Starting /dee2/code/volunteer_pipeline.sh SRR12670988 current disk space = 3051667615744 free memory = 1310847996 SRR12670988 SRAfilesize 8a4d9696d93c82b503da57d25cbb76fb SRR12670988.sra SRR12670988.sra file validated SRR12670988 is paired end SRR12670988 is conventional basespace SRR12670988 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670988_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4825 37.0 37.0 37.0 37.0 37.0 2 36.3635 37.0 37.0 37.0 37.0 37.0 3 36.5345 37.0 37.0 37.0 37.0 37.0 4 36.6385 37.0 37.0 37.0 37.0 37.0 5 36.673 37.0 37.0 37.0 37.0 37.0 6 36.6265 37.0 37.0 37.0 37.0 37.0 7 36.55 37.0 37.0 37.0 37.0 37.0 8 36.6705 37.0 37.0 37.0 37.0 37.0 9 36.6435 37.0 37.0 37.0 37.0 37.0 10-14 36.6142 37.0 37.0 37.0 37.0 37.0 15-19 36.6302 37.0 37.0 37.0 37.0 37.0 20-24 36.613200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.5587 37.0 37.0 37.0 37.0 37.0 30-34 36.517700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5309 37.0 37.0 37.0 37.0 37.0 40-44 36.5295 37.0 37.0 37.0 37.0 37.0 45-49 36.5112 37.0 37.0 37.0 37.0 37.0 50-54 36.4727 37.0 37.0 37.0 37.0 37.0 55-59 36.4677 37.0 37.0 37.0 37.0 37.0 60-64 36.4344 37.0 37.0 37.0 37.0 37.0 65-69 36.408100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.448 37.0 37.0 37.0 37.0 37.0 75-79 36.3449 37.0 37.0 37.0 37.0 37.0 80-84 36.351600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.299099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.3396 37.0 37.0 37.0 37.0 37.0 95-99 36.28 37.0 37.0 37.0 37.0 37.0 100-104 36.2459 37.0 37.0 37.0 37.0 37.0 105-109 36.2226 37.0 37.0 37.0 37.0 37.0 110-114 36.1794 37.0 37.0 37.0 37.0 37.0 115-119 36.1113 37.0 37.0 37.0 37.0 37.0 120-124 36.130399999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.1016 37.0 37.0 37.0 37.0 37.0 130-134 35.9157 37.0 37.0 37.0 37.0 37.0 135-139 36.000800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.9282 37.0 37.0 37.0 37.0 37.0 145-149 35.8389 37.0 37.0 37.0 37.0 37.0 150-151 35.733999999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 2.0 26 6.0 27 8.0 28 11.0 29 15.0 30 27.0 31 30.0 32 46.0 33 94.0 34 101.0 35 252.0 36 2722.0 37 682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.349999999999998 10.875 4.875 53.900000000000006 2 14.899999999999999 11.575000000000001 44.6 28.925 3 16.625 14.95 27.725 40.699999999999996 4 22.400000000000002 22.425 22.85 32.324999999999996 5 24.075 29.125 26.900000000000002 19.900000000000002 6 19.7 31.75 26.224999999999998 22.325 7 15.25 25.15 42.699999999999996 16.900000000000002 8 16.3 24.15 35.4 24.15 9 16.025 22.575 36.225 25.174999999999997 10-14 19.11 30.005 27.985 22.900000000000002 15-19 19.405 27.88 28.494999999999997 24.22 20-24 19.85 28.18 27.994999999999997 23.974999999999998 25-29 19.580000000000002 28.16 28.28 23.98 30-34 19.12 27.97 28.89 24.02 35-39 19.96 28.02 28.075 23.945 40-44 20.064999999999998 28.065 28.355000000000004 23.515 45-49 19.400000000000002 28.660000000000004 27.339999999999996 24.6 50-54 19.675 28.29 27.88 24.154999999999998 55-59 20.294999999999998 28.255000000000003 27.725 23.724999999999998 60-64 19.985 28.455000000000002 27.72 23.84 65-69 20.11 28.26 27.83 23.799999999999997 70-74 20.76 27.544999999999998 27.725 23.97 75-79 20.635 27.744999999999997 27.76 23.86 80-84 20.87 28.194999999999997 27.785 23.150000000000002 85-89 19.48 28.044999999999998 28.29 