000003 30.375000000000004 25.174999999999997 21.375 6 19.400000000000002 34.65 23.9 22.05 7 15.6 25.924999999999997 42.275 16.2 8 16.075 25.2 34.849999999999994 23.875 9 17.349999999999998 22.825 35.775 24.05 10-14 19.7 30.09 28.615000000000002 21.595 15-19 20.29 27.825 28.32 23.565 20-24 20.025000000000002 27.750000000000004 27.955000000000002 24.27 25-29 20.34 29.054999999999996 27.455000000000002 23.150000000000002 30-34 19.78 28.65 27.08 24.490000000000002 35-39 19.93 28.660000000000004 27.950000000000003 23.46 40-44 20.200000000000003 28.655 27.97 23.175 45-49 19.845 28.08 27.810000000000002 24.265 50-54 20.125 27.955000000000002 27.375 24.545 55-59 19.715 28.035 27.825 24.425 60-64 20.5 27.994999999999997 27.325 24.18 65-69 20.115 27.705000000000002 28.12 24.060000000000002 70-74 20.474999999999998 28.53 27.105 23.89 75-79 19.875 28.625 28.08 23.419999999999998 80-84 20.43 28.57 27.560000000000002 23.44 85-89 20.369999999999997 29.104999999999997 27.150000000000002 23.375 90-94 20.169999999999998 28.144999999999996 27.384999999999998 24.3 95-99 19.7 27.93 27.91 24.46 100-104 20.145 28.33 27.284999999999997 24.240000000000002 105-109 20.195 27.994999999999997 27.82 23.990000000000002 110-114 20.57 27.875 27.675 23.880000000000003 115-119 21.075 28.625 27.27 23.03 120-124 20.455000000000002 29.07 26.745 23.73 125-129 20.69 28.74 26.855 23.715 130-134 20.53 28.08 27.735 23.655 135-139 20.845 27.625 27.42 24.11 140-144 20.955 27.794999999999998 27.33 23.919999999999998 145-149 20.49 28.575 26.93 24.005000000000003 150-151 19.8875 27.925 27.3875 24.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.5 21 4.0 22 2.0 23 2.5 24 4.5 25 6.0 26 8.0 27 9.0 28 10.0 29 11.0 30 14.0 31 18.0 32 32.0 33 48.5 34 57.5 35 68.5 36 87.5 37 97.0 38 108.5 39 140.0 40 176.5 41 209.0 42 224.5 43 245.0 44 259.0 45 269.5 46 261.5 47 244.5 48 247.5 49 233.0 50 206.0 51 155.5 52 120.0 53 98.5 54 79.0 55 65.0 56 44.5 57 34.5 58 27.0 59 22.0 60 16.0 61 10.0 62 4.5 63 3.5 64 3.5 65 2.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.75 #Duplication Level Percentage of deduplicated Percentage of total 1 90.74380165289256 82.35 2 8.457300275482094 15.35 3 0.6887052341597797 1.875 4 0.08264462809917356 0.3 5 0.027548209366391182 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 3.0 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138-139 3.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670979 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670979_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.235 37.0 37.0 37.0 37.0 37.0 2 36.293 37.0 37.0 37.0 37.0 37.0 3 36.3855 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.378 37.0 37.0 37.0 37.0 37.0 7 36.2885 37.0 37.0 37.0 37.0 37.0 8 36.415 37.0 37.0 37.0 37.0 37.0 9 36.359 37.0 37.0 37.0 37.0 37.0 10-14 36.405100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3652 37.0 37.0 37.0 37.0 37.0 20-24 36.3412 37.0 37.0 37.0 37.0 37.0 25-29 36.2742 37.0 37.0 37.0 37.0 37.0 30-34 36.3096 37.0 37.0 37.0 37.0 37.0 35-39 36.267599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.2243 37.0 37.0 37.0 37.0 37.0 45-49 36.204899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2649 37.0 37.0 37.0 37.0 37.0 55-59 36.1919 37.0 37.0 37.0 37.0 37.0 60-64 36.1836 37.0 37.0 37.0 37.0 37.0 65-69 36.1942 37.0 37.0 37.0 37.0 37.0 70-74 36.1796 37.0 37.0 37.0 37.0 37.0 75-79 36.12230000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1226 37.0 37.0 37.0 37.0 37.0 85-89 36.0717 37.0 37.0 37.0 37.0 37.0 90-94 36.074000000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.10459999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.0449 37.0 37.0 37.0 37.0 37.0 105-109 36.035399999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9468 37.0 37.0 37.0 37.0 37.0 115-119 35.9357 37.0 37.0 37.0 37.0 37.0 120-124 35.7889 37.0 37.0 37.0 37.0 37.0 125-129 35.820299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.819900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8452 37.0 37.0 37.0 37.0 37.0 140-144 35.798899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4891 37.0 37.0 37.0 37.0 37.0 150-151 35.2745 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 3.0 15 2.0 16 2.0 17 0.0 18 0.0 19 2.0 20 1.0 21 0.0 22 