Starting /dee2/code/volunteer_pipeline.sh SRR12670985 current disk space = 3052388364288 free memory = 1345447228 SRR12670985 SRAfilesize 0414a98e711a75e93b1e7e13bbd484eb SRR12670985.sra SRR12670985.sra file validated SRR12670985 is paired end SRR12670985 is conventional basespace SRR12670985 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670985_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47875 37.0 37.0 37.0 37.0 37.0 2 36.3475 37.0 37.0 37.0 37.0 37.0 3 36.555 37.0 37.0 37.0 37.0 37.0 4 36.581 37.0 37.0 37.0 37.0 37.0 5 36.705 37.0 37.0 37.0 37.0 37.0 6 36.6295 37.0 37.0 37.0 37.0 37.0 7 36.54 37.0 37.0 37.0 37.0 37.0 8 36.6125 37.0 37.0 37.0 37.0 37.0 9 36.628 37.0 37.0 37.0 37.0 37.0 10-14 36.611900000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5997 37.0 37.0 37.0 37.0 37.0 20-24 36.5599 37.0 37.0 37.0 37.0 37.0 25-29 36.5599 37.0 37.0 37.0 37.0 37.0 30-34 36.486000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4876 37.0 37.0 37.0 37.0 37.0 40-44 36.4662 37.0 37.0 37.0 37.0 37.0 45-49 36.3582 37.0 37.0 37.0 37.0 37.0 50-54 36.410700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3464 37.0 37.0 37.0 37.0 37.0 60-64 36.2534 37.0 37.0 37.0 37.0 37.0 65-69 36.2119 37.0 37.0 37.0 37.0 37.0 70-74 36.2755 37.0 37.0 37.0 37.0 37.0 75-79 36.3835 37.0 37.0 37.0 37.0 37.0 80-84 36.3175 37.0 37.0 37.0 37.0 37.0 85-89 36.3273 37.0 37.0 37.0 37.0 37.0 90-94 36.2682 37.0 37.0 37.0 37.0 37.0 95-99 36.2252 37.0 37.0 37.0 37.0 37.0 100-104 36.2646 37.0 37.0 37.0 37.0 37.0 105-109 36.21510000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.2187 37.0 37.0 37.0 37.0 37.0 115-119 36.136700000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.12480000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.1003 37.0 37.0 37.0 37.0 37.0 130-134 35.934799999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0223 37.0 37.0 37.0 37.0 37.0 140-144 35.9774 37.0 37.0 37.0 37.0 37.0 145-149 35.7992 37.0 37.0 37.0 37.0 37.0 150-151 35.697500000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 2.0 24 0.0 25 2.0 26 4.0 27 11.0 28 8.0 29 29.0 30 27.0 31 33.0 32 52.0 33 90.0 34 130.0 35 234.0 36 2729.0 37 647.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.90718038528897 11.458593945459095 5.203902927195396 40.43032274205654 2 17.7 12.45 38.275 31.574999999999996 3 16.75 15.1 28.175 39.975 4 21.85 23.65 22.875 31.624999999999996 5 25.900000000000002 30.4 23.825 19.875 6 21.349999999999998 34.1 22.400000000000002 22.15 7 14.85 28.000000000000004 39.825 17.325 8 17.1 25.775 34.625 22.5 9 17.349999999999998 22.975 35.525 24.15 10-14 19.105 30.0 27.54 23.355 15-19 18.985 28.610000000000003 28.605000000000004 23.799999999999997 20-24 19.375 28.125 28.46 24.04 25-29 19.965 27.884999999999998 28.134999999999998 24.015 30-34 18.995 27.62 28.775000000000002 24.610000000000003 35-39 20.830000000000002 27.555000000000003 27.82 23.794999999999998 40-44 19.98 28.005000000000003 28.48 23.535 45-49 19.885 28.075 28.43 23.61 50-54 20.68 27.839999999999996 27.834999999999997 23.645 55-59 19.814999999999998 28.57 28.01 23.605 60-64 20.29 28.185 27.73 23.794999999999998 65-69 20.275000000000002 28.754999999999995 27.76 23.21 70-74 21.475 27.435 28.12 22.97 75-79 20.195 28.525 27.634999999999998 