Starting /dee2/code/volunteer_pipeline.sh SRR12670986 current disk space = 3051311296512 free memory = 1472739952 SRR12670986 SRAfilesize fa0baeeb8bb3b6c405a5bc7991b05a07 SRR12670986.sra SRR12670986.sra file validated SRR12670986 is paired end SRR12670986 is conventional basespace SRR12670986 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670986_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4375 37.0 37.0 37.0 37.0 37.0 2 36.412 37.0 37.0 37.0 37.0 37.0 3 36.443 37.0 37.0 37.0 37.0 37.0 4 36.5625 37.0 37.0 37.0 37.0 37.0 5 36.515 37.0 37.0 37.0 37.0 37.0 6 36.585 37.0 37.0 37.0 37.0 37.0 7 36.508 37.0 37.0 37.0 37.0 37.0 8 36.5675 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.6261 37.0 37.0 37.0 37.0 37.0 15-19 36.5827 37.0 37.0 37.0 37.0 37.0 20-24 36.5293 37.0 37.0 37.0 37.0 37.0 25-29 36.4908 37.0 37.0 37.0 37.0 37.0 30-34 36.458600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.443 37.0 37.0 37.0 37.0 37.0 40-44 36.4158 37.0 37.0 37.0 37.0 37.0 45-49 36.438100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3997 37.0 37.0 37.0 37.0 37.0 55-59 36.3164 37.0 37.0 37.0 37.0 37.0 60-64 36.3084 37.0 37.0 37.0 37.0 37.0 65-69 36.3 37.0 37.0 37.0 37.0 37.0 70-74 36.2332 37.0 37.0 37.0 37.0 37.0 75-79 36.236000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.197599999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.1724 37.0 37.0 37.0 37.0 37.0 90-94 36.2196 37.0 37.0 37.0 37.0 37.0 95-99 36.0427 37.0 37.0 37.0 37.0 37.0 100-104 36.076800000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0581 37.0 37.0 37.0 37.0 37.0 110-114 36.0169 37.0 37.0 37.0 37.0 37.0 115-119 35.985200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.953199999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0072 37.0 37.0 37.0 37.0 37.0 130-134 35.824400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.7694 37.0 37.0 37.0 37.0 37.0 140-144 35.763000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6121 37.0 37.0 37.0 37.0 37.0 150-151 35.476749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 3.0 24 10.0 25 4.0 26 12.0 27 17.0 28 20.0 29 20.0 30 38.0 31 34.0 32 44.0 33 76.0 34 118.0 35 262.0 36 2633.0 37 705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.825 11.825 5.3 35.05 2 18.85 11.05 37.05 33.050000000000004 3 17.0 15.325 28.449999999999996 39.225 4 22.3 21.575 24.075 32.05 5 23.95 29.2 24.975 21.875 6 20.424999999999997 32.775 23.7 23.1 7 14.575 27.6 42.225 15.6 8 15.625 24.375 34.425 25.575 9 17.299999999999997 23.5 35.175 24.025 10-14 19.2 29.515 28.705000000000002 22.58 15-19 20.080000000000002 27.389999999999997 28.37 24.16 20-24 19.665 28.384999999999998 28.155 23.794999999999998 25-29 20.255000000000003 28.51 27.894999999999996 23.34 30-34 19.79 27.79 28.13 24.29 35-39 19.875 27.765 28.285 24.075 40-44 20.31 28.08 27.73 23.880000000000003 45-49 20.41 27.91 28.199999999999996 23.48 50-54 20.625 28.685 27.339999999999996 23.35 55-59 20.415 28.13 27.85 23.605 60-64 20.369999999999997 28.48 27.46 23.69 65-69 19.509999999999998 28.875 27.975 23.64 70-74 20.175 28.660000000000004 27.6 23.565 75-79 19.865 28.410000000000004 27.865000000000002 23.86 80-84 19.994999999999997 27.994999999999997 27.66 24.349999999999998 85-89 20.244999999999997 28.255000000000003 28.08 23.419999999999998 90-94 20.11 27.98 27.675 24.235 95-99 20.44 28.215 28.075 23.27 100-104 20.495 28.694999999999997 27.42 23.39 105-109 20.62 28.465 27.77 23.145 110-114 20.7 28.425 27.725 23.150000000000002 115-119 20.805 28.299999999999997 27.315 23.580000000000002 120-124 20.380000000000003 28.17 27.82 23.630000000000003 125-129 20.895 27.665 27.99 23.45 130-134 20.64 28.24 27.435 23.685000000000002 135-139 20.96 27.425 27.965 23.65 140-144 21.099999999999998 27.83 27.71 23.36 145-149 20.919999999999998 28.21 27.315 23.555 150-151 21.0125 28.575 27.5875 22.