Starting /dee2/code/volunteer_pipeline.sh SRR12670984 current disk space = 3051779977216 free memory = 1154714560 SRR12670984 SRAfilesize c4ba36c0a4d8249ba1a2f56a1ecf4a12 SRR12670984.sra SRR12670984.sra file validated SRR12670984 is paired end SRR12670984 is conventional basespace SRR12670984 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670984_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37425 37.0 37.0 37.0 37.0 37.0 2 36.419 37.0 37.0 37.0 37.0 37.0 3 36.537 37.0 37.0 37.0 37.0 37.0 4 36.5255 37.0 37.0 37.0 37.0 37.0 5 36.572 37.0 37.0 37.0 37.0 37.0 6 36.512 37.0 37.0 37.0 37.0 37.0 7 36.542 37.0 37.0 37.0 37.0 37.0 8 36.617 37.0 37.0 37.0 37.0 37.0 9 36.606 37.0 37.0 37.0 37.0 37.0 10-14 36.5975 37.0 37.0 37.0 37.0 37.0 15-19 36.569300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5098 37.0 37.0 37.0 37.0 37.0 25-29 36.503099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.426399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.450100000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4269 37.0 37.0 37.0 37.0 37.0 45-49 36.388999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.387299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.373200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.311299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3289 37.0 37.0 37.0 37.0 37.0 70-74 36.3759 37.0 37.0 37.0 37.0 37.0 75-79 36.2649 37.0 37.0 37.0 37.0 37.0 80-84 36.2262 37.0 37.0 37.0 37.0 37.0 85-89 36.2336 37.0 37.0 37.0 37.0 37.0 90-94 36.231 37.0 37.0 37.0 37.0 37.0 95-99 36.1428 37.0 37.0 37.0 37.0 37.0 100-104 36.1582 37.0 37.0 37.0 37.0 37.0 105-109 36.1019 37.0 37.0 37.0 37.0 37.0 110-114 36.096000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.034000000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.0149 37.0 37.0 37.0 37.0 37.0 125-129 35.9678 37.0 37.0 37.0 37.0 37.0 130-134 35.821000000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.890299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8648 37.0 37.0 37.0 37.0 37.0 145-149 35.6915 37.0 37.0 37.0 37.0 37.0 150-151 35.584 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 0.0 21 1.0 22 1.0 23 2.0 24 0.0 25 5.0 26 9.0 27 8.0 28 19.0 29 20.0 30 28.0 31 43.0 32 52.0 33 79.0 34 133.0 35 273.0 36 2648.0 37 676.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.83737803352514 10.532899674756067 5.579184388291218 34.05053790342757 2 19.375 11.35 36.0 33.275 3 16.225 15.174999999999999 29.475 39.125 4 21.325 23.575 24.875 30.225 5 23.05 29.325000000000003 25.124999999999996 22.5 6 19.650000000000002 34.425 24.65 21.275 7 15.525 26.275 42.1 16.1 8 15.375 26.05 34.525 24.05 9 18.475 23.549999999999997 35.775 22.2 10-14 19.7 29.99 28.189999999999998 22.12 15-19 18.925 28.189999999999998 28.835 24.05 20-24 19.53 28.804999999999996 28.310000000000002 23.355 25-29 20.325 28.73 27.355 23.59 30-34 20.169999999999998 28.255000000000003 28.110000000000003 23.465 35-39 19.575 28.425 28.525 23.474999999999998 40-44 20.275000000000002 27.889999999999997 28.255000000000003 23.580000000000002 45-49 20.16 28.425 27.355 24.060000000000002 50-54 19.845 27.935 28.33 23.89 55-59 20.135 28.249999999999996 27.68 23.935000000000002 60-64 20.595 28.410000000000004 27.76 23.235 65-69 19.645000000000003 28.065 27.894999999999996 24.395 70-74 19.79 28.535 27.939999999999998 23.735 75-79 20.13 28.265 27.865000000000002 23.74 80-84 20.345 27.605 28.08 23.97 85-89 19.869999999999997 28.33 27.855 23.945 90-94 19.89 28.365000000000002 27.994999999999997 23.75 95-99 20.315 28.285 27.905 23.494999999999997 100-104 20.105 28.360000000000003 27.775 23.76 105-109 20.5 28.27 28.005000000000003 23.225 110-114 20.125 27.834999999999997 28.01 24.03 115-119 20.415 28.265 27.639999999999997 23.68 120-124 20.549999999999997 28.765 26.905 23.78 125-129 20.29 28.535 27.939999999999998 23.235 130-134 20.165 28.610000000000003 