3.0 23 1.0 24 5.0 25 10.0 26 10.0 27 14.0 28 14.0 29 14.0 30 27.0 31 30.0 32 56.0 33 90.0 34 115.0 35 363.0 36 2669.0 37 563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.949999999999996 23.875 9.5 24.675 2 27.525 24.175 31.424999999999997 16.875 3 21.25 24.9 34.8 19.05 4 25.35 33.050000000000004 22.725 18.875 5 25.95 37.375 20.325 16.35 6 21.05 40.825 20.75 17.375 7 20.45 23.075000000000003 37.724999999999994 18.75 8 20.3 25.124999999999996 29.549999999999997 25.025 9 22.625 25.45 29.375 22.55 10-14 23.07 29.220000000000002 26.86 20.849999999999998 15-19 23.75 28.08 27.765 20.405 20-24 22.939999999999998 28.775000000000002 26.900000000000002 21.385 25-29 23.125 28.515 27.439999999999998 20.919999999999998 30-34 22.985 27.905 27.905 21.205 35-39 22.91 28.62 27.029999999999998 21.44 40-44 23.35 27.96 27.779999999999998 20.91 45-49 22.645 28.275 27.889999999999997 21.19 50-54 23.27 28.21 27.134999999999998 21.385 55-59 22.855 28.26 27.750000000000004 21.135 60-64 23.330000000000002 28.315 27.584999999999997 20.77 65-69 23.599999999999998 27.455000000000002 27.755000000000003 21.19 70-74 23.985 28.065 26.810000000000002 21.14 75-79 23.0 28.249999999999996 26.905 21.845 80-84 23.06 27.779999999999998 27.875 21.285 85-89 23.9 27.71 26.939999999999998 21.45 90-94 23.775 27.48 27.405 21.34 95-99 22.825 28.375 27.450000000000003 21.349999999999998 100-104 23.794999999999998 27.76 27.88 20.565 105-109 23.369999999999997 27.805000000000003 27.74 21.085 110-114 23.855 27.735 27.994999999999997 20.415 115-119 23.955000000000002 28.425 26.86 20.76 120-124 23.845 28.000000000000004 27.665 20.49 125-129 23.985 27.71 27.389999999999997 20.915 130-134 24.145 28.225 27.474999999999998 20.155 135-139 24.3 27.77 27.505000000000003 20.424999999999997 140-144 24.565 28.165000000000003 26.729999999999997 20.54 145-149 24.8 27.85 26.995 20.355 150-151 24.3 27.9375 27.325 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 2.5 26 2.5 27 4.0 28 5.5 29 8.5 30 13.5 31 18.0 32 24.0 33 35.5 34 46.5 35 62.5 36 76.0 37 98.5 38 132.0 39 157.5 40 184.5 41 225.5 42 244.0 43 263.5 44 264.5 45 258.5 46 266.5 47 261.0 48 245.0 49 208.5 50 180.5 51 150.0 52 115.5 53 94.5 54 87.5 55 68.0 56 50.0 57 36.0 58 27.0 59 26.0 60 15.5 61 5.5 62 4.0 63 3.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2661356770118 83.075 2 7.854984894259818 14.299999999999999 3 0.7415545179895633 2.025 4 0.10985992859104642 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027464982147761604 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.475 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 3.0875000000000004 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATGG 10 0.006830828 145.0 5 GTGGTGG 10 0.006830828 145.0 145 AAAAAAA 25 4.977651E-4 29.0 90-94 >>END_MODULE Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643633 spots for SRR12670979.sra Written 643633 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra Read 643630 spots for SRR12670979.sra Written 643630 spots for SRR12670979.sra SRR ids: ['SRR12670979.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hdge0hsu SRR12670979.sra spots: 12872603 blocks: [[1, 643630], [643631, 1287260], [1287261, 1930890], [1930891, 2574520], [2574521, 3218150], [3218151, 3861780], [3861781, 4505410], [4505411, 5149040], [5149041, 5792670], [5792671, 6436300], [6436301, 7079930], [7079931, 7723560], [7723561, 8367190], [8367191, 9010820], [9010821, 9654450], [9654451, 10298080], [10298081, 10941710], [10941711, 11585340], [11585341, 12228970], [12228971, 12872603]] SRR12670979 file size 4352973 SRR12670979 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670979 SRR12670979_1.fastq SRR12670979_2.fastq Input file: SRR12670979_1.fastq Paired file: SRR12670979_2.fastq trimmed: SRR12670979-trimmed-pair1.fastq, SRR12670979-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:55:44 2025 >> started Tue Feb 11 10:56:05 2025 >> done (20.894s) 12872603 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 2034 ( 0.02%) empty read pairs filtered out after trimming by size control 12870525 (99.98%) read pairs available; of these: 736992 ( 5.73%) trimmed read pairs available after processing 12133533 (94.