Starting /dee2/code/volunteer_pipeline.sh SRR12670980 current disk space = 3052296822784 free memory = 1463622496 SRR12670980 SRAfilesize cf4fc7a306c2e216b48eb8bf0be0140e SRR12670980.sra SRR12670980.sra file validated SRR12670980 is paired end SRR12670980 is conventional basespace SRR12670980 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670980_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41425 37.0 37.0 37.0 37.0 37.0 2 36.4495 37.0 37.0 37.0 37.0 37.0 3 36.54 37.0 37.0 37.0 37.0 37.0 4 36.5305 37.0 37.0 37.0 37.0 37.0 5 36.652 37.0 37.0 37.0 37.0 37.0 6 36.609 37.0 37.0 37.0 37.0 37.0 7 36.5555 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.581 37.0 37.0 37.0 37.0 37.0 10-14 36.5877 37.0 37.0 37.0 37.0 37.0 15-19 36.596999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4996 37.0 37.0 37.0 37.0 37.0 25-29 36.432 37.0 37.0 37.0 37.0 37.0 30-34 36.37949999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4301 37.0 37.0 37.0 37.0 37.0 40-44 36.4061 37.0 37.0 37.0 37.0 37.0 45-49 36.3869 37.0 37.0 37.0 37.0 37.0 50-54 36.363800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.322 37.0 37.0 37.0 37.0 37.0 60-64 36.3126 37.0 37.0 37.0 37.0 37.0 65-69 36.2769 37.0 37.0 37.0 37.0 37.0 70-74 36.292699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.24870000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2294 37.0 37.0 37.0 37.0 37.0 85-89 36.2153 37.0 37.0 37.0 37.0 37.0 90-94 36.2113 37.0 37.0 37.0 37.0 37.0 95-99 36.167 37.0 37.0 37.0 37.0 37.0 100-104 36.156200000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1235 37.0 37.0 37.0 37.0 37.0 110-114 36.0895 37.0 37.0 37.0 37.0 37.0 115-119 36.0479 37.0 37.0 37.0 37.0 37.0 120-124 36.003099999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0071 37.0 37.0 37.0 37.0 37.0 130-134 35.8095 37.0 37.0 37.0 37.0 37.0 135-139 35.863 37.0 37.0 37.0 37.0 37.0 140-144 35.821400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.689 37.0 37.0 37.0 37.0 37.0 150-151 35.53 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 10.0 27 6.0 28 15.0 29 27.0 30 40.0 31 50.0 32 55.0 33 82.0 34 112.0 35 255.0 36 2676.0 37 663.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.261946459844886 11.358518889166875 5.629221916437328 33.75031273455092 2 18.35 11.125 37.65 32.875 3 16.175 17.224999999999998 29.25 37.35 4 22.125 22.1 26.6 29.175 5 24.275 29.95 23.575 22.2 6 19.6 34.275 23.3 22.825 7 14.975 25.900000000000002 43.225 15.9 8 15.9 25.775 33.625 24.7 9 16.85 23.95 35.9 23.3 10-14 19.465 29.885 28.27 22.38 15-19 20.345 27.639999999999997 28.139999999999997 23.875 20-24 19.38 28.64 28.144999999999996 23.835 25-29 19.97 29.160000000000004 27.405 23.465 30-34 19.814999999999998 27.950000000000003 28.65 23.585 35-39 20.24 28.275 28.015 23.47 40-44 19.575 28.595 28.595 23.235 45-49 20.135 28.59 27.43 23.845 50-54 20.1 28.63 27.18 24.09 55-59 20.015 28.535 27.54 23.91 60-64 19.955000000000002 28.21 28.095 23.74 65-69 20.255000000000003 28.565 27.555000000000003 23.625 70-74 20.69 28.49 27.41 23.41 75-79 20.365 28.74 27.21 23.685000000000002 80-84 20.0 28.51 27.284999999999997 24.205 85-89 20.935000000000002 27.805000000000003 27.49 23.77 90-94 20.294999999999998 27.985 28.139999999999997 23.580000000000002 95-99 20.419999999999998 28.585 27.51 23.485 100-104 19.994999999999997 28.83 27.544999999999998 23.630000000000003 105-109 20.705000000000002 28.13 27.185 23.98 110-114 20.49 28.625 27.55 23.335 115-119 21.14 28.000000000000004 27.295 23.565 120-124 20.330000000000002 28.26 27.515 23.895 125-129 20.195 28.49 27.015 24.3 130-134 20.385 28.360000000000003 27.485 23.77 135-139 20.715 27.800000000000004 27.279999999999998 24.205 140-144 21.185000000000002 27.675 27.37 23.77 145-149 20.169999999999998 28.215 27.115000000000002 24.5 150-151 21.125 27.537499999999998 28.1 23.