Starting /dee2/code/volunteer_pipeline.sh SRR12670982 current disk space = 3051763703808 free memory = 1463527396 SRR12670982 SRAfilesize 2fb4a989578b6b075eba9ff8d16c1a98 SRR12670982.sra SRR12670982.sra file validated SRR12670982 is paired end SRR12670982 is conventional basespace SRR12670982 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670982_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46 37.0 37.0 37.0 37.0 37.0 2 36.319 37.0 37.0 37.0 37.0 37.0 3 36.4885 37.0 37.0 37.0 37.0 37.0 4 36.58 37.0 37.0 37.0 37.0 37.0 5 36.6475 37.0 37.0 37.0 37.0 37.0 6 36.578 37.0 37.0 37.0 37.0 37.0 7 36.5115 37.0 37.0 37.0 37.0 37.0 8 36.571 37.0 37.0 37.0 37.0 37.0 9 36.6145 37.0 37.0 37.0 37.0 37.0 10-14 36.6304 37.0 37.0 37.0 37.0 37.0 15-19 36.5574 37.0 37.0 37.0 37.0 37.0 20-24 36.5272 37.0 37.0 37.0 37.0 37.0 25-29 36.503699999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.456900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4464 37.0 37.0 37.0 37.0 37.0 40-44 36.465700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4026 37.0 37.0 37.0 37.0 37.0 50-54 36.4225 37.0 37.0 37.0 37.0 37.0 55-59 36.4069 37.0 37.0 37.0 37.0 37.0 60-64 36.341300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3796 37.0 37.0 37.0 37.0 37.0 70-74 36.319900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2883 37.0 37.0 37.0 37.0 37.0 80-84 36.2678 37.0 37.0 37.0 37.0 37.0 85-89 36.2334 37.0 37.0 37.0 37.0 37.0 90-94 36.26 37.0 37.0 37.0 37.0 37.0 95-99 36.1179 37.0 37.0 37.0 37.0 37.0 100-104 36.218900000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1378 37.0 37.0 37.0 37.0 37.0 110-114 36.08129999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0325 37.0 37.0 37.0 37.0 37.0 120-124 36.0532 37.0 37.0 37.0 37.0 37.0 125-129 36.0095 37.0 37.0 37.0 37.0 37.0 130-134 35.768699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.860299999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.879200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.6471 37.0 37.0 37.0 37.0 37.0 150-151 35.541250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 1.0 25 6.0 26 5.0 27 7.0 28 11.0 29 27.0 30 27.0 31 46.0 32 58.0 33 75.0 34 135.0 35 267.0 36 2736.0 37 597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.625 10.6 6.8500000000000005 46.925 2 16.825000000000003 11.825 39.825 31.525 3 16.55 13.325000000000001 28.175 41.949999999999996 4 22.400000000000002 22.325 23.974999999999998 31.3 5 23.974999999999998 28.249999999999996 25.7 22.075 6 20.275000000000002 33.5 23.599999999999998 22.625 7 14.799999999999999 26.700000000000003 42.425000000000004 16.075 8 16.3 26.150000000000002 33.725 23.825 9 16.150000000000002 24.45 35.375 24.025 10-14 18.845 30.485 28.415000000000003 22.255 15-19 19.265 28.215 28.299999999999997 24.22 20-24 19.84 28.244999999999997 28.07 23.845 25-29 19.035 28.49 28.565 23.91 30-34 19.695 28.415000000000003 27.965 23.925 35-39 19.27 28.535 28.02 24.175 40-44 19.54 28.71 27.675 24.075 45-49 19.595000000000002 28.54 28.07 23.794999999999998 50-54 19.67 28.804999999999996 28.225 23.3 55-59 20.07 28.075 28.025 23.830000000000002 60-64 19.555 28.310000000000002 28.33 23.805 65-69 20.04 29.020000000000003 27.57 23.369999999999997 70-74 19.79 28.225 28.1 23.885 75-79 19.42 28.255000000000003 28.560000000000002 23.765 80-84 20.355 28.555000000000003 27.584999999999997 23.505000000000003 85-89 19.865 28.455000000000002 27.805000000000003 23.875 90-94 20.015 28.64 27.200000000000003 24.145 95-99 20.05 28.43 28.125 23.395 100-104 19.580000000000002 28.560000000000002 28.425 23.435 105-109 20.325 27.725 28.410000000000004 23.54 110-114 20.19 27.93 28.24 23.64 115-119 20.435 28.694999999999997 27.715 23.155 120-124 20.1 28.15 28.43 23.32 125-129 20.285 27.35 28.575 23.79 130-134 19.86 