27.500000000000004 23.724999999999998 135-139 20.849999999999998 27.845 27.62 23.685000000000002 140-144 20.880000000000003 27.96 27.33 23.830000000000002 145-149 20.87 28.470000000000002 27.169999999999998 23.49 150-151 20.25 27.950000000000003 27.6875 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 3.0 25 5.0 26 9.0 27 12.0 28 13.0 29 14.0 30 16.5 31 24.5 32 38.0 33 45.5 34 49.5 35 62.0 36 84.5 37 112.0 38 139.5 39 163.0 40 192.0 41 218.0 42 222.0 43 233.5 44 251.5 45 260.5 46 260.5 47 254.0 48 232.0 49 204.5 50 183.0 51 145.5 52 126.5 53 105.5 54 77.5 55 61.5 56 43.5 57 35.0 58 26.0 59 18.5 60 14.0 61 10.0 62 6.0 63 4.0 64 3.0 65 0.5 66 0.5 67 2.5 68 3.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.03163686382393 82.72500000000001 2 8.033012379642365 14.6 3 0.8253094910591471 2.25 4 0.08253094910591473 0.3 5 0.027510316368638238 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0375 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.1500000000000004 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAACA 10 0.006830828 145.0 2 CAAACTT 10 0.006830828 145.0 4 TTTGCTC 10 0.006830828 145.0 9 >>END_MODULE SRR12670984 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670984_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1615 37.0 37.0 37.0 37.0 37.0 2 36.118 37.0 37.0 37.0 37.0 37.0 3 36.1975 37.0 37.0 37.0 37.0 37.0 4 36.251 37.0 37.0 37.0 37.0 37.0 5 36.418 37.0 37.0 37.0 37.0 37.0 6 36.358 37.0 37.0 37.0 37.0 37.0 7 36.3975 37.0 37.0 37.0 37.0 37.0 8 36.3945 37.0 37.0 37.0 37.0 37.0 9 36.386 37.0 37.0 37.0 37.0 37.0 10-14 36.3507 37.0 37.0 37.0 37.0 37.0 15-19 36.3696 37.0 37.0 37.0 37.0 37.0 20-24 36.39 37.0 37.0 37.0 37.0 37.0 25-29 36.2589 37.0 37.0 37.0 37.0 37.0 30-34 36.259699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.198100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.19199999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1703 37.0 37.0 37.0 37.0 37.0 50-54 36.1413 37.0 37.0 37.0 37.0 37.0 55-59 36.1537 37.0 37.0 37.0 37.0 37.0 60-64 36.0813 37.0 37.0 37.0 37.0 37.0 65-69 36.1644 37.0 37.0 37.0 37.0 37.0 70-74 36.077200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0839 37.0 37.0 37.0 37.0 37.0 80-84 36.0674 37.0 37.0 37.0 37.0 37.0 85-89 35.9993 37.0 37.0 37.0 37.0 37.0 90-94 35.9908 37.0 37.0 37.0 37.0 37.0 95-99 36.022000000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.977000000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9046 37.0 37.0 37.0 37.0 37.0 110-114 35.925 37.0 37.0 37.0 37.0 37.0 115-119 35.87050000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.8172 37.0 37.0 37.0 37.0 37.0 125-129 35.6965 37.0 37.0 37.0 37.0 37.0 130-134 35.7324 37.0 37.0 37.0 37.0 37.0 135-139 35.73459999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.6673 37.0 37.0 37.0 37.0 37.0 145-149 35.487 37.0 37.0 37.0 37.0 37.0 150-151 35.198 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 0.0 15 2.0 16 3.0 17 0.0 18 2.0 19 0.0 20 0.0 21 1.0 22 6.0 23 6.0 24 9.0 25 6.0 26 12.0 27 11.0 28 8.0 29 22.0 30 26.0 31 39.0 32 49.0 33 75.0 34 149.0 35 362.0 36 2657.0 37 545.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.475 23.925 8.0 21.6 2 25.775 26.05 32.275 15.9 3 21.6 26.125 32.725 19.55 4 25.75 32.574999999999996 23.425 18.25 5 25.85 36.3 21.175 16.675 6 19.125 40.699999999999996 21.45 18.725 7 21.349999999999998 23.575 36.625 18.45 8 19.3 26.924999999999997 29.775000000000002 24.0 9 22.425 23.925 30.099999999999998 23.549999999999997 10-14 23.335 28.660000000000004 27.43 20.575 15-19 23.845 28.185 27.395000000000003 20.575 20-24 22.845 28.51 27.85 20.794999999999998 25-29 23.169999999999998 28.09 27.67 21.07 30-34 22.85 28.610000000000003 27.865000000000002 20.674999999999997 35-39 22.46 27.810000000000002 28.115000000000002 21.615000000000002 40-44 23.345 28.249999999999996 27.73 20.674999999999997 45-49 22.835 28.360000000000003 28.000000000000004 