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 2.0 24 2.5 25 5.0 26 7.5 27 11.0 28 13.5 29 16.5 30 26.5 31 33.5 32 35.0 33 40.0 34 54.0 35 73.5 36 91.0 37 105.5 38 127.5 39 146.5 40 168.5 41 209.5 42 258.0 43 252.5 44 228.0 45 240.0 46 243.0 47 243.5 48 235.0 49 204.5 50 178.0 51 162.0 52 128.0 53 97.0 54 81.5 55 61.5 56 50.5 57 43.5 58 31.5 59 27.5 60 20.5 61 11.0 62 6.5 63 3.5 64 3.5 65 2.0 66 0.5 67 0.0 68 0.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.02504082743603 84.52499999999999 2 7.212847033206314 13.25 3 0.6532389765922699 1.7999999999999998 4 0.08165487207403374 0.3 5 0.027218290691344585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGAT 10 0.006830828 145.0 8 >>END_MODULE SRR12670980 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670980_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2375 37.0 37.0 37.0 37.0 37.0 2 36.3195 37.0 37.0 37.0 37.0 37.0 3 36.3475 37.0 37.0 37.0 37.0 37.0 4 36.2635 37.0 37.0 37.0 37.0 37.0 5 36.3545 37.0 37.0 37.0 37.0 37.0 6 36.368 37.0 37.0 37.0 37.0 37.0 7 36.434 37.0 37.0 37.0 37.0 37.0 8 36.428 37.0 37.0 37.0 37.0 37.0 9 36.3575 37.0 37.0 37.0 37.0 37.0 10-14 36.40410000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.3797 37.0 37.0 37.0 37.0 37.0 20-24 36.3793 37.0 37.0 37.0 37.0 37.0 25-29 36.3485 37.0 37.0 37.0 37.0 37.0 30-34 36.3134 37.0 37.0 37.0 37.0 37.0 35-39 36.272 37.0 37.0 37.0 37.0 37.0 40-44 36.2425 37.0 37.0 37.0 37.0 37.0 45-49 36.2667 37.0 37.0 37.0 37.0 37.0 50-54 36.2194 37.0 37.0 37.0 37.0 37.0 55-59 36.1729 37.0 37.0 37.0 37.0 37.0 60-64 36.16799999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.192800000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.1713 37.0 37.0 37.0 37.0 37.0 75-79 36.1526 37.0 37.0 37.0 37.0 37.0 80-84 36.109 37.0 37.0 37.0 37.0 37.0 85-89 36.10209999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.080999999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.096 37.0 37.0 37.0 37.0 37.0 100-104 36.068799999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9795 37.0 37.0 37.0 37.0 37.0 110-114 35.9706 37.0 37.0 37.0 37.0 37.0 115-119 35.9631 37.0 37.0 37.0 37.0 37.0 120-124 35.856100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7835 37.0 37.0 37.0 37.0 37.0 130-134 35.8258 37.0 37.0 37.0 37.0 37.0 135-139 35.836400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7606 37.0 37.0 37.0 37.0 37.0 145-149 35.65650000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.31625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 1.0 15 5.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 0.0 23 9.0 24 3.0 25 7.0 26 10.0 27 13.0 28 17.0 29 22.0 30 19.0 31 40.0 32 47.0 33 71.0 34 134.0 35 327.0 36 2697.0 37 568.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.45 25.174999999999997 7.625 21.75 2 28.549999999999997 24.474999999999998 30.825000000000003 16.150000000000002 3 19.775000000000002 26.8 34.8 18.625 4 24.65 33.324999999999996 23.025000000000002 19.0 5 25.85 36.7 20.825 16.625 6 19.3 40.225 21.7 18.775 7 20.974999999999998 22.925 37.475 18.625 8 20.625 25.75 28.225 25.4 9 22.5 24.2 30.525000000000002 22.775000000000002 10-14 22.875 29.794999999999998 26.640000000000004 20.69 15-19 23.53 27.925 27.26 21.285 20-24 23.575 28.794999999999998 26.625 21.005 25-29 22.865 28.689999999999998 28.09 20.355 30-34 23.79 28.33 27.560000000000002 20.32 35-39 24.035 28.389999999999997 27.500000000000004 20.075000000000003 40-44 23.119999999999997 28.849999999999998 27.16 20.87 45-49 23.400000000000002 28.199999999999996 27.439999999999998 20.96 50-54 22.715 27.944999999999997 27.900000000000002 21.44 55-59 22.91 27.794999999999998 28.110000000000003 21.185000000000002 60-64 23.724999999999998 27.915 27.55 