Starting /dee2/code/volunteer_pipeline.sh SRR12670981 current disk space = 3051656208384 free memory = 1514736308 SRR12670981 SRAfilesize 6cfde4e84667298baccb6947f1aa7910 SRR12670981.sra SRR12670981.sra file validated SRR12670981 is paired end SRR12670981 is conventional basespace SRR12670981 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670981_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44575 37.0 37.0 37.0 37.0 37.0 2 36.4055 37.0 37.0 37.0 37.0 37.0 3 36.6065 37.0 37.0 37.0 37.0 37.0 4 36.6315 37.0 37.0 37.0 37.0 37.0 5 36.6445 37.0 37.0 37.0 37.0 37.0 6 36.6175 37.0 37.0 37.0 37.0 37.0 7 36.5455 37.0 37.0 37.0 37.0 37.0 8 36.579 37.0 37.0 37.0 37.0 37.0 9 36.561 37.0 37.0 37.0 37.0 37.0 10-14 36.6417 37.0 37.0 37.0 37.0 37.0 15-19 36.601600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.58980000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.566500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5379 37.0 37.0 37.0 37.0 37.0 35-39 36.497899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.5065 37.0 37.0 37.0 37.0 37.0 45-49 36.469500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4666 37.0 37.0 37.0 37.0 37.0 55-59 36.476099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3941 37.0 37.0 37.0 37.0 37.0 65-69 36.4054 37.0 37.0 37.0 37.0 37.0 70-74 36.4433 37.0 37.0 37.0 37.0 37.0 75-79 36.337 37.0 37.0 37.0 37.0 37.0 80-84 36.337399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.3209 37.0 37.0 37.0 37.0 37.0 90-94 36.26649999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2565 37.0 37.0 37.0 37.0 37.0 100-104 36.2177 37.0 37.0 37.0 37.0 37.0 105-109 36.1965 37.0 37.0 37.0 37.0 37.0 110-114 36.1875 37.0 37.0 37.0 37.0 37.0 115-119 36.1576 37.0 37.0 37.0 37.0 37.0 120-124 36.1395 37.0 37.0 37.0 37.0 37.0 125-129 36.095800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.910399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9457 37.0 37.0 37.0 37.0 37.0 140-144 35.876099999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.7859 37.0 37.0 37.0 37.0 37.0 150-151 35.57475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 2.0 23 1.0 24 2.0 25 3.0 26 5.0 27 4.0 28 13.0 29 26.0 30 24.0 31 37.0 32 51.0 33 64.0 34 97.0 35 237.0 36 2741.0 37 689.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.011758819114334 11.43357518138604 4.653490117588191 34.901175881911435 2 18.45 10.05 38.074999999999996 33.425 3 16.975 14.875 29.025000000000002 39.125 4 22.825 21.349999999999998 25.424999999999997 30.4 5 22.35 30.3 24.825 22.525000000000002 6 20.5 32.5 23.775 23.225 7 14.975 28.025 41.925000000000004 15.075 8 15.675 25.2 35.05 24.075 9 17.45 23.7 35.55 23.3 10-14 18.865000000000002 30.595 28.275 22.264999999999997 15-19 19.5 27.91 28.365000000000002 24.224999999999998 20-24 19.495 28.46 28.555000000000003 23.49 25-29 19.875 29.13 28.08 22.915 30-34 19.975 27.915 27.560000000000002 24.55 35-39 19.634999999999998 28.46 27.57 24.335 40-44 19.23 29.060000000000002 28.205000000000002 23.505000000000003 45-49 20.0 28.78 27.900000000000002 23.32 50-54 20.485 28.904999999999998 27.26 23.35 55-59 19.71 28.625 27.875 23.79 60-64 20.105 28.205000000000002 27.91 23.78 65-69 20.355 28.425 27.700000000000003 23.52 70-74 19.89 28.165000000000003 28.175 23.77 75-79 20.11 