28.389999999999997 28.599999999999998 23.150000000000002 135-139 20.325 27.810000000000002 28.255000000000003 23.61 140-144 20.535 27.98 27.79 23.695 145-149 20.54 27.884999999999998 27.800000000000004 23.775 150-151 20.125 28.025 27.987499999999997 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 2.0 22 2.0 23 0.5 24 2.0 25 5.0 26 5.5 27 15.5 28 21.0 29 17.5 30 20.0 31 25.0 32 32.5 33 44.0 34 56.0 35 80.0 36 102.0 37 109.0 38 128.5 39 149.5 40 172.0 41 214.5 42 246.0 43 249.0 44 261.5 45 275.5 46 265.5 47 237.5 48 220.5 49 200.5 50 177.0 51 151.5 52 116.5 53 100.0 54 79.5 55 56.0 56 46.0 57 37.5 58 22.5 59 14.5 60 13.0 61 8.5 62 4.0 63 2.0 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.01075268817203 86.5 2 6.505376344086021 12.1 3 0.43010752688172044 1.2 4 0.053763440860215055 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670982 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670982_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.307 37.0 37.0 37.0 37.0 37.0 2 36.222 37.0 37.0 37.0 37.0 37.0 3 36.272 37.0 37.0 37.0 37.0 37.0 4 36.221 37.0 37.0 37.0 37.0 37.0 5 36.3335 37.0 37.0 37.0 37.0 37.0 6 36.299 37.0 37.0 37.0 37.0 37.0 7 36.3435 37.0 37.0 37.0 37.0 37.0 8 36.518 37.0 37.0 37.0 37.0 37.0 9 36.4775 37.0 37.0 37.0 37.0 37.0 10-14 36.465999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3899 37.0 37.0 37.0 37.0 37.0 20-24 36.4319 37.0 37.0 37.0 37.0 37.0 25-29 36.3531 37.0 37.0 37.0 37.0 37.0 30-34 36.2987 37.0 37.0 37.0 37.0 37.0 35-39 36.2663 37.0 37.0 37.0 37.0 37.0 40-44 36.236900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.303 37.0 37.0 37.0 37.0 37.0 50-54 36.227500000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.194 37.0 37.0 37.0 37.0 37.0 60-64 36.1682 37.0 37.0 37.0 37.0 37.0 65-69 36.173199999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.146699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0789 37.0 37.0 37.0 37.0 37.0 80-84 36.133700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.025400000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0456 37.0 37.0 37.0 37.0 37.0 95-99 36.0296 37.0 37.0 37.0 37.0 37.0 100-104 36.0457 37.0 37.0 37.0 37.0 37.0 105-109 35.8801 37.0 37.0 37.0 37.0 37.0 110-114 35.9577 37.0 37.0 37.0 37.0 37.0 115-119 35.90725 37.0 37.0 37.0 37.0 37.0 120-124 35.9039 37.0 37.0 37.0 37.0 37.0 125-129 35.695100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8223 37.0 37.0 37.0 37.0 37.0 135-139 35.7342 37.0 37.0 37.0 37.0 37.0 140-144 35.69435 37.0 37.0 37.0 37.0 37.0 145-149 35.5573 37.0 37.0 37.0 37.0 37.0 150-151 35.184 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 0.0 17 0.0 18 0.0 19 2.0 20 1.0 21 4.0 22 2.0 23 3.0 24 7.0 25 5.0 26 7.0 27 10.0 28 10.0 29 22.0 30 31.0 31 39.0 32 46.0 33 89.0 34 162.0 35 422.0 36 2650.0 37 485.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.8 23.525 10.875 30.8 2 23.724999999999998 28.525 32.550000000000004 15.2 3 19.475 27.950000000000003 32.675 19.900000000000002 4 23.150000000000002 33.45 24.975 18.425 5 26.35 37.475 20.25 15.925 6 19.425 40.8 22.3 17.474999999999998 7 19.125 22.75 39.324999999999996 18.8 8 19.125 25.5 30.475 24.9 9 21.8 23.5 30.95 23.75 10-14 22.625 29.060000000000002 27.155 21.16 15-19 22.31 28.515 27.894999999999996 21.279999999999998 20-24 21.98 28.865000000000002 28.08 21.075 25-29 22.21 28.499999999999996 28.395 20.895 30-34 21.865000000000002 29.225 27.785 21.125 35-39 22.15 28.854999999999997 27.805000000000003 21.19 40-44 22.865 28.24 28.084999999999997 20.810000000000002 45-49 21.915000000000003 28.110000000000003 29.134999999999998 20.84 50-54 22.405 27.905 28.449999999999996 21.240000000000002 55-59 22.439999999999998 28.215 28.505000000000003 20.84 60-64 22.29 28.365000000000002 28.26 21.085 65-69 22.99 28.375 27.62 