23.645 80-84 20.805 28.470000000000002 27.68 23.044999999999998 85-89 21.029999999999998 27.775 28.055000000000003 23.14 90-94 21.21 28.294999999999998 26.915 23.580000000000002 95-99 21.42 27.675 27.575 23.330000000000002 100-104 21.23 27.63 27.91 23.23 105-109 21.435000000000002 28.244999999999997 27.839999999999996 22.48 110-114 21.035 28.09 27.655 23.22 115-119 21.75 27.68 27.575 22.994999999999997 120-124 20.905 28.37 27.66 23.064999999999998 125-129 21.64 27.71 27.200000000000003 23.45 130-134 21.65 28.095 26.965 23.29 135-139 21.19 28.29 26.935 23.585 140-144 21.555 28.03 27.534999999999997 22.88 145-149 21.445 28.565 27.18 22.81 150-151 20.7625 27.425 27.275 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 3.0 25 4.0 26 5.0 27 7.5 28 10.5 29 20.0 30 22.5 31 22.5 32 38.0 33 46.0 34 52.5 35 62.5 36 68.5 37 93.0 38 129.5 39 152.5 40 163.5 41 203.5 42 254.5 43 255.5 44 278.5 45 304.0 46 268.0 47 243.5 48 227.0 49 208.5 50 180.0 51 141.0 52 114.0 53 84.5 54 74.5 55 62.0 56 40.5 57 32.0 58 27.0 59 21.5 60 13.5 61 9.5 62 5.5 63 2.0 64 2.0 65 7.0 66 12.0 67 11.0 68 7.0 69 3.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.63022866703848 81.25 2 8.254322364751813 14.799999999999999 3 0.8644729503625209 2.325 4 0.16731734523145567 0.6 5 0.027886224205242612 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027886224205242612 0.22499999999999998 >10 0.027886224205242612 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTCGGTTATCTCGTAT 27 0.675 TruSeq Adapter, Index 18 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTCGGTTATCGCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 18 (97% over 38bp) CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACGAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0125 0.0 102-103 0.7875000000000001 0.0 0.0 0.025 0.0 104-105 0.8625 0.0 0.0 0.025 0.0 106-107 1.0125 0.0 0.0 0.025 0.0 108-109 1.0625 0.0 0.0 0.025 0.0 110-111 1.125 0.0 0.0 0.025 0.0 112-113 1.225 0.0 0.0 0.025 0.0 114-115 1.3375 0.0 0.0 0.025 0.0 116-117 1.425 0.0 0.0 0.025 0.0 118-119 1.675 0.0 0.0 0.025 0.0 120-121 1.9500000000000002 0.0 0.0 0.025 0.0 122-123 2.075 0.0 0.0 0.025 0.0 124-125 2.3 0.0 0.0 0.025 0.0 126-127 2.625 0.0 0.0 0.025 0.0 128-129 2.9125 0.0 0.0 0.025 0.0 130-131 3.2 0.0 0.0 0.025 0.0 132-133 3.425 0.0 0.0 0.025 0.0 134-135 3.7875 0.0 0.0 0.025 0.0 136-137 4.325 0.0 0.0 0.025 0.0 138-139 4.6875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTTGT 10 0.006830828 145.0 3 >>END_MODULE SRR12670985 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670985_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2485 37.0 37.0 37.0 37.0 37.0 2 36.0265 37.0 37.0 37.0 37.0 37.0 3 36.241 37.0 37.0 37.0 37.0 37.0 4 36.261 37.0 37.0 37.0 37.0 37.0 5 36.283 37.0 37.0 37.0 37.0 37.0 6 36.292 37.0 37.0 37.0 37.0 37.0 7 36.2265 37.0 37.0 37.0 37.0 37.0 8 36.2595 37.0 37.0 37.0 37.0 37.0 9 36.363 37.0 37.0 37.0 37.0 37.0 10-14 36.3115 37.0 37.0 37.0 37.0 37.0 15-19 36.3165 37.0 37.0 37.0 37.0 37.0 20-24 36.3356 37.0 37.0 37.0 37.0 37.0 25-29 36.156699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.0866 37.0 37.0 37.0 37.0 37.0 35-39 36.0943 37.0 37.0 37.0 37.0 37.0 40-44 36.084500000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.0488 37.0 37.0 37.0 37.0 37.0 