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.5 21 2.0 22 2.5 23 1.5 24 1.5 25 4.5 26 5.5 27 5.0 28 7.5 29 10.5 30 17.0 31 25.0 32 32.0 33 39.5 34 52.0 35 69.0 36 84.5 37 94.0 38 121.0 39 162.0 40 183.0 41 201.5 42 234.5 43 256.5 44 250.0 45 243.0 46 266.5 47 276.5 48 237.0 49 208.5 50 196.0 51 164.0 52 117.0 53 97.5 54 84.5 55 55.5 56 52.0 57 44.0 58 25.0 59 17.5 60 14.0 61 8.5 62 4.0 63 3.5 64 3.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.59050772626932 82.075 2 8.526490066225167 15.45 3 0.8002207505518764 2.175 4 0.08278145695364239 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.2375 0.0 0.0 0.0 0.0 136-137 4.550000000000001 0.0 0.0 0.0 0.0 138-139 5.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACAA 10 0.006830828 145.0 7 >>END_MODULE SRR12670986 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670986_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.207 37.0 37.0 37.0 37.0 37.0 2 36.1675 37.0 37.0 37.0 37.0 37.0 3 36.13 37.0 37.0 37.0 37.0 37.0 4 36.2105 37.0 37.0 37.0 37.0 37.0 5 36.3245 37.0 37.0 37.0 37.0 37.0 6 36.328 37.0 37.0 37.0 37.0 37.0 7 36.231 37.0 37.0 37.0 37.0 37.0 8 36.339 37.0 37.0 37.0 37.0 37.0 9 36.283 37.0 37.0 37.0 37.0 37.0 10-14 36.3436 37.0 37.0 37.0 37.0 37.0 15-19 36.2978 37.0 37.0 37.0 37.0 37.0 20-24 36.3193 37.0 37.0 37.0 37.0 37.0 25-29 36.221399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.228500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2243 37.0 37.0 37.0 37.0 37.0 40-44 36.1416 37.0 37.0 37.0 37.0 37.0 45-49 36.147499999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.1055 37.0 37.0 37.0 37.0 37.0 55-59 36.0643 37.0 37.0 37.0 37.0 37.0 60-64 36.1115 37.0 37.0 37.0 37.0 37.0 65-69 36.0953 37.0 37.0 37.0 37.0 37.0 70-74 36.0373 37.0 37.0 37.0 37.0 37.0 75-79 36.021699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0536 37.0 37.0 37.0 37.0 37.0 85-89 35.9229 37.0 37.0 37.0 37.0 37.0 90-94 35.9507 37.0 37.0 37.0 37.0 37.0 95-99 35.976 37.0 37.0 37.0 37.0 37.0 100-104 35.9326 37.0 37.0 37.0 37.0 37.0 105-109 35.9141 37.0 37.0 37.0 37.0 37.0 110-114 35.9012 37.0 37.0 37.0 37.0 37.0 115-119 35.8718 37.0 37.0 37.0 37.0 37.0 120-124 35.786 37.0 37.0 37.0 37.0 37.0 125-129 35.6613 37.0 37.0 37.0 37.0 37.0 130-134 35.6859 37.0 37.0 37.0 37.0 37.0 135-139 35.57379999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.5852 37.0 37.0 37.0 37.0 37.0 145-149 35.2767 37.0 37.0 37.0 34.6 37.0 150-151 34.981750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 4.0 16 1.0 17 2.0 18 1.0 19 1.0 20 0.0 21 3.0 22 1.0 23 5.0 24 7.0 25 10.0 26 9.0 27 15.0 28 19.0 29 25.0 30 35.0 31 42.0 32 45.0 33 97.0 34 152.0 35 380.0 36 2647.0 37 493.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.15 26.950000000000003 9.049999999999999 21.85 2 28.375 25.525 31.125000000000004 14.975 3 20.349999999999998 27.675 34.25 17.724999999999998 4 23.3 33.7 24.275 18.725 5 25.25 37.675 21.325 15.75 6 20.549999999999997 37.6 23.75 18.099999999999998 7 20.05 23.25 38.025 18.675 8 18.875 26.674999999999997 30.475 23.974999999999998 9 21.475 24.85 30.625000000000004 23.05 10-14 23.01 29.635 27.279999999999998 20.075000000000003 15-19 22.39 28.535 27.925 21.15 20-24 22.405 29.465000000000003 27.839999999999996 20.29 25-29 22.97 28.325 27.805000000000003 20.9 30-34 22.075 28.54 28.660000000000004 20.724999999999998 35-39 22.725 28.28 27.72 21.275 40-44 22.869999999999997 28.605000000000004 27.85 20.674999999999997 45-49 23.055 27.63 28.249999999999996 21.065 50-54 22.175 28.71 27.750000000000004 21.365000000000002 55-59 22.24 28.615000000000002 27.855 21.29 60-64 23.294999999999998 27.474999999999998 27.905 21.325 65-69 22.305 28.244999999999997 27.88 21.57 70-74 23.04 28.07 27.305 