24.185000000000002 90-94 19.78 27.87 28.59 23.76 95-99 19.73 28.000000000000004 28.799999999999997 23.47 100-104 20.235 28.01 28.055000000000003 23.7 105-109 20.345 28.310000000000002 27.150000000000002 24.195 110-114 19.53 28.515 27.765 24.19 115-119 20.16 28.03 27.744999999999997 24.065 120-124 20.61 27.62 27.894999999999996 23.875 125-129 20.06 27.845 27.785 24.310000000000002 130-134 20.96 27.57 27.405 24.065 135-139 20.96 27.839999999999996 28.060000000000002 23.14 140-144 20.895 27.875 28.065 23.165 145-149 20.615 27.810000000000002 27.41 24.165 150-151 20.5375 27.025 27.875 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 2.0 22 1.5 23 1.0 24 2.5 25 5.0 26 6.5 27 8.5 28 12.5 29 13.5 30 24.0 31 28.5 32 30.5 33 41.0 34 59.5 35 74.0 36 83.5 37 111.0 38 126.5 39 145.5 40 176.5 41 205.0 42 229.0 43 240.0 44 269.0 45 280.0 46 259.0 47 258.0 48 246.0 49 207.5 50 169.0 51 137.0 52 107.0 53 85.0 54 80.5 55 78.0 56 61.5 57 40.0 58 25.5 59 20.0 60 12.5 61 7.0 62 7.0 63 4.0 64 3.5 65 4.5 66 2.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.65782200110559 82.0 2 8.264234383637369 14.95 3 0.9397457158651189 2.55 4 0.13819789939192925 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.38749999999999996 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 10 0.006830828 145.0 2 GTCCGAG 10 0.006830828 145.0 1 GTCCTCT 10 0.006830828 145.0 1 GTCCCAT 10 0.006830828 145.0 1 TCCGAGT 10 0.006830828 145.0 2 >>END_MODULE SRR12670988 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670988_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.405 37.0 37.0 37.0 37.0 37.0 2 36.2315 37.0 37.0 37.0 37.0 37.0 3 36.333 37.0 37.0 37.0 37.0 37.0 4 36.418 37.0 37.0 37.0 37.0 37.0 5 36.4985 37.0 37.0 37.0 37.0 37.0 6 36.3455 37.0 37.0 37.0 37.0 37.0 7 36.3155 37.0 37.0 37.0 37.0 37.0 8 36.4405 37.0 37.0 37.0 37.0 37.0 9 36.452 37.0 37.0 37.0 37.0 37.0 10-14 36.408300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4358 37.0 37.0 37.0 37.0 37.0 20-24 36.4062 37.0 37.0 37.0 37.0 37.0 25-29 36.331 37.0 37.0 37.0 37.0 37.0 30-34 36.3209 37.0 37.0 37.0 37.0 37.0 35-39 36.2596 37.0 37.0 37.0 37.0 37.0 40-44 36.2537 37.0 37.0 37.0 37.0 37.0 45-49 36.3031 37.0 37.0 37.0 37.0 37.0 50-54 36.218599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.239999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.228899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.248999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.21939999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1202 37.0 37.0 37.0 37.0 37.0 80-84 36.1552 37.0 37.0 37.0 37.0 37.0 85-89 36.0306 37.0 37.0 37.0 37.0 37.0 90-94 36.048 37.0 37.0 37.0 37.0 37.0 95-99 36.07809999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.07039999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9594 37.0 37.0 37.0 37.0 37.0 110-114 35.9735 37.0 37.0 37.0 37.0 37.0 115-119 35.8891 37.0 37.0 37.0 37.0 37.0 120-124 35.851800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.7554 37.0 37.0 37.0 37.0 37.0 130-134 35.831100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.800200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7672 37.0 37.0 37.0 37.0 37.0 145-149 35.5368 37.0 37.0 37.0 37.0 37.0 150-151 35.28574999999999 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 0.0 21 1.0 22 3.0 23 2.0 24 5.0 25 6.0 26 5.0 27 12.0 28 14.0 29 17.0 30 27.0 31 50.0 32 48.0 33 91.0 34 167.0 35 407.0 36 2663.0 37 479.