28.34 27.860000000000003 23.69 80-84 20.44 27.55 27.894999999999996 24.115000000000002 85-89 20.315 28.22 27.905 23.56 90-94 20.655 28.235 28.139999999999997 22.97 95-99 20.605 27.67 28.38 23.345 100-104 20.1 28.84 27.639999999999997 23.419999999999998 105-109 20.485 28.194999999999997 27.939999999999998 23.380000000000003 110-114 20.375 27.955000000000002 28.065 23.605 115-119 20.645 28.794999999999998 27.675 22.884999999999998 120-124 20.79 28.475 27.425 23.31 125-129 20.064999999999998 28.335 27.639999999999997 23.96 130-134 21.11 28.249999999999996 27.744999999999997 22.895 135-139 20.724999999999998 28.105000000000004 27.98 23.189999999999998 140-144 21.095 27.884999999999998 27.634999999999998 23.385 145-149 20.78 28.705000000000002 27.229999999999997 23.285 150-151 20.7125 28.762500000000003 26.700000000000003 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 2.5 25 0.5 26 4.5 27 8.0 28 8.5 29 15.0 30 20.5 31 25.0 32 29.0 33 39.0 34 62.5 35 66.0 36 70.5 37 105.5 38 130.5 39 163.0 40 191.5 41 233.5 42 258.5 43 266.5 44 274.5 45 263.0 46 263.5 47 256.5 48 231.5 49 210.5 50 190.0 51 138.5 52 108.5 53 90.0 54 72.0 55 56.5 56 35.0 57 25.0 58 15.5 59 18.0 60 18.5 61 6.5 62 4.0 63 5.0 64 3.5 65 2.5 66 3.0 67 2.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.37447988904299 81.45 2 8.432732316227462 15.2 3 1.0540915395284327 2.85 4 0.13869625520110956 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.025 0.0 36-37 0.025 0.0 0.0 0.025 0.0 38-39 0.025 0.0 0.0 0.025 0.0 40-41 0.025 0.0 0.0 0.025 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.1 0.0 0.0 0.025 0.0 72-73 0.1 0.0 0.0 0.025 0.0 74-75 0.125 0.0 0.0 0.025 0.0 76-77 0.125 0.0 0.0 0.025 0.0 78-79 0.16249999999999998 0.0 0.0 0.025 0.0 80-81 0.175 0.0 0.0 0.025 0.0 82-83 0.175 0.0 0.0 0.025 0.0 84-85 0.175 0.0 0.0 0.025 0.0 86-87 0.21250000000000002 0.0 0.0 0.025 0.0 88-89 0.225 0.0 0.0 0.025 0.0 90-91 0.225 0.0 0.0 0.025 0.0 92-93 0.275 0.0 0.0 0.025 0.0 94-95 0.325 0.0 0.0 0.025 0.0 96-97 0.4 0.0 0.0 0.025 0.0 98-99 0.4375 0.0 0.0 0.025 0.0 100-101 0.5375 0.0 0.0 0.025 0.0 102-103 0.675 0.0 0.0 0.025 0.0 104-105 0.825 0.0 0.0 0.025 0.0 106-107 0.975 0.0 0.0 0.025 0.0 108-109 1.2 0.0 0.0 0.025 0.0 110-111 1.35 0.0 0.0 0.025 0.0 112-113 1.3875 0.0 0.0 0.025 0.0 114-115 1.5125 0.0 0.0 0.025 0.0 116-117 1.8875 0.0 0.0 0.025 0.0 118-119 2.1625 0.0 0.0 0.025 0.0 120-121 2.3875 0.0 0.0 0.025 0.0 122-123 2.7125 0.0 0.0 0.025 0.0 124-125 3.15 0.0 0.0 0.025 0.0 126-127 3.5625 0.0 0.0 0.025 0.0 128-129 3.9875 0.0 0.0 0.025 0.0 130-131 4.387499999999999 0.0 0.0 0.025 0.0 132-133 4.6875 0.0 0.0 0.025 0.0 134-135 4.9 0.0 0.0 0.025 0.0 136-137 5.275 0.0 0.0 0.025 0.0 138-139 5.625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTAGG 10 0.006830828 145.0 145 >>END_MODULE SRR12670981 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670981_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2315 37.0 37.0 37.0 37.0 37.0 2 36.1645 37.0 37.0 37.0 37.0 37.0 3 36.33 37.0 37.0 37.0 37.0 37.0 4 36.2465 37.0 37.0 37.0 37.0 37.0 5 36.367 37.0 37.0 37.0 37.0 37.0 6 36.316 37.0 37.0 37.0 37.0 37.0 7 36.362 37.0 37.0 37.0 37.0 37.0 8 36.38 37.0 37.0 37.0 37.0 37.0 9 36.3295 37.0 37.0 37.0 37.0 37.0 10-14 36.3808 37.0 37.0 37.0 37.0 37.0 15-19 36.3758 37.0 