21.584999999999997 75-79 22.78 28.634999999999998 27.529999999999998 21.055 80-84 23.225 28.17 27.485 21.12 85-89 23.1 28.294999999999998 27.79 20.815 90-94 23.34 28.08 28.134999999999998 20.445 95-99 23.615 28.470000000000002 27.55 20.365 100-104 24.01 28.49 27.235 20.265 105-109 22.93 28.34 28.044999999999998 20.685000000000002 110-114 23.235 28.360000000000003 28.525 19.88 115-119 23.885 28.865000000000002 26.479999999999997 20.77 120-124 24.135 28.43 27.405 20.03 125-129 24.39 28.46 27.21 19.939999999999998 130-134 23.630000000000003 28.194999999999997 27.85 20.325 135-139 24.279999999999998 27.644999999999996 28.125 19.950000000000003 140-144 24.195 27.99 27.555000000000003 20.26 145-149 25.61 27.92 26.724999999999998 19.744999999999997 150-151 25.087500000000002 28.1375 26.900000000000002 19.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 2.0 15 2.0 16 1.5 17 1.5 18 1.5 19 2.0 20 1.0 21 3.0 22 4.0 23 1.5 24 3.0 25 6.0 26 9.5 27 12.0 28 12.5 29 12.0 30 16.5 31 25.5 32 38.0 33 39.0 34 50.0 35 70.0 36 82.0 37 107.5 38 141.5 39 176.5 40 205.5 41 230.0 42 246.0 43 263.0 44 287.5 45 281.5 46 251.0 47 235.5 48 225.5 49 193.0 50 163.0 51 128.5 52 87.5 53 75.0 54 67.5 55 59.5 56 46.0 57 31.5 58 26.0 59 20.5 60 14.5 61 10.5 62 5.5 63 3.0 64 4.0 65 3.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.6397119911382 81.825 2 8.39102741622819 15.15 3 0.7754084741068956 2.1 4 0.11077263915812793 0.4 5 0.027693159789531983 0.125 6 0.027693159789531983 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027693159789531983 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 10 0.25 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.0374999999999996 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.675000000000001 0.0 0.0 0.0 0.0 138-139 5.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACTAA 10 0.006830828 145.0 5 TTTAAAA 10 0.006830828 145.0 7 >>END_MODULE Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628818 spots for SRR12670986.sra Written 628818 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra Read 628799 spots for SRR12670986.sra Written 628799 spots for SRR12670986.sra SRR ids: ['SRR12670986.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ecktuk50 SRR12670986.sra spots: 12575999 blocks: [[1, 628799], [628800, 1257598], [1257599, 1886397], [1886398, 2515196], [2515197, 3143995], [3143996, 3772794], [3772795, 4401593], [4401594, 5030392], [5030393, 5659191], [5659192, 6287990], [6287991, 6916789], [6916790, 7545588], [7545589, 8174387], [8174388, 8803186], [8803187, 9431985], [9431986, 10060784], [10060785, 10689583], [10689584, 11318382], [11318383, 11947181], [11947182, 12575999]] SRR12670986 file size 4252174 SRR12670986 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670986 SRR12670986_1.fastq SRR12670986_2.fastq Input file: SRR12670986_1.fastq Paired file: SRR12670986_2.fastq trimmed: SRR12670986-trimmed-pair1.fastq, SRR12670986-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:54:58 2025 >> started Tue Feb 11 11:55:13 2025 >> done (14.673s) 12575999 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 2913 ( 0.02%) empty read pairs filtered out after trimming by size control 12572979 (99.98%) read pairs available; of these: 917805 ( 7.30%) trimmed read pairs available after processing 11655174 (92.