50-54 36.02760000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.98100000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.022999999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9798 37.0 37.0 37.0 37.0 37.0 70-74 35.9658 37.0 37.0 37.0 37.0 37.0 75-79 35.8468 37.0 37.0 37.0 37.0 37.0 80-84 35.9004 37.0 37.0 37.0 37.0 37.0 85-89 35.872699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9484 37.0 37.0 37.0 37.0 37.0 95-99 35.991600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0347 37.0 37.0 37.0 37.0 37.0 105-109 35.9031 37.0 37.0 37.0 37.0 37.0 110-114 35.95890000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8934 37.0 37.0 37.0 37.0 37.0 120-124 35.8563 37.0 37.0 37.0 37.0 37.0 125-129 35.8586 37.0 37.0 37.0 37.0 37.0 130-134 35.739999999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.772400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.630100000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.4587 37.0 37.0 37.0 37.0 37.0 150-151 35.06625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 2.0 17 0.0 18 2.0 19 2.0 20 2.0 21 3.0 22 3.0 23 10.0 24 8.0 25 4.0 26 11.0 27 14.0 28 16.0 29 20.0 30 34.0 31 45.0 32 58.0 33 96.0 34 179.0 35 378.0 36 2645.0 37 465.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5 21.6 9.700000000000001 27.200000000000003 2 26.150000000000002 25.2 32.125 16.525000000000002 3 20.925 25.974999999999998 33.825 19.275000000000002 4 26.674999999999997 31.8 22.6 18.925 5 25.674999999999997 38.175 21.349999999999998 14.799999999999999 6 21.6 37.775 22.650000000000002 17.974999999999998 7 21.65 22.05 37.95 18.35 8 22.175 24.65 29.7 23.474999999999998 9 22.5 23.95 29.65 23.9 10-14 23.225 29.160000000000004 27.21 20.405 15-19 23.630000000000003 27.985 27.765 20.62 20-24 23.32 28.754999999999995 26.815 21.11 25-29 23.1 27.889999999999997 28.035 20.974999999999998 30-34 23.169999999999998 27.750000000000004 28.04 21.04 35-39 23.16 27.615000000000002 28.16 21.065 40-44 23.14 28.23 28.21 20.419999999999998 45-49 22.86 27.265 28.4 21.475 50-54 22.45 27.975 27.505000000000003 22.07 55-59 22.915 27.825 28.125 21.135 60-64 23.64 26.905 28.34 21.115000000000002 65-69 24.195 27.54 27.41 20.855 70-74 23.705000000000002 28.15 27.785 20.36 75-79 23.415 27.04 28.43 21.115000000000002 80-84 24.135 27.384999999999998 27.735 20.745 85-89 23.91 27.71 28.005000000000003 20.375 90-94 23.905 27.860000000000003 27.605 20.630000000000003 95-99 23.71 28.055000000000003 27.765 20.47 100-104 24.365000000000002 27.045 27.63 20.96 105-109 24.215 27.705000000000002 27.894999999999996 20.185 110-114 23.9 28.055000000000003 27.689999999999998 20.355 115-119 24.18 27.495000000000005 27.405 20.919999999999998 120-124 24.85 27.794999999999998 27.24 20.115 125-129 24.535 28.005000000000003 27.38 20.080000000000002 130-134 24.490000000000002 27.800000000000004 27.66 20.05 135-139 24.98 27.97 26.99 20.06 140-144 25.55 26.810000000000002 27.72 19.919999999999998 145-149 25.569999999999997 28.01 26.91 19.509999999999998 150-151 26.125 27.625 26.7125 19.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 1.5 22 0.5 23 3.5 24 3.5 25 3.5 26 6.0 27 5.5 28 5.0 29 12.5 30 21.0 31 23.5 32 27.5 33 39.5 34 47.5 35 47.0 36 69.5 37 112.0 38 146.0 39 175.0 40 216.5 41 238.0 42 251.0 43 266.5 44 276.5 45 281.0 46 266.5 47 250.5 48 221.5 49 192.5 50 171.5 51 129.0 52 86.0 53 70.5 54 65.5 55 57.5 56 38.0 57 25.5 58 25.0 59 21.5 60 16.5 61 10.0 62 6.0 63 4.5 64 3.5 65 2.5 66 2.