37.0 37.0 37.0 37.0 20-24 36.3741 37.0 37.0 37.0 37.0 37.0 25-29 36.2879 37.0 37.0 37.0 37.0 37.0 30-34 36.2929 37.0 37.0 37.0 37.0 37.0 35-39 36.2301 37.0 37.0 37.0 37.0 37.0 40-44 36.206 37.0 37.0 37.0 37.0 37.0 45-49 36.2055 37.0 37.0 37.0 37.0 37.0 50-54 36.1785 37.0 37.0 37.0 37.0 37.0 55-59 36.1685 37.0 37.0 37.0 37.0 37.0 60-64 36.170500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.17719999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.1322 37.0 37.0 37.0 37.0 37.0 75-79 36.129 37.0 37.0 37.0 37.0 37.0 80-84 36.098600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0781 37.0 37.0 37.0 37.0 37.0 90-94 36.03099999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.0515 37.0 37.0 37.0 37.0 37.0 100-104 36.0185 37.0 37.0 37.0 37.0 37.0 105-109 35.8969 37.0 37.0 37.0 37.0 37.0 110-114 35.9556 37.0 37.0 37.0 37.0 37.0 115-119 35.90995 37.0 37.0 37.0 37.0 37.0 120-124 35.885000000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7784 37.0 37.0 37.0 37.0 37.0 130-134 35.7822 37.0 37.0 37.0 37.0 37.0 135-139 35.7162 37.0 37.0 37.0 37.0 37.0 140-144 35.65095 37.0 37.0 37.0 37.0 37.0 145-149 35.4249 37.0 37.0 37.0 37.0 37.0 150-151 35.21175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 3.0 16 2.0 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 5.0 23 2.0 24 4.0 25 11.0 26 12.0 27 8.0 28 16.0 29 19.0 30 26.0 31 36.0 32 49.0 33 75.0 34 155.0 35 380.0 36 2652.0 37 533.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.974999999999994 23.525 8.525 23.974999999999998 2 27.6 25.324999999999996 31.1 15.975 3 20.5 27.3 35.099999999999994 17.1 4 23.474999999999998 33.575 24.45 18.5 5 24.349999999999998 37.0 22.225 16.425 6 20.349999999999998 39.0 23.425 17.224999999999998 7 20.075000000000003 23.425 37.525 18.975 8 19.15 26.25 30.025000000000002 24.575 9 21.725 23.849999999999998 31.374999999999996 23.05 10-14 22.985 29.125 27.474999999999998 20.415 15-19 23.1 28.575 28.315 20.01 20-24 22.695 28.65 27.6 21.055 25-29 22.38 28.060000000000002 28.389999999999997 21.17 30-34 22.49 28.685 27.884999999999998 20.94 35-39 22.45 27.875 28.725 20.95 40-44 22.84 28.110000000000003 28.785 20.265 45-49 22.33 28.744999999999997 28.37 20.555 50-54 23.150000000000002 28.815 27.685 20.349999999999998 55-59 22.84 28.084999999999997 28.144999999999996 20.93 60-64 23.06 28.15 27.725 21.065 65-69 22.54 28.335 28.175 20.95 70-74 23.27 27.994999999999997 27.6 21.135 75-79 22.689999999999998 27.79 28.105000000000004 21.415 80-84 23.195 28.68 27.195000000000004 20.93 85-89 23.325000000000003 28.134999999999998 27.93 20.61 90-94 23.14 27.884999999999998 27.955000000000002 21.02 95-99 23.225 28.134999999999998 28.03 20.61 100-104 23.05 28.285 27.785 20.880000000000003 105-109 22.925 27.76 28.965000000000003 20.349999999999998 110-114 23.849999999999998 27.73 27.785 20.635 115-119 23.196159807990398 28.576428821441073 27.2013600680034 21.026051302565126 120-124 24.005000000000003 28.345 27.400000000000002 20.25 125-129 24.13 28.26 27.155 20.455000000000002 130-134 24.099999999999998 28.565 27.215 20.119999999999997 135-139 24.425 28.060000000000002 27.935 19.580000000000002 140-144 24.16620831041552 28.176408820441022 27.651382569128458 20.006000300015 145-149 25.105 28.435 27.1 19.36 150-151 25.775 27.85 27.3125 19.