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 11 0.00% 21 4 0.00% 22 1 0.00% 23 6 0.00% 24 9 0.00% 25 7 0.00% 26 11 0.00% 27 18 0.00% 28 11 0.00% 29 10 0.00% 30 8 0.00% 31 15 0.00% 32 12 0.00% 33 18 0.00% 34 25 0.00% 35 14 0.00% 36 19 0.00% 37 13 0.00% 38 12 0.00% 39 9 0.00% 40 19 0.00% 41 16 0.00% 42 18 0.00% 43 22 0.00% 44 18 0.00% 45 19 0.00% 46 28 0.00% 47 16 0.00% 48 33 0.00% 49 35 0.00% 50 35 0.00% 51 47 0.00% 52 55 0.00% 53 55 0.00% 54 62 0.00% 55 85 0.00% 56 76 0.00% 57 85 0.00% 58 99 0.00% 59 122 0.00% 60 146 0.00% 61 151 0.00% 62 188 0.00% 63 218 0.00% 64 226 0.00% 65 280 0.00% 66 289 0.00% 67 313 0.00% 68 375 0.00% 69 429 0.00% 70 496 0.00% 71 547 0.00% 72 703 0.01% 73 753 0.01% 74 807 0.01% 75 853 0.01% 76 1038 0.01% 77 1059 0.01% 78 1223 0.01% 79 1277 0.01% 80 1470 0.01% 81 1622 0.01% 82 1844 0.01% 83 1932 0.02% 84 2220 0.02% 85 2402 0.02% 86 2517 0.02% 87 2635 0.02% 88 2952 0.02% 89 3059 0.02% 90 3197 0.03% 91 3469 0.03% 92 3723 0.03% 93 4084 0.03% 94 4286 0.03% 95 4632 0.04% 96 4747 0.04% 97 5135 0.04% 98 5286 0.04% 99 5720 0.05% 100 5941 0.05% 101 5855 0.05% 102 6396 0.05% 103 6872 0.05% 104 7132 0.06% 105 7517 0.06% 106 7667 0.06% 107 8005 0.06% 108 8372 0.07% 109 8654 0.07% 110 8823 0.07% 111 9332 0.07% 112 9531 0.08% 113 9902 0.08% 114 10494 0.08% 115 11034 0.09% 116 11342 0.09% 117 11976 0.10% 118 12340 0.10% 119 12630 0.10% 120 13335 0.11% 121 13833 0.11% 122 14202 0.11% 123 14625 0.12% 124 14865 0.12% 125 15337 0.12% 126 16266 0.13% 127 16645 0.13% 128 17190 0.14% 129 17603 0.14% 130 18361 0.15% 131 18618 0.15% 132 18894 0.15% 133 19900 0.16% 134 20118 0.16% 135 20520 0.16% 136 21426 0.17% 137 22054 0.18% 138 22886 0.18% 139 23648 0.19% 140 23998 0.19% 141 24768 0.20% 142 24986 0.20% 143 25712 0.20% 144 26575 0.21% 145 27015 0.21% 146 27619 0.22% 147 28005 0.22% 148 29021 0.23% 149 29623 0.24% 150 30844 0.25% 151 11655174 92.70% 12572979 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.60 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=7.77 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=AAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=25 prefix-density=0.72 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=61.35 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=8.9 sequence=AAAAGAAAAGAAAA SRR12670986 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:55:57 Started mapping on | Feb 11 11:55:57 Finished on | Feb 11 11:57:22 Mapping speed, Million of reads per hour | 532.50 Number of input reads | 12572979 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11746807 Uniquely mapped reads % | 93.43% Average mapped length | 297.18 Number of splices: Total | 11923896 Number of splices: Annotated (sjdb) | 11692243 Number of splices: GT/AG | 11688151 Number of splices: GC/AG | 198168 Number of splices: AT/AC | 6773 Number of splices: Non-canonical | 30804 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276288 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 61215 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 549884 549884 549884 N_multimapping 276288 276288 276288 N_noFeature 474038 11580038 526679 N_ambiguous 181418 767 66848 UnstrandedReadsAssigned:11091351 PositiveStrandReadsAssigned:166002 NegativeStrandReadsAssigned:11153280 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670986 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670986-trimmed-pair1.fastq SRR12670986-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,572,979 reads, 11,181,918 reads pseudoaligned [quant] estimated average fragment length: 267.33 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12670986.ke.tsv 34699 SRR12670986.se.tsv 87100 total ==> SRR12670986.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.67 307 13.5557 Potri.005G024800.1.v4.1 1035 768.67 180 18.1121 Potri.004G059700.1.v4.1 961 694.866 0 0 Potri.007G009000.2.v4.1 1416 1149.67 0 0 Potri.003G141000.2.v4.1 2943 2676.67 621.508 17.9592 Potri.016G087400.1.v4.1 270 77.8487 520 516.64 Potri.015G069301.1.v4.1 564 311.543 0 0 Potri.010G195200.1.v4.1 1773 1506.67 32 1.64274 Potri.012G127500.1.v4.1 977 710.801 82 8.92282 ==> SRR12670986.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670986 completed mapping pipeline successfully