Starting /dee2/code/volunteer_pipeline.sh SRR12670983 current disk space = 3051787304960 free memory = 1491610928 SRR12670983 SRAfilesize b62d392673f61066d1e05ffb7e1cde2c SRR12670983.sra SRR12670983.sra file validated SRR12670983 is paired end SRR12670983 is conventional basespace SRR12670983 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670983_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3715 37.0 37.0 37.0 37.0 37.0 2 36.254 37.0 37.0 37.0 37.0 37.0 3 36.4895 37.0 37.0 37.0 37.0 37.0 4 36.5885 37.0 37.0 37.0 37.0 37.0 5 36.6 37.0 37.0 37.0 37.0 37.0 6 36.479 37.0 37.0 37.0 37.0 37.0 7 36.5255 37.0 37.0 37.0 37.0 37.0 8 36.5655 37.0 37.0 37.0 37.0 37.0 9 36.4885 37.0 37.0 37.0 37.0 37.0 10-14 36.5509 37.0 37.0 37.0 37.0 37.0 15-19 36.57430000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5086 37.0 37.0 37.0 37.0 37.0 25-29 36.503 37.0 37.0 37.0 37.0 37.0 30-34 36.4196 37.0 37.0 37.0 37.0 37.0 35-39 36.4872 37.0 37.0 37.0 37.0 37.0 40-44 36.40260000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3885 37.0 37.0 37.0 37.0 37.0 50-54 36.3525 37.0 37.0 37.0 37.0 37.0 55-59 36.3665 37.0 37.0 37.0 37.0 37.0 60-64 36.32809999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3206 37.0 37.0 37.0 37.0 37.0 70-74 36.2958 37.0 37.0 37.0 37.0 37.0 75-79 36.2389 37.0 37.0 37.0 37.0 37.0 80-84 36.2368 37.0 37.0 37.0 37.0 37.0 85-89 36.2032 37.0 37.0 37.0 37.0 37.0 90-94 36.1904 37.0 37.0 37.0 37.0 37.0 95-99 36.1783 37.0 37.0 37.0 37.0 37.0 100-104 36.157799999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.049400000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0539 37.0 37.0 37.0 37.0 37.0 115-119 35.985 37.0 37.0 37.0 37.0 37.0 120-124 35.9235 37.0 37.0 37.0 37.0 37.0 125-129 35.887600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.7332 37.0 37.0 37.0 37.0 37.0 135-139 35.694300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7268 37.0 37.0 37.0 37.0 37.0 145-149 35.5553 37.0 37.0 37.0 37.0 37.0 150-151 35.44075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 2.0 22 0.0 23 5.0 24 3.0 25 3.0 26 4.0 27 14.0 28 15.0 29 27.0 30 36.0 31 46.0 32 51.0 33 94.0 34 117.0 35 258.0 36 2665.0 37 658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.275 11.450000000000001 5.975 37.3 2 18.325 11.475 39.525 30.675 3 16.425 15.2 26.75 41.625 4 21.425 23.5 24.025 31.05 5 24.575 28.7 24.45 22.275 6 19.2 33.875 23.9 23.025000000000002 7 16.35 25.6 42.05 16.0 8 16.7 26.174999999999997 34.375 22.75 9 17.299999999999997 23.9 36.025 22.775000000000002 10-14 19.935 30.11 27.700000000000003 22.255 15-19 19.634999999999998 28.794999999999998 27.655 23.915 20-24 19.865 28.299999999999997 28.395 23.44 25-29 20.26 29.544999999999998 27.26 22.935 30-34 19.755 28.645 27.98 23.62 35-39 20.145 28.46 27.925 23.47 40-44 20.495 28.215 28.075 23.215 45-49 20.169999999999998 28.185 28.02 23.625 50-54 19.99 27.800000000000004 28.305000000000003 23.905 55-59 19.66 28.860000000000003 27.62 23.86 60-64 20.125 27.950000000000003 27.994999999999997 23.93 65-69 20.155 28.4 27.63 23.815 70-74 20.02 27.93 28.325 23.724999999999998 75-79 20.07 28.32 28.07 23.54 80-84 20.365 29.035 27.02 23.580000000000002 85-89 20.365 28.315 27.66 23.66 90-94 20.325 28.655 27.650000000000002 23.369999999999997 95-99 20.325 29.134999999999998 27.415 23.125 100-104 20.635 29.549999999999997 27.155 22.66 105-109 20.375 28.749999999999996 27.065 23.810000000000002 110-114 19.975 28.49 28.03 23.505000000000003 115-119 21.044999999999998 28.725 26.724999999999998 23.505000000000003 120-124 20.52 28.749999999999996 27.015 23.715 125-129 20.549999999999997 28.51 26.955000000000002 23.985 130-134 20.665 28.65 28.144999999999996 22.54 135-139 20.86 27.939999999999998 27.155 24.044999999999998 140-144 21.54 29.104999999999997 26.995 22.36 145-149 20.8970897089709 28.347834783478348 26.837683768376834 23.91739173917392 150-151 20.849999999999998 29.4875 26.575 23.