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.525 23.150000000000002 10.2 35.125 2 24.0 25.4 36.6 14.000000000000002 3 18.075 28.575 33.1 20.25 4 22.6 32.95 24.25 20.200000000000003 5 24.85 37.1 21.6 16.45 6 18.175 40.150000000000006 23.0 18.675 7 20.75 21.05 37.55 20.65 8 18.25 26.1 31.574999999999996 24.075 9 22.05 23.474999999999998 31.5 22.975 10-14 22.86 29.03 26.775 21.335 15-19 22.63 28.084999999999997 28.17 21.115000000000002 20-24 22.185 28.49 28.125 21.2 25-29 21.355 28.37 28.395 21.88 30-34 22.375 28.555000000000003 28.225 20.845 35-39 21.990000000000002 28.57 27.334999999999997 22.105 40-44 22.81 27.915 27.62 21.654999999999998 45-49 22.665 28.005000000000003 27.935 21.395 50-54 22.245 28.38 27.779999999999998 21.595 55-59 22.74 27.950000000000003 27.939999999999998 21.37 60-64 22.66 27.155 28.155 22.03 65-69 22.875 28.275 27.145000000000003 21.705 70-74 22.365 27.665 27.800000000000004 22.17 75-79 23.145 27.375 27.944999999999997 21.535 80-84 22.35 27.625 28.000000000000004 22.025 85-89 22.82 27.875 27.63 21.675 90-94 22.95 27.689999999999998 27.22 22.14 95-99 23.0 27.834999999999997 27.644999999999996 21.52 100-104 23.335 27.85 27.435 21.38 105-109 22.98 27.855 27.905 21.26 110-114 23.080000000000002 27.860000000000003 27.555000000000003 21.505 115-119 23.51 28.515 27.3 20.674999999999997 120-124 23.775 28.485 27.425 20.315 125-129 23.419999999999998 28.53 26.590000000000003 21.46 130-134 23.405 27.944999999999997 27.68 20.97 135-139 23.225 27.52 27.97 21.285 140-144 23.31 27.634999999999998 28.005000000000003 21.05 145-149 23.945 27.744999999999997 27.91 20.4 150-151 24.425 28.8875 26.8 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 2.5 19 2.0 20 0.5 21 2.0 22 2.5 23 2.5 24 3.0 25 4.5 26 8.0 27 9.5 28 9.5 29 13.0 30 17.0 31 18.5 32 24.0 33 34.0 34 46.5 35 73.0 36 88.5 37 102.5 38 134.5 39 155.5 40 183.5 41 230.0 42 266.5 43 274.5 44 277.0 45 259.0 46 254.0 47 251.5 48 224.0 49 206.0 50 164.0 51 134.0 52 111.0 53 80.5 54 69.5 55 59.5 56 45.5 57 28.5 58 26.5 59 29.5 60 24.0 61 19.0 62 9.5 63 5.5 64 3.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42730299667036 81.475 2 8.407325194228635 15.15 3 0.9711431742508323 2.625 4 0.13873473917869034 0.5 5 0.05549389567147614 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.38749999999999996 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6375 0.0 0.0 0.0 0.0 132-133 1.8 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGCT 10 0.006830828 145.0 9 >>END_MODULE Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726213 spots for SRR12670988.sra Written 726213 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra Read 726206 spots for SRR12670988.sra Written 726206 spots for SRR12670988.sra SRR ids: ['SRR12670988.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_96viuiuq SRR12670988.sra spots: 14524127 blocks: [[1, 726206], [726207, 1452412], [1452413, 2178618], [2178619, 2904824], [2904825, 3631030], [3631031, 4357236], [4357237, 5083442], [5083443, 5809648], [5809649, 6535854], [6535855, 7262060], [7262061, 7988266], [7988267, 8714472], [8714473, 9440678], [9440679, 10166884], [10166885, 10893090], [10893091, 11619296], [11619297, 12345502], [12345503, 13071708], [13071709, 13797914], [13797915, 14524127]] SRR12670988 file size 4914233 SRR12670988 