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 1.5 18 2.0 19 1.0 20 0.5 21 1.0 22 1.0 23 3.0 24 4.0 25 4.5 26 8.5 27 9.5 28 11.5 29 13.5 30 18.5 31 28.5 32 37.0 33 45.0 34 49.0 35 57.5 36 82.5 37 116.0 38 150.5 39 177.5 40 215.5 41 244.0 42 250.5 43 265.5 44 282.0 45 266.0 46 250.0 47 250.5 48 224.0 49 180.0 50 156.0 51 134.0 52 99.0 53 76.5 54 67.5 55 58.0 56 45.0 57 27.5 58 14.0 59 15.0 60 13.0 61 11.0 62 7.0 63 3.0 64 2.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.48015542603386 81.5 2 8.270885373300029 14.899999999999999 3 1.0824313072439635 2.9250000000000003 4 0.11101859561476549 0.4 5 0.02775464890369137 0.125 6 0.02775464890369137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.737500000000001 0.0 0.0 0.0 0.0 134-135 4.949999999999999 0.0 0.0 0.0 0.0 136-137 5.324999999999999 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATTCT 10 0.006830828 145.0 1 >>END_MODULE Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746176 spots for SRR12670981.sra Written 746176 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra Read 746167 spots for SRR12670981.sra Written 746167 spots for SRR12670981.sra SRR ids: ['SRR12670981.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w2qzw3y_ SRR12670981.sra spots: 14923349 blocks: [[1, 746167], [746168, 1492334], [1492335, 2238501], [2238502, 2984668], [2984669, 3730835], [3730836, 4477002], [4477003, 5223169], [5223170, 5969336], [5969337, 6715503], [6715504, 7461670], [7461671, 8207837], [8207838, 8954004], [8954005, 9700171], [9700172, 10446338], [10446339, 11192505], [11192506, 11938672], [11938673, 12684839], [12684840, 13431006], [13431007, 14177173], [14177174, 14923349]] SRR12670981 file size 5049906 SRR12670981 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670981 SRR12670981_1.fastq SRR12670981_2.fastq Input file: SRR12670981_1.fastq Paired file: SRR12670981_2.fastq trimmed: SRR12670981-trimmed-pair1.fastq, SRR12670981-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:36:15 2025 >> started Tue Feb 11 11:36:31 2025 >> done (16.224s) 14923349 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 2865 ( 0.02%) empty read pairs filtered out after trimming by size control 14920389 (99.98%) read pairs available; of these: 1218671 ( 8.17%) trimmed read pairs available after processing 13701718 (91.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 8 0.00% 21 8 0.00% 22 13 0.00% 23 5 0.00% 24 5 0.00% 25 12 0.00% 26 12 0.00% 27 14 0.00% 28 11 0.00% 29 15 0.00% 30 17 0.00% 31 12 0.00% 32 9 0.00% 33 15 0.00% 34 8 0.00% 35 11 0.00% 36 19 0.00% 37 15 0.00% 38 18 0.00% 39 19 0.00% 40 27 0.00% 41 23 0.00% 42 26 0.00% 43 31 0.00% 44 29 0.00% 45 30 0.00% 46 37 0.00% 47 33 0.00% 48 38 0.00% 49 46 0.00% 50 62 0.00% 51 52 0.00% 52 81 0.00% 53 79 0.00% 54 66 0.00% 55 86 0.00% 56 92 0.00% 57 97 0.00% 58 136 0.00% 59 150 0.00% 60 186 0.00% 61 203 0.00% 62 214 0.00% 63 246 0.00% 64 300 0.00% 65 291 0.00% 66 361 0.00% 67 390 0.00% 68 475 0.00% 69 565 0.00% 70 565 0.00% 71 635 0.00% 72 731 0.00% 73 917 0.01% 74 1029 0.01% 75 1162 0.01% 76 1224 0.01% 77 1388 0.01% 78 1530 0.01% 79 1655 0.01% 80 1775 0.01% 81 2039 0.01% 82 2211 0.01% 83 2442 0.02% 84 2821 0.02% 85 3205 0.02% 86 3319 0.02% 87 3488 0.02% 88 3741 0.03% 89 4106 0.03% 90 4278 