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 2.5 23 2.0 24 1.5 25 2.5 26 3.5 27 7.0 28 9.0 29 11.0 30 14.0 31 18.5 32 29.0 33 41.5 34 59.0 35 75.5 36 88.0 37 104.0 38 127.5 39 158.0 40 193.5 41 216.5 42 238.5 43 249.0 44 250.0 45 280.0 46 286.5 47 269.0 48 240.0 49 201.5 50 170.0 51 135.0 52 114.5 53 86.5 54 72.5 55 70.0 56 50.0 57 33.5 58 23.5 59 17.0 60 12.0 61 10.0 62 6.0 63 2.0 64 0.5 65 1.5 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.12393514701841 82.89999999999999 2 7.996702390766694 14.549999999999999 3 0.741962077493817 2.025 4 0.10992030777686176 0.4 5 0.02748007694421544 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAATGTACAGAACATCCCATAGACAGACCAGAATATCTTATAGGGAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.7000000000000002 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 2.9124999999999996 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTTG 10 0.006830828 145.0 7 GCAGAAA 10 0.006830828 145.0 1 CAGATCG 10 0.006830828 145.0 145 >>END_MODULE SRR12670983 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670983_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1395 37.0 37.0 37.0 37.0 37.0 2 36.112 37.0 37.0 37.0 37.0 37.0 3 36.251 37.0 37.0 37.0 37.0 37.0 4 36.2325 37.0 37.0 37.0 37.0 37.0 5 36.3505 37.0 37.0 37.0 37.0 37.0 6 36.2355 37.0 37.0 37.0 37.0 37.0 7 36.3075 37.0 37.0 37.0 37.0 37.0 8 36.353 37.0 37.0 37.0 37.0 37.0 9 36.264 37.0 37.0 37.0 37.0 37.0 10-14 36.2945 37.0 37.0 37.0 37.0 37.0 15-19 36.274699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.32190000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.268899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.24150000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.176300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1356 37.0 37.0 37.0 37.0 37.0 45-49 36.178700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1366 37.0 37.0 37.0 37.0 37.0 55-59 36.1392 37.0 37.0 37.0 37.0 37.0 60-64 36.125 37.0 37.0 37.0 37.0 37.0 65-69 36.1117 37.0 37.0 37.0 37.0 37.0 70-74 36.0711 37.0 37.0 37.0 37.0 37.0 75-79 36.0436 37.0 37.0 37.0 37.0 37.0 80-84 36.062799999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.922999999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.929300000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.980599999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9902 37.0 37.0 37.0 37.0 37.0 105-109 35.936099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.8861 37.0 37.0 37.0 37.0 37.0 115-119 35.917350000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.8027 37.0 37.0 37.0 37.0 37.0 125-129 35.7795 37.0 37.0 37.0 37.0 37.0 130-134 35.7765 37.0 37.0 37.0 37.0 37.0 135-139 35.7274 37.0 37.0 37.0 37.0 37.0 140-144 35.66825 37.0 37.0 37.0 37.0 37.0 145-149 35.4602 37.0 37.0 37.0 37.0 37.0 150-151 35.2245 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 2.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 2.0 21 6.0 22 3.0 23 8.0 24 6.0 25 6.0 26 10.0 27 13.0 28 19.0 29 27.0 30 36.0 31 52.0 32 48.0 33 65.0 34 147.0 35 320.0 36 2590.0 37 630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.449999999999996 25.4 8.525 24.625 2 25.074999999999996 26.950000000000003 33.525 14.45 3 20.3 27.900000000000002 33.300000000000004 18.5 4 24.45 32.550000000000004 23.25 19.75 5 25.724999999999998 36.925000000000004 20.349999999999998 17.0 6 20.349999999999998 39.35 23.175 17.125 7 20.424999999999997 22.8 38.275 18.5 8 19.275000000000002 26.200000000000003 28.725 25.8 9 20.95 23.599999999999998 32.625 22.825 10-14 22.205 29.585 26.93 21.279999999999998 15-19 22.36 28.744999999999997 27.905 20.990000000000002 20-24 22.195 28.33 27.825 21.65 25-29 22.025 28.7 28.325 20.95 30-34 22.825 27.975 28.345 20.855 35-39 22.095000000000002 28.96 27.939999999999998 21.005 40-44 22.634999999999998 28.395 28.18 20.79 45-49 22.7 28.62 28.575 20.105 50-54 