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 1.0 77 1.0 78 0.0 79 0.0 80 0.5 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 1.0 92 2.0 93 1.5 94 0.5 95 1.0 96 2.0 97 2.5 98 3.0 99 4.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.10251450676982 82.425 2 7.875103619784471 14.249999999999998 3 0.7184305056645481 1.95 4 0.22105554020447638 0.8 5 0.055263885051119094 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027631942525559547 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit CCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.25 0.0 0.0 0.0 0.0 132-133 3.4749999999999996 0.0 0.0 0.0 0.0 134-135 3.8375000000000004 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACACA 10 0.006830828 145.0 2 >>END_MODULE Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660225 spots for SRR12670985.sra Written 660225 spots for SRR12670985.sra Read 660241 spots for SRR12670985.sra Written 660241 spots for SRR12670985.sra SRR ids: ['SRR12670985.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zw7fn1hu SRR12670985.sra spots: 13204516 blocks: [[1, 660225], [660226, 1320450], [1320451, 1980675], [1980676, 2640900], [2640901, 3301125], [3301126, 3961350], [3961351, 4621575], [4621576, 5281800], [5281801, 5942025], [5942026, 6602250], [6602251, 7262475], [7262476, 7922700], [7922701, 8582925], [8582926, 9243150], [9243151, 9903375], [9903376, 10563600], [10563601, 11223825], [11223826, 11884050], [11884051, 12544275], [12544276, 13204516]] SRR12670985 file size 4465771 SRR12670985 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670985 SRR12670985_1.fastq SRR12670985_2.fastq Input file: SRR12670985_1.fastq Paired file: SRR12670985_2.fastq trimmed: SRR12670985-trimmed-pair1.fastq, SRR12670985-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:10:45 2025 >> started Tue Feb 11 11:11:06 2025 >> done (20.950s) 13204516 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 123357 ( 0.93%) empty read pairs filtered out after trimming by size control 13081086 (99.07%) read pairs available; of these: 894846 ( 6.84%) trimmed read pairs available after processing 12186240 (93.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 10 0.00% 21 3 0.00% 22 5 0.00% 23 1 0.00% 24 10 0.00% 25 7 0.00% 26 8 0.00% 27 10 0.00% 28 11 0.00% 29 9 0.00% 30 9 0.00% 31 14 0.00% 32 16 0.00% 33 9 0.00% 34 16 0.00% 35 17 0.00% 36 13 0.00% 37 17 0.00% 38 10 0.00% 39 16 0.00% 40 16 0.00% 41 19 0.00% 42 23 0.00% 43 19 0.00% 44 13 0.00% 45 17 0.00% 46 23 0.00% 47 36 0.00% 48 26 0.00% 49 38 0.00% 50 55 0.00% 51 46 0.00% 52 48 0.00% 53 46 0.00% 54 59 0.00% 55 62 0.00% 56 85 0.00% 57 92 0.00% 58 75 0.00% 59 89 0.00% 60 105 0.00% 61 149 0.00% 62 184 0.00% 63 162 0.00% 64 226 0.00% 65 184 0.00% 66 244 0.00% 67 276 0.00% 68 299 0.00% 69 340 0.00% 70 411 0.00% 71 450 0.00% 72 554 0.00% 73 544 0.00% 74 645 0.00% 75 766 0.01% 76 834 0.01% 77 836 0.01% 78 990 0.01% 79 1131 0.01% 80 1204 0.01% 81 1485 0.01% 82 1484 0.01% 83 1686 0.01% 84 1880 0.01% 85 2131 0.02% 86 2247 0.02% 87 2494 0.02% 88 2583 0.02% 89 2752 0.02% 