0.03% 91 4780 0.03% 92 4886 0.03% 93 5276 0.04% 94 5789 0.04% 95 6176 0.04% 96 6439 0.04% 97 6771 0.05% 98 7008 0.05% 99 7413 0.05% 100 7868 0.05% 101 8303 0.06% 102 8658 0.06% 103 9073 0.06% 104 9738 0.07% 105 10333 0.07% 106 10671 0.07% 107 11126 0.07% 108 11706 0.08% 109 11958 0.08% 110 12118 0.08% 111 12567 0.08% 112 13241 0.09% 113 13396 0.09% 114 14077 0.09% 115 15001 0.10% 116 15673 0.11% 117 16418 0.11% 118 16840 0.11% 119 17312 0.12% 120 17666 0.12% 121 18242 0.12% 122 18994 0.13% 123 19668 0.13% 124 20607 0.14% 125 20781 0.14% 126 21999 0.15% 127 22572 0.15% 128 23258 0.16% 129 24147 0.16% 130 24486 0.16% 131 24987 0.17% 132 25665 0.17% 133 26026 0.17% 134 27167 0.18% 135 27455 0.18% 136 28294 0.19% 137 29150 0.20% 138 29898 0.20% 139 30921 0.21% 140 31340 0.21% 141 32443 0.22% 142 32769 0.22% 143 33956 0.23% 144 34515 0.23% 145 34725 0.23% 146 35678 0.24% 147 36404 0.24% 148 37917 0.25% 149 37816 0.25% 150 39539 0.26% 151 13701718 91.83% 14920389 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=24.36 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.3 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.55 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=72.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12670981 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:37:16 Started mapping on | Feb 11 11:37:16 Finished on | Feb 11 11:39:01 Mapping speed, Million of reads per hour | 511.56 Number of input reads | 14920389 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13958243 Uniquely mapped reads % | 93.55% Average mapped length | 296.61 Number of splices: Total | 14060133 Number of splices: Annotated (sjdb) | 13751537 Number of splices: GT/AG | 13780680 Number of splices: GC/AG | 229225 Number of splices: AT/AC | 8957 Number of splices: Non-canonical | 41271 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348019 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 33746 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 614127 614127 614127 N_multimapping 348019 348019 348019 N_noFeature 533384 13783533 596487 N_ambiguous 203427 847 91440 UnstrandedReadsAssigned:13221432 PositiveStrandReadsAssigned:173863 NegativeStrandReadsAssigned:13270316 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670981 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670981-trimmed-pair1.fastq SRR12670981-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,920,389 reads, 13,241,963 reads pseudoaligned [quant] estimated average fragment length: 261.261 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR12670981.ke.tsv 34699 SRR12670981.se.tsv 87100 total ==> SRR12670981.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.74 500 20.8603 Potri.005G024800.1.v4.1 1035 774.739 247 23.3801 Potri.004G059700.1.v4.1 961 700.898 6 0.62777 Potri.007G009000.2.v4.1 1416 1155.74 0 0 Potri.003G141000.2.v4.1 2943 2682.74 618 16.8933 Potri.016G087400.1.v4.1 270 79.7119 551 506.912 Potri.015G069301.1.v4.1 564 316.247 0 0 Potri.010G195200.1.v4.1 1773 1512.74 75 3.63582 Potri.012G127500.1.v4.1 977 716.823 92 9.41197 ==> SRR12670981.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 339 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 19 SRR12670981 completed mapping pipeline successfully