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 0 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 7 0.00% 27 9 0.00% 28 6 0.00% 29 5 0.00% 30 10 0.00% 31 13 0.00% 32 13 0.00% 33 13 0.00% 34 10 0.00% 35 7 0.00% 36 13 0.00% 37 9 0.00% 38 15 0.00% 39 14 0.00% 40 20 0.00% 41 13 0.00% 42 13 0.00% 43 26 0.00% 44 16 0.00% 45 23 0.00% 46 30 0.00% 47 16 0.00% 48 26 0.00% 49 28 0.00% 50 40 0.00% 51 44 0.00% 52 49 0.00% 53 66 0.00% 54 53 0.00% 55 60 0.00% 56 73 0.00% 57 77 0.00% 58 74 0.00% 59 71 0.00% 60 119 0.00% 61 125 0.00% 62 172 0.00% 63 186 0.00% 64 189 0.00% 65 234 0.00% 66 244 0.00% 67 279 0.00% 68 305 0.00% 69 336 0.00% 70 411 0.00% 71 462 0.00% 72 533 0.00% 73 619 0.00% 74 650 0.01% 75 741 0.01% 76 742 0.01% 77 848 0.01% 78 937 0.01% 79 1025 0.01% 80 1137 0.01% 81 1262 0.01% 82 1392 0.01% 83 1558 0.01% 84 1671 0.01% 85 1929 0.01% 86 1960 0.02% 87 2202 0.02% 88 2337 0.02% 89 2454 0.02% 90 2597 0.02% 91 2781 0.02% 92 2901 0.02% 93 3235 0.03% 94 3413 0.03% 95 3811 0.03% 96 3923 0.03% 97 4037 0.03% 98 4207 0.03% 99 4440 0.03% 100 4726 0.04% 101 4917 0.04% 102 5223 0.04% 103 5315 0.04% 104 5602 0.04% 105 5749 0.04% 106 6306 0.05% 107 6726 0.05% 108 6859 0.05% 109 6797 0.05% 110 7117 0.06% 111 7527 0.06% 112 7810 0.06% 113 7811 0.06% 114 8221 0.06% 115 8776 0.07% 116 9079 0.07% 117 9535 0.07% 118 9679 0.08% 119 10060 0.08% 120 10684 0.08% 121 10786 0.08% 122 11142 0.09% 123 11448 0.09% 124 12156 0.09% 125 12099 0.09% 126 12894 0.10% 127 13125 0.10% 128 13786 0.11% 129 14270 0.11% 130 14475 0.11% 131 14778 0.11% 132 15235 0.12% 133 15883 0.12% 134 16185 0.13% 135 16562 0.13% 136 17265 0.13% 137 17652 0.14% 138 18535 0.14% 139 19137 0.15% 140 19330 0.15% 141 19695 0.15% 142 20378 0.16% 143 20786 0.16% 144 21475 0.17% 145 21778 0.17% 146 22420 0.17% 147 22983 0.18% 148 23688 0.18% 149 24208 0.19% 150 24933 0.19% 151 12133533 94.27% 12870525 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.67 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=12.72 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.8 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=28 prefix-density=0.78 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=24.27 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.4 sequence=CCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670979 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:56:53 Started mapping on | Feb 11 10:56:53 Finished on | Feb 11 10:58:19 Mapping speed, Million of reads per hour | 538.77 Number of input reads | 12870525 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12044619 Uniquely mapped reads % | 93.58% Average mapped length | 297.88 Number of splices: Total | 12568555 Number of splices: Annotated (sjdb) | 12329528 Number of splices: GT/AG | 12308690 Number of splices: GC/AG | 218105 Number of splices: AT/AC | 7388 Number of splices: Non-canonical | 34372 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278139 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 48514 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547767 547767 547767 N_multimapping 278139 278139 278139 N_noFeature 395345 11872745 443909 N_ambiguous 203059 717 79350 UnstrandedReadsAssigned:11446215 PositiveStrandReadsAssigned:171157 NegativeStrandReadsAssigned:11521360 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670979 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670979-trimmed-pair1.fastq SRR12670979-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,870,525 reads, 11,497,706 reads pseudoaligned [quant] estimated average fragment length: 271.32 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12670979.ke.tsv 34699 SRR12670979.se.tsv 87100 total ==> SRR12670979.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.68 415 17.8807 Potri.005G024800.1.v4.1 1035 764.68 159 15.6572 Potri.004G059700.1.v4.1 961 690.831 0 0 Potri.007G009000.2.v4.1 1416 1145.68 0 0 Potri.003G141000.2.v4.1 2943 2672.68 867 24.427 Potri.016G087400.1.v4.1 270 73.0202 513 529.02 Potri.015G069301.1.v4.1 564 305.382 0 0 Potri.010G195200.1.v4.1 1773 1502.68 39 1.95432 Potri.012G127500.1.v4.1 977 706.748 15 1.59818 ==> SRR12670979.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 76 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12670979 completed mapping pipeline successfully