22.564999999999998 27.794999999999998 28.105000000000004 21.535 55-59 23.57 28.03 27.685 20.715 60-64 23.44 28.499999999999996 27.725 20.335 65-69 22.935 27.839999999999996 27.994999999999997 21.23 70-74 23.445 27.229999999999997 28.249999999999996 21.075 75-79 22.81 27.415 28.384999999999998 21.39 80-84 23.025000000000002 28.634999999999998 27.43 20.91 85-89 23.005 28.02 27.815 21.16 90-94 23.369999999999997 27.245 28.720000000000002 20.665 95-99 23.1 27.884999999999998 28.205000000000002 20.810000000000002 100-104 23.07 28.410000000000004 27.38 21.14 105-109 23.36 27.825 27.950000000000003 20.865000000000002 110-114 23.61 28.37 28.34 19.68 115-119 23.28116405820291 28.116405820291014 27.91639581979099 20.686034301715086 120-124 23.43 27.779999999999998 28.29 20.5 125-129 23.625 27.985 27.279999999999998 21.11 130-134 23.165 28.78 27.57 20.485 135-139 23.505000000000003 27.175 28.28 21.04 140-144 23.576178808940448 28.081404070203508 27.771388569428474 20.571028551427574 145-149 24.560000000000002 28.08 26.77 20.59 150-151 25.362499999999997 27.925 26.737499999999997 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 0.5 9 1.0 10 1.5 11 1.5 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.5 18 1.5 19 2.0 20 2.5 21 2.0 22 0.5 23 1.5 24 2.5 25 2.5 26 6.0 27 6.5 28 8.5 29 18.5 30 20.5 31 19.5 32 31.0 33 38.0 34 45.5 35 66.0 36 80.5 37 106.5 38 147.0 39 174.5 40 200.5 41 220.5 42 256.0 43 288.0 44 290.5 45 279.0 46 259.5 47 241.5 48 234.0 49 207.5 50 151.5 51 120.5 52 98.5 53 87.0 54 77.0 55 56.0 56 38.0 57 24.5 58 18.0 59 16.0 60 11.0 61 5.0 62 5.5 63 3.0 64 1.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 1.0 75 1.0 76 1.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.47010422380691 83.375 2 7.5973669775095996 13.850000000000001 3 0.7405375754251234 2.025 4 0.13713658804168952 0.5 5 0.054854635216675815 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit TCTACTGTTCTGGCAGCAAGGAAAACGAATGTTAGCTACTCTATTCTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAGCT 10 0.006830828 145.0 4 >>END_MODULE Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra Read 593917 spots for SRR12670983.sra Written 593917 spots for SRR12670983.sra Read 593908 spots for SRR12670983.sra Written 593908 spots for SRR12670983.sra SRR ids: ['SRR12670983.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ha1tqmm8 SRR12670983.sra spots: 11878169 blocks: [[1, 593908], [593909, 1187816], [1187817, 1781724], [1781725, 2375632], [2375633, 2969540], [2969541, 3563448], [3563449, 4157356], [4157357, 4751264], [4751265, 5345172], [5345173, 5939080], [5939081, 6532988], [6532989, 7126896], [7126897, 7720804], [7720805, 8314712], [8314713, 8908620], [8908621, 9502528], [9502529, 10096436], [10096437, 10690344], [10690345, 11284252], [11284253, 11878169]] SRR12670983 file size 4015021 SRR12670983 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670983 SRR12670983_1.fastq SRR12670983_2.fastq Input file: SRR12670983_1.fastq Paired file: SRR12670983_2.fastq trimmed: SRR12670983-trimmed-pair1.fastq, SRR12670983-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:29:26 2025 >> started Tue Feb 11 11:29:39 2025 >> done (12.650s) 11878169 read pairs processed; of these: 111 ( 0.00%) short read pairs filtered out after trimming by size control 2821 ( 0.02%) empty read pairs filtered out after trimming by size control 11875237 (99.98%) read pairs available; of these: 701691 ( 5.91%) trimmed read pairs available after processing 11173546 (94.