20.805 50-54 22.585 27.92 28.505000000000003 20.990000000000002 55-59 23.080000000000002 28.439999999999998 27.725 20.755000000000003 60-64 23.64 27.91 27.63 20.82 65-69 23.265 28.34 27.415 20.979999999999997 70-74 23.225 27.950000000000003 27.705000000000002 21.12 75-79 23.755000000000003 27.175 27.785 21.285 80-84 23.085 28.735 27.229999999999997 20.95 85-89 23.235 28.235 27.474999999999998 21.055 90-94 23.35 27.705000000000002 28.17 20.775 95-99 23.18 28.360000000000003 27.575 20.885 100-104 23.36 28.410000000000004 27.355 20.875 105-109 23.805 28.235 27.255000000000003 20.705000000000002 110-114 23.849999999999998 28.63 27.29 20.23 115-119 23.155 28.215 27.900000000000002 20.73 120-124 24.474999999999998 28.555000000000003 27.05 19.919999999999998 125-129 23.905 28.53 27.145000000000003 20.419999999999998 130-134 23.865 28.294999999999998 27.61 20.23 135-139 23.94 28.050000000000004 27.715 20.294999999999998 140-144 23.94 27.965 27.310000000000002 20.785 145-149 24.925 27.935 26.76 20.380000000000003 150-151 24.25 28.9375 26.974999999999998 19.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 3.0 12 3.5 13 1.0 14 1.0 15 1.0 16 1.5 17 2.5 18 2.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.5 25 6.0 26 4.5 27 3.0 28 6.5 29 9.0 30 19.5 31 23.0 32 21.5 33 37.0 34 56.5 35 63.5 36 75.5 37 112.5 38 141.0 39 154.0 40 166.0 41 210.5 42 265.0 43 278.5 44 273.0 45 276.5 46 274.0 47 260.5 48 238.5 49 199.5 50 167.0 51 137.5 52 111.0 53 80.5 54 55.5 55 48.5 56 40.0 57 38.0 58 31.5 59 21.0 60 15.0 61 11.0 62 11.5 63 9.0 64 4.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.52728269810804 83.45 2 7.650123389086922 13.950000000000001 3 0.6854949273375377 1.875 4 0.027419797093501508 0.1 5 0.054839594187003016 0.25 6 0.027419797093501508 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027419797093501508 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0375 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.3125 0.0 0.0 0.0 0.0 138-139 3.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGTT 10 0.006830828 145.0 7 GATACAG 10 0.006830828 145.0 5 TGATCCA 10 0.006830828 145.0 2 GACTGCC 10 0.006830828 145.0 5 GTGATCC 10 0.006830828 145.0 1 ATACAGT 10 0.006830828 145.0 6 ACAGTTA 10 0.006830828 145.0 8 >>END_MODULE Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610832 spots for SRR12670984.sra Written 610832 spots for SRR12670984.sra Read 610842 spots for SRR12670984.sra Written 610842 spots for SRR12670984.sra SRR ids: ['SRR12670984.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2dnu7nfw SRR12670984.sra spots: 12216650 blocks: [[1, 610832], [610833, 1221664], [1221665, 1832496], [1832497, 2443328], [2443329, 3054160], [3054161, 3664992], [3664993, 4275824], [4275825, 4886656], [4886657, 5497488], [5497489, 6108320], [6108321, 6719152], [6719153, 7329984], [7329985, 7940816], [7940817, 8551648], [8551649, 9162480], [9162481, 9773312], [9773313, 10384144], [10384145, 10994976], [10994977, 11605808], [11605809, 12216650]] SRR12670984 file size 4130051 SRR12670984 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670984 SRR12670984_1.fastq SRR12670984_2.fastq Input file: SRR12670984_1.fastq Paired file: SRR12670984_2.fastq trimmed: SRR12670984-trimmed-pair1.fastq, SRR12670984-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:29:41 2025 >> started Tue Feb 11 11:29:55 2025 >> done (14.045s) 12216650 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 1714 ( 0.01%) empty read pairs filtered out after trimming by size control 12214843 (99.99%) read pairs available; of these: 707629 ( 5.79%) trimmed read pairs available after processing 11507214 (94.