20.810000000000002 65-69 23.549999999999997 27.46 27.87 21.12 70-74 22.905 27.54 28.23 21.325 75-79 23.27 27.894999999999996 27.595 21.240000000000002 80-84 23.31 28.110000000000003 27.3 21.279999999999998 85-89 23.435 26.955000000000002 28.125 21.485000000000003 90-94 23.575 27.389999999999997 28.165000000000003 20.87 95-99 23.54 27.88 27.134999999999998 21.445 100-104 23.580000000000002 28.349999999999998 27.915 20.155 105-109 23.294999999999998 28.435 27.975 20.294999999999998 110-114 23.79 28.665000000000003 27.07 20.474999999999998 115-119 23.94 27.79 28.000000000000004 20.27 120-124 24.08 28.050000000000004 27.534999999999997 20.335 125-129 23.315 28.22 27.965 20.5 130-134 24.3 27.62 27.615000000000002 20.465 135-139 24.285 27.474999999999998 27.855 20.385 140-144 24.23 27.87 27.584999999999997 20.315 145-149 24.6 28.110000000000003 26.715 20.575 150-151 24.975 29.012500000000003 26.174999999999997 19.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 1.0 5 1.0 6 0.0 7 0.5 8 1.0 9 1.5 10 1.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.5 18 2.0 19 0.5 20 1.5 21 1.5 22 2.5 23 3.5 24 4.0 25 6.0 26 8.5 27 9.5 28 9.5 29 12.0 30 14.0 31 20.0 32 26.0 33 24.5 34 38.0 35 60.0 36 80.0 37 100.5 38 132.0 39 171.0 40 201.0 41 211.5 42 236.0 43 269.5 44 263.5 45 255.5 46 268.5 47 258.5 48 235.0 49 188.0 50 151.5 51 147.0 52 114.0 53 89.0 54 77.5 55 66.5 56 55.5 57 38.0 58 27.5 59 27.0 60 20.0 61 12.0 62 13.5 63 11.5 64 4.5 65 1.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 1.5 72 2.0 73 2.0 74 1.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.05442176870748 84.575 2 7.26530612244898 13.350000000000001 3 0.5170068027210885 1.425 4 0.13605442176870747 0.5 5 0.0 0.0 6 0.027210884353741496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCAAA 10 0.006830828 145.0 8 TTAGCAA 10 0.006830828 145.0 7 >>END_MODULE Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710112 spots for SRR12670980.sra Written 710112 spots for SRR12670980.sra Read 710128 spots for SRR12670980.sra Written 710128 spots for SRR12670980.sra SRR ids: ['SRR12670980.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m2ffb3dr SRR12670980.sra spots: 14202256 blocks: [[1, 710112], [710113, 1420224], [1420225, 2130336], [2130337, 2840448], [2840449, 3550560], [3550561, 4260672], [4260673, 4970784], [4970785, 5680896], [5680897, 6391008], [6391009, 7101120], [7101121, 7811232], [7811233, 8521344], [8521345, 9231456], [9231457, 9941568], [9941569, 10651680], [10651681, 11361792], [11361793, 12071904], [12071905, 12782016], [12782017, 13492128], [13492129, 14202256]] SRR12670980 file size 4804847 SRR12670980 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670980 SRR12670980_1.fastq SRR12670980_2.fastq Input file: SRR12670980_1.fastq Paired file: SRR12670980_2.fastq trimmed: SRR12670980-trimmed-pair1.fastq, SRR12670980-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:12:32 2025 >> started Tue Feb 11 11:12:48 2025 >> done (15.982s) 14202256 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 6219 ( 0.04%) empty read pairs filtered out after trimming by size control 14195963 (99.96%) read pairs available; of these: 656671 ( 4.63%) trimmed read pairs available after processing 13539292 (95.