90 2956 0.02% 91 3258 0.02% 92 3493 0.03% 93 3679 0.03% 94 4155 0.03% 95 4383 0.03% 96 4750 0.04% 97 5087 0.04% 98 5457 0.04% 99 5636 0.04% 100 5753 0.04% 101 6244 0.05% 102 6448 0.05% 103 6804 0.05% 104 7166 0.05% 105 7675 0.06% 106 7992 0.06% 107 8342 0.06% 108 8615 0.07% 109 9082 0.07% 110 9041 0.07% 111 9702 0.07% 112 9947 0.08% 113 10296 0.08% 114 10678 0.08% 115 11157 0.09% 116 11818 0.09% 117 12115 0.09% 118 12617 0.10% 119 12978 0.10% 120 13628 0.10% 121 13729 0.10% 122 14095 0.11% 123 14670 0.11% 124 15066 0.12% 125 15614 0.12% 126 16282 0.12% 127 16629 0.13% 128 17113 0.13% 129 17603 0.13% 130 18246 0.14% 131 18519 0.14% 132 18984 0.15% 133 19510 0.15% 134 19425 0.15% 135 20636 0.16% 136 20562 0.16% 137 21306 0.16% 138 21993 0.17% 139 22434 0.17% 140 22823 0.17% 141 23381 0.18% 142 24143 0.18% 143 24448 0.19% 144 24794 0.19% 145 25204 0.19% 146 25976 0.20% 147 26664 0.20% 148 27753 0.21% 149 27642 0.21% 150 28266 0.22% 151 12186240 93.16% 13081086 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=13.70 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=31 prefix-density=0.68 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=66.77 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=8.3 sequence=AAAAGAAAAGAAAA SRR12670985 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:11:59 Started mapping on | Feb 11 11:11:59 Finished on | Feb 11 11:13:30 Mapping speed, Million of reads per hour | 517.49 Number of input reads | 13081086 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12364114 Uniquely mapped reads % | 94.52% Average mapped length | 297.45 Number of splices: Total | 12305305 Number of splices: Annotated (sjdb) | 12056134 Number of splices: GT/AG | 12062741 Number of splices: GC/AG | 201287 Number of splices: AT/AC | 7046 Number of splices: Non-canonical | 34231 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306765 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 53424 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 410207 410207 410207 N_multimapping 306765 306765 306765 N_noFeature 488610 12197751 548225 N_ambiguous 180939 759 73781 UnstrandedReadsAssigned:11694565 PositiveStrandReadsAssigned:165604 NegativeStrandReadsAssigned:11742108 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670985 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670985-trimmed-pair1.fastq SRR12670985-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,081,086 reads, 11,763,823 reads pseudoaligned [quant] estimated average fragment length: 274.199 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12670985.ke.tsv 34699 SRR12670985.se.tsv 87100 total ==> SRR12670985.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.8 401 17.9791 Potri.005G024800.1.v4.1 1035 761.801 144 14.7874 Potri.004G059700.1.v4.1 961 687.956 6 0.682277 Potri.007G009000.2.v4.1 1416 1142.8 0 0 Potri.003G141000.2.v4.1 2943 2669.8 761 22.2985 Potri.016G087400.1.v4.1 270 76.5235 481 491.723 Potri.015G069301.1.v4.1 564 305.175 0 0 Potri.010G195200.1.v4.1 1773 1499.8 34 1.77344 Potri.012G127500.1.v4.1 977 703.859 39 4.3346 ==> SRR12670985.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 297 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12670985 completed mapping pipeline successfully