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 10 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 11 0.00% 25 12 0.00% 26 9 0.00% 27 19 0.00% 28 9 0.00% 29 10 0.00% 30 11 0.00% 31 13 0.00% 32 9 0.00% 33 22 0.00% 34 14 0.00% 35 11 0.00% 36 15 0.00% 37 9 0.00% 38 11 0.00% 39 12 0.00% 40 17 0.00% 41 14 0.00% 42 19 0.00% 43 19 0.00% 44 12 0.00% 45 19 0.00% 46 24 0.00% 47 22 0.00% 48 32 0.00% 49 34 0.00% 50 40 0.00% 51 40 0.00% 52 46 0.00% 53 51 0.00% 54 38 0.00% 55 59 0.00% 56 59 0.00% 57 55 0.00% 58 91 0.00% 59 105 0.00% 60 139 0.00% 61 143 0.00% 62 144 0.00% 63 171 0.00% 64 169 0.00% 65 175 0.00% 66 254 0.00% 67 267 0.00% 68 290 0.00% 69 325 0.00% 70 392 0.00% 71 412 0.00% 72 526 0.00% 73 604 0.00% 74 670 0.01% 75 716 0.01% 76 746 0.01% 77 816 0.01% 78 854 0.01% 79 1067 0.01% 80 1098 0.01% 81 1247 0.01% 82 1381 0.01% 83 1538 0.01% 84 1728 0.01% 85 1902 0.02% 86 1995 0.02% 87 2155 0.02% 88 2205 0.02% 89 2515 0.02% 90 2540 0.02% 91 2795 0.02% 92 3099 0.03% 93 3221 0.03% 94 3398 0.03% 95 3733 0.03% 96 3809 0.03% 97 4114 0.03% 98 4253 0.03% 99 4477 0.04% 100 4627 0.04% 101 4809 0.04% 102 5161 0.04% 103 5253 0.04% 104 5583 0.05% 105 5882 0.05% 106 6105 0.05% 107 6388 0.05% 108 6611 0.05% 109 6930 0.06% 110 7043 0.06% 111 7443 0.06% 112 7720 0.06% 113 7689 0.06% 114 8180 0.07% 115 8435 0.07% 116 8931 0.07% 117 9460 0.08% 118 9436 0.08% 119 9758 0.08% 120 10319 0.08% 121 10685 0.09% 122 10754 0.09% 123 11285 0.09% 124 11766 0.10% 125 11990 0.10% 126 12579 0.10% 127 12656 0.10% 128 13178 0.11% 129 13521 0.11% 130 13911 0.11% 131 14043 0.11% 132 14791 0.12% 133 15170 0.12% 134 15489 0.13% 135 15867 0.13% 136 16368 0.13% 137 16558 0.14% 138 17488 0.14% 139 17987 0.15% 140 17762 0.15% 141 18708 0.15% 142 19197 0.16% 143 19480 0.16% 144 20260 0.17% 145 20710 0.17% 146 20745 0.17% 147 21615 0.18% 148 22009 0.18% 149 22809 0.19% 150 23367 0.19% 151 11507214 94.21% 12214843 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=21.13 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.66 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=25.35 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=7.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12670984 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:30:43 Started mapping on | Feb 11 11:30:43 Finished on | Feb 11 11:32:09 Mapping speed, Million of reads per hour | 511.32 Number of input reads | 12214843 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11286438 Uniquely mapped reads % | 92.40% Average mapped length | 297.77 Number of splices: Total | 11585111 Number of splices: Annotated (sjdb) | 11357101 Number of splices: GT/AG | 11355368 Number of splices: GC/AG | 191425 Number of splices: AT/AC | 7072 Number of splices: Non-canonical | 31246 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299661 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 148833 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 628744 628744 628744 N_multimapping 299661 299661 299661 N_noFeature 464599 11093936 520769 N_ambiguous 212289 776 75542 UnstrandedReadsAssigned:10609550 PositiveStrandReadsAssigned:191726 NegativeStrandReadsAssigned:10690127 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670984 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670984-trimmed-pair1.fastq SRR12670984-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,214,843 reads, 10,779,243 reads pseudoaligned [quant] estimated average fragment length: 283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR12670984.ke.tsv 34699 SRR12670984.se.tsv 87100 total ==> SRR12670984.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736 465 20.7506 Potri.005G024800.1.v4.1 1035 753 259 26.646 Potri.004G059700.1.v4.1 961 679.27 1 0.114047 Potri.007G009000.2.v4.1 1416 1134 0 0 Potri.003G141000.2.v4.1 2943 2661 729.62 21.2412 Potri.016G087400.1.v4.1 270 73.8449 535 561.255 Potri.015G069301.1.v4.1 564 299.442 0 0 Potri.010G195200.1.v4.1 1773 1491 143 7.42993 Potri.012G127500.1.v4.1 977 695.116 61 6.79828 ==> SRR12670984.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670984 completed mapping pipeline successfully