21.015 70-74 22.939999999999998 28.265 27.625 21.17 75-79 22.31 28.57 27.245 21.875 80-84 23.035 28.375 27.665 20.925 85-89 23.055 28.48 27.560000000000002 20.905 90-94 23.22 27.810000000000002 28.000000000000004 20.97 95-99 22.689999999999998 28.37 28.125 20.815 100-104 22.919999999999998 28.415000000000003 27.61 21.055 105-109 23.064999999999998 28.165000000000003 28.34 20.43 110-114 23.549999999999997 28.13 27.785 20.535 115-119 23.60618030901545 28.741437071853593 27.30636531826591 20.346017300865043 120-124 23.674999999999997 28.89 27.500000000000004 19.935 125-129 24.085 27.975 27.384999999999998 20.555 130-134 23.895 27.744999999999997 28.044999999999998 20.315 135-139 23.555 28.265 27.865000000000002 20.315 140-144 24.141207060353018 28.741437071853593 27.251362568128407 19.865993299664982 145-149 24.18 28.199999999999996 27.534999999999997 20.085 150-151 24.4375 28.050000000000004 26.8375 20.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 1.5 21 2.0 22 2.5 23 3.0 24 2.0 25 2.5 26 3.5 27 6.0 28 13.5 29 15.0 30 24.0 31 29.5 32 30.5 33 40.5 34 60.0 35 82.5 36 102.0 37 121.0 38 146.0 39 188.0 40 207.5 41 230.0 42 254.0 43 267.0 44 284.0 45 271.0 46 242.0 47 222.0 48 216.5 49 197.5 50 157.0 51 117.0 52 91.5 53 85.0 54 69.0 55 46.5 56 34.5 57 29.5 58 25.5 59 19.5 60 15.0 61 10.5 62 8.5 63 6.5 64 3.0 65 1.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.99002426530062 86.225 2 6.36290105149636 11.799999999999999 3 0.5661903478026422 1.575 4 0.026961445133459154 0.1 5 0.026961445133459154 0.125 6 0.0 0.0 7 0.026961445133459154 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928892 spots for SRR12670982.sra Written 928892 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra Read 928888 spots for SRR12670982.sra Written 928888 spots for SRR12670982.sra SRR ids: ['SRR12670982.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l5t60ihk SRR12670982.sra spots: 18577764 blocks: [[1, 928888], [928889, 1857776], [1857777, 2786664], [2786665, 3715552], [3715553, 4644440], [4644441, 5573328], [5573329, 6502216], [6502217, 7431104], [7431105, 8359992], [8359993, 9288880], [9288881, 10217768], [10217769, 11146656], [11146657, 12075544], [12075545, 13004432], [13004433, 13933320], [13933321, 14862208], [14862209, 15791096], [15791097, 16719984], [16719985, 17648872], [17648873, 18577764]] SRR12670982 file size 6291836 SRR12670982 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670982 SRR12670982_1.fastq SRR12670982_2.fastq Input file: SRR12670982_1.fastq Paired file: SRR12670982_2.fastq trimmed: SRR12670982-trimmed-pair1.fastq, SRR12670982-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:25:34 2025 >> started Tue Feb 11 11:26:04 2025 >> done (30.325s) 18577764 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 2676 ( 0.01%) empty read pairs filtered out after trimming by size control 18574995 (99.99%) read pairs available; of these: 935259 ( 5.04%) trimmed read pairs available after processing 17639736 (94.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 7 0.00% 21 9 0.00% 22 7 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 7 0.00% 27 9 0.00% 28 5 0.00% 29 8 0.00% 30 15 0.00% 31 17 0.00% 32 8 0.00% 33 12 0.00% 34 17 0.00% 35 25 0.00% 36 16 0.00% 37 12 0.00% 38 16 0.00% 39 16 0.00% 40 17 0.00% 41 18 0.00% 42 25 0.00% 43 19 0.00% 44 21 0.00% 45 23 0.00% 46 22 0.00% 47 17 0.00% 48 29 0.00% 49 26 0.00% 50 39 0.00% 51 30 0.00% 52 35 0.00% 53 49 0.00% 54 32 0.00% 55 64 0.00% 56 68 0.00% 57 69 0.00% 58 61 0.00% 59 79 0.00% 60 91 0.00% 61 90 0.00% 62 103 0.00% 63 122 0.00% 64 146 0.00% 65 178 0.00% 66 178 0.00% 67 203 0.00% 68 220 0.00% 69 239 0.00% 70 270 0.00% 71 297 0.00% 72 365 0.00% 73 410 0.00% 74 456 0.00% 75 517 0.00% 76 586 0.00% 77 631 0.00% 78 641 0.00% 79 812 0.00% 80 