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 8 0.00% 21 5 0.00% 22 13 0.00% 23 9 0.00% 24 5 0.00% 25 15 0.00% 26 12 0.00% 27 13 0.00% 28 21 0.00% 29 10 0.00% 30 28 0.00% 31 17 0.00% 32 15 0.00% 33 12 0.00% 34 13 0.00% 35 19 0.00% 36 7 0.00% 37 9 0.00% 38 16 0.00% 39 19 0.00% 40 14 0.00% 41 17 0.00% 42 10 0.00% 43 23 0.00% 44 23 0.00% 45 20 0.00% 46 27 0.00% 47 33 0.00% 48 30 0.00% 49 33 0.00% 50 44 0.00% 51 45 0.00% 52 43 0.00% 53 40 0.00% 54 65 0.00% 55 43 0.00% 56 39 0.00% 57 51 0.00% 58 79 0.00% 59 105 0.00% 60 84 0.00% 61 103 0.00% 62 130 0.00% 63 168 0.00% 64 135 0.00% 65 173 0.00% 66 184 0.00% 67 188 0.00% 68 229 0.00% 69 311 0.00% 70 304 0.00% 71 329 0.00% 72 391 0.00% 73 442 0.00% 74 522 0.00% 75 623 0.00% 76 646 0.00% 77 669 0.00% 78 707 0.00% 79 854 0.01% 80 901 0.01% 81 1003 0.01% 82 1202 0.01% 83 1328 0.01% 84 1347 0.01% 85 1583 0.01% 86 1700 0.01% 87 1750 0.01% 88 1896 0.01% 89 1988 0.01% 90 2170 0.02% 91 2325 0.02% 92 2519 0.02% 93 2914 0.02% 94 2846 0.02% 95 3171 0.02% 96 3296 0.02% 97 3557 0.03% 98 3746 0.03% 99 3889 0.03% 100 4111 0.03% 101 4285 0.03% 102 4592 0.03% 103 4733 0.03% 104 4837 0.03% 105 5275 0.04% 106 5500 0.04% 107 5654 0.04% 108 6003 0.04% 109 5937 0.04% 110 6355 0.04% 111 6616 0.05% 112 6963 0.05% 113 7091 0.05% 114 7429 0.05% 115 7821 0.06% 116 8133 0.06% 117 8627 0.06% 118 8578 0.06% 119 8838 0.06% 120 9356 0.07% 121 9694 0.07% 122 10176 0.07% 123 10517 0.07% 124 10706 0.08% 125 11285 0.08% 126 11584 0.08% 127 11932 0.08% 128 12081 0.09% 129 12860 0.09% 130 13133 0.09% 131 13236 0.09% 132 13759 0.10% 133 14187 0.10% 134 14494 0.10% 135 15093 0.11% 136 15397 0.11% 137 15616 0.11% 138 16162 0.11% 139 17006 0.12% 140 17122 0.12% 141 17883 0.13% 142 17980 0.13% 143 18912 0.13% 144 19514 0.14% 145 19802 0.14% 146 20240 0.14% 147 20480 0.14% 148 21399 0.15% 149 21952 0.15% 150 22352 0.16% 151 13539292 95.37% 14195963 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=84.88 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.4 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=27 prefix-density=0.59 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=19.19 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.0 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670980 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:13:33 Started mapping on | Feb 11 11:13:33 Finished on | Feb 11 11:15:18 Mapping speed, Million of reads per hour | 486.72 Number of input reads | 14195963 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13026704 Uniquely mapped reads % | 91.76% Average mapped length | 298.40 Number of splices: Total | 13154093 Number of splices: Annotated (sjdb) | 12884849 Number of splices: GT/AG | 12888809 Number of splices: GC/AG | 217974 Number of splices: AT/AC | 7646 Number of splices: Non-canonical | 39664 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324991 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 188735 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.34% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 844268 844268 844268 N_multimapping 324991 324991 324991 N_noFeature 551282 12828470 611068 N_ambiguous 228670 955 89839 UnstrandedReadsAssigned:12246752 PositiveStrandReadsAssigned:197279 NegativeStrandReadsAssigned:12325797 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670980 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670980-trimmed-pair1.fastq SRR12670980-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,195,963 reads, 12,446,973 reads pseudoaligned [quant] estimated average fragment length: 289.344 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR12670980.ke.tsv 34699 SRR12670980.se.tsv 87100 total ==> SRR12670980.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.66 427 17.4229 Potri.005G024800.1.v4.1 1035 746.656 149 14.0837 Potri.004G059700.1.v4.1 961 672.933 3 0.314631 Potri.007G009000.2.v4.1 1416 1127.66 0 0 Potri.003G141000.2.v4.1 2943 2654.66 772 20.524 Potri.016G087400.1.v4.1 270 70.0902 504.449 507.94 Potri.015G069301.1.v4.1 564 293.045 0 0 Potri.010G195200.1.v4.1 1773 1484.66 100 4.75364 Potri.012G127500.1.v4.1 977 688.796 88 9.01663 ==> SRR12670980.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 240 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670980 completed mapping pipeline successfully