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 4 0.00% 20 4 0.00% 21 7 0.00% 22 1 0.00% 23 10 0.00% 24 17 0.00% 25 23 0.00% 26 19 0.00% 27 9 0.00% 28 12 0.00% 29 12 0.00% 30 21 0.00% 31 25 0.00% 32 24 0.00% 33 14 0.00% 34 13 0.00% 35 19 0.00% 36 29 0.00% 37 30 0.00% 38 24 0.00% 39 19 0.00% 40 17 0.00% 41 15 0.00% 42 24 0.00% 43 22 0.00% 44 23 0.00% 45 22 0.00% 46 15 0.00% 47 24 0.00% 48 32 0.00% 49 46 0.00% 50 41 0.00% 51 48 0.00% 52 43 0.00% 53 55 0.00% 54 51 0.00% 55 61 0.00% 56 56 0.00% 57 83 0.00% 58 77 0.00% 59 88 0.00% 60 113 0.00% 61 125 0.00% 62 142 0.00% 63 171 0.00% 64 190 0.00% 65 201 0.00% 66 237 0.00% 67 202 0.00% 68 220 0.00% 69 312 0.00% 70 355 0.00% 71 395 0.00% 72 430 0.00% 73 484 0.00% 74 589 0.00% 75 628 0.01% 76 684 0.01% 77 773 0.01% 78 837 0.01% 79 913 0.01% 80 987 0.01% 81 1163 0.01% 82 1331 0.01% 83 1401 0.01% 84 1480 0.01% 85 1679 0.01% 86 1811 0.02% 87 1946 0.02% 88 2038 0.02% 89 2160 0.02% 90 2354 0.02% 91 2540 0.02% 92 2760 0.02% 93 3098 0.03% 94 3207 0.03% 95 3411 0.03% 96 3789 0.03% 97 3892 0.03% 98 3873 0.03% 99 4314 0.04% 100 4377 0.04% 101 4589 0.04% 102 4866 0.04% 103 5225 0.04% 104 5376 0.05% 105 5602 0.05% 106 6049 0.05% 107 6295 0.05% 108 6456 0.05% 109 6916 0.06% 110 6802 0.06% 111 7270 0.06% 112 7652 0.06% 113 8108 0.07% 114 8254 0.07% 115 8205 0.07% 116 8866 0.07% 117 9230 0.08% 118 9658 0.08% 119 9867 0.08% 120 10196 0.09% 121 10697 0.09% 122 10960 0.09% 123 11027 0.09% 124 11663 0.10% 125 12034 0.10% 126 12349 0.10% 127 12767 0.11% 128 13231 0.11% 129 13444 0.11% 130 13836 0.12% 131 14156 0.12% 132 14774 0.12% 133 15140 0.13% 134 15565 0.13% 135 16072 0.14% 136 16435 0.14% 137 16494 0.14% 138 17254 0.15% 139 18140 0.15% 140 18193 0.15% 141 18828 0.16% 142 19229 0.16% 143 19680 0.17% 144 20516 0.17% 145 20554 0.17% 146 20857 0.18% 147 21676 0.18% 148 21962 0.18% 149 22397 0.19% 150 23477 0.20% 151 11173546 94.09% 11875237 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=99.16 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.5 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=25 prefix-density=0.53 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=32.19 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=12.0 sequence=AAAGAAAAGAAAA SRR12670983 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:30:26 Started mapping on | Feb 11 11:30:26 Finished on | Feb 11 11:31:44 Mapping speed, Million of reads per hour | 548.09 Number of input reads | 11875237 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11115817 Uniquely mapped reads % | 93.61% Average mapped length | 297.67 Number of splices: Total | 11092416 Number of splices: Annotated (sjdb) | 10857341 Number of splices: GT/AG | 10876611 Number of splices: GC/AG | 178313 Number of splices: AT/AC | 7206 Number of splices: Non-canonical | 30286 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255371 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 24864 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 504049 504049 504049 N_multimapping 255371 255371 255371 N_noFeature 437077 10968146 485303 N_ambiguous 170336 629 70612 UnstrandedReadsAssigned:10508404 PositiveStrandReadsAssigned:147042 NegativeStrandReadsAssigned:10559902 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670983 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670983-trimmed-pair1.fastq SRR12670983-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,875,237 reads, 10,562,077 reads pseudoaligned [quant] estimated average fragment length: 280.849 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR12670983.ke.tsv 34699 SRR12670983.se.tsv 87100 total ==> SRR12670983.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.15 415 20.4645 Potri.005G024800.1.v4.1 1035 755.151 163 18.501 Potri.004G059700.1.v4.1 961 681.408 18 2.26416 Potri.007G009000.2.v4.1 1416 1136.15 0 0 Potri.003G141000.2.v4.1 2943 2663.15 567.449 18.263 Potri.016G087400.1.v4.1 270 74.2777 464 535.427 Potri.015G069301.1.v4.1 564 301.43 0 0 Potri.010G195200.1.v4.1 1773 1493.15 54 3.09978 Potri.012G127500.1.v4.1 977 697.276 176 21.6346 ==> SRR12670983.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 409 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 152 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12670983 completed mapping pipeline successfully