877 0.00% 81 995 0.01% 82 1105 0.01% 83 1247 0.01% 84 1415 0.01% 85 1590 0.01% 86 1755 0.01% 87 1866 0.01% 88 2126 0.01% 89 2194 0.01% 90 2369 0.01% 91 2561 0.01% 92 2801 0.02% 93 3096 0.02% 94 3412 0.02% 95 3601 0.02% 96 4005 0.02% 97 4276 0.02% 98 4558 0.02% 99 4723 0.03% 100 5006 0.03% 101 5307 0.03% 102 5677 0.03% 103 5930 0.03% 104 6180 0.03% 105 6608 0.04% 106 7116 0.04% 107 7485 0.04% 108 8010 0.04% 109 8365 0.05% 110 8735 0.05% 111 8972 0.05% 112 9435 0.05% 113 9666 0.05% 114 10088 0.05% 115 10599 0.06% 116 11328 0.06% 117 11846 0.06% 118 12180 0.07% 119 12724 0.07% 120 13282 0.07% 121 13965 0.08% 122 14490 0.08% 123 14909 0.08% 124 15428 0.08% 125 16111 0.09% 126 16775 0.09% 127 17310 0.09% 128 17859 0.10% 129 18276 0.10% 130 19497 0.10% 131 19489 0.10% 132 20121 0.11% 133 20689 0.11% 134 21522 0.12% 135 21950 0.12% 136 22975 0.12% 137 23270 0.13% 138 24013 0.13% 139 25409 0.14% 140 25877 0.14% 141 26901 0.14% 142 27369 0.15% 143 28149 0.15% 144 29019 0.16% 145 29279 0.16% 146 30581 0.16% 147 31498 0.17% 148 32296 0.17% 149 32987 0.18% 150 34606 0.19% 151 17639736 94.96% 18574995 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.29 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=74.13 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=CACCTTCACGGCGACCTCCGTAACCGCCACCGCCTCCACGGCTGTAGCCCCCACCTCCGCCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTCGTTGTTGAAGGTAACAAATCCAAAGCCGCGAGATCTTCCAGTTTCACGATCGTTTATAATCTTCGAATCGATGATTTCACCGTACTGGCTAAA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.42 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=73.00 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=15.7 sequence=AAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCACAACTCCACCGCCACGTTAGTCCTCCTCTAT SRR12670982 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:26:57 Started mapping on | Feb 11 11:26:57 Finished on | Feb 11 11:30:57 Mapping speed, Million of reads per hour | 278.62 Number of input reads | 18574995 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17665962 Uniquely mapped reads % | 95.11% Average mapped length | 298.50 Number of splices: Total | 17659005 Number of splices: Annotated (sjdb) | 17279472 Number of splices: GT/AG | 17325455 Number of splices: GC/AG | 270349 Number of splices: AT/AC | 11875 Number of splices: Non-canonical | 51326 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435395 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 59428 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 473638 473638 473638 N_multimapping 435395 435395 435395 N_noFeature 690772 17434710 755674 N_ambiguous 281852 1104 114889 UnstrandedReadsAssigned:16693338 PositiveStrandReadsAssigned:230148 NegativeStrandReadsAssigned:16795399 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670982 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670982-trimmed-pair1.fastq SRR12670982-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,574,995 reads, 16,695,312 reads pseudoaligned [quant] estimated average fragment length: 288.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR12670982.ke.tsv 34699 SRR12670982.se.tsv 87100 total ==> SRR12670982.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.95 701.04 21.3038 Potri.005G024800.1.v4.1 1035 747.95 273 19.1994 Potri.004G059700.1.v4.1 961 674.266 5 0.390065 Potri.007G009000.2.v4.1 1416 1128.95 0 0 Potri.003G141000.2.v4.1 2943 2655.95 831 16.4581 Potri.016G087400.1.v4.1 270 72.1891 986 718.461 Potri.015G069301.1.v4.1 564 296.109 0 0 Potri.010G195200.1.v4.1 1773 1485.95 165 5.84087 Potri.012G127500.1.v4.1 977 690.103 215 16.3879 ==> SRR12670982.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 513 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12670982 completed mapping pipeline successfully