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670988 SRR12670988_1.fastq SRR12670988_2.fastq Input file: SRR12670988_1.fastq Paired file: SRR12670988_2.fastq trimmed: SRR12670988-trimmed-pair1.fastq, SRR12670988-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:34:28 2025 >> started Tue Feb 11 11:34:51 2025 >> done (23.596s) 14524127 read pairs processed; of these: 63 ( 0.00%) short read pairs filtered out after trimming by size control 310 ( 0.00%) empty read pairs filtered out after trimming by size control 14523754 (100.00%) read pairs available; of these: 560880 ( 3.86%) trimmed read pairs available after processing 13962874 (96.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 6 0.00% 24 4 0.00% 25 9 0.00% 26 4 0.00% 27 8 0.00% 28 7 0.00% 29 6 0.00% 30 6 0.00% 31 7 0.00% 32 7 0.00% 33 7 0.00% 34 4 0.00% 35 9 0.00% 36 5 0.00% 37 18 0.00% 38 11 0.00% 39 6 0.00% 40 3 0.00% 41 15 0.00% 42 9 0.00% 43 12 0.00% 44 11 0.00% 45 17 0.00% 46 14 0.00% 47 17 0.00% 48 33 0.00% 49 17 0.00% 50 16 0.00% 51 31 0.00% 52 20 0.00% 53 39 0.00% 54 38 0.00% 55 31 0.00% 56 46 0.00% 57 47 0.00% 58 52 0.00% 59 69 0.00% 60 68 0.00% 61 65 0.00% 62 74 0.00% 63 101 0.00% 64 84 0.00% 65 111 0.00% 66 117 0.00% 67 143 0.00% 68 154 0.00% 69 168 0.00% 70 196 0.00% 71 222 0.00% 72 280 0.00% 73 265 0.00% 74 317 0.00% 75 371 0.00% 76 426 0.00% 77 391 0.00% 78 489 0.00% 79 537 0.00% 80 600 0.00% 81 661 0.00% 82 733 0.01% 83 826 0.01% 84 904 0.01% 85 1006 0.01% 86 1120 0.01% 87 1149 0.01% 88 1402 0.01% 89 1446 0.01% 90 1535 0.01% 91 1723 0.01% 92 1793 0.01% 93 1959 0.01% 94 2099 0.01% 95 2322 0.02% 96 2518 0.02% 97 2686 0.02% 98 2854 0.02% 99 2981 0.02% 100 3169 0.02% 101 3348 0.02% 102 3477 0.02% 103 3694 0.03% 104 3892 0.03% 105 4082 0.03% 106 4235 0.03% 107 4472 0.03% 108 4870 0.03% 109 5001 0.03% 110 5147 0.04% 111 5483 0.04% 112 5658 0.04% 113 5761 0.04% 114 6150 0.04% 115 6281 0.04% 116 6866 0.05% 117 7120 0.05% 118 7413 0.05% 119 7631 0.05% 120 8004 0.06% 121 8176 0.06% 122 8504 0.06% 123 9118 0.06% 124 9232 0.06% 125 9425 0.06% 126 9981 0.07% 127 10410 0.07% 128 10735 0.07% 129 10740 0.07% 130 11106 0.08% 131 11395 0.08% 132 11989 0.08% 133 12299 0.08% 134 12570 0.09% 135 12817 0.09% 136 13536 0.09% 137 14029 0.10% 138 14396 0.10% 139 14928 0.10% 140 15535 0.11% 141 15844 0.11% 142 16454 0.11% 143 16915 0.12% 144 17163 0.12% 145 17508 0.12% 146 18208 0.13% 147 18681 0.13% 148 19360 0.13% 149 19783 0.14% 150 20717 0.14% 151 13962874 96.14% 14523754 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=29 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=13.83 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.5 sequence=CATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=28 prefix-density=0.52 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=21 fanout-score=16.97 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=7.7 sequence=AAGAAAGCTTACCCTAAC SRR12670988 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:35:38 Started mapping on | Feb 11 11:35:38 Finished on | Feb 11 11:37:18 Mapping speed, Million of reads per hour | 522.86 Number of input reads | 14523754 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13741241 Uniquely mapped reads % | 94.61% Average mapped length | 298.99 Number of splices: Total | 14195610 Number of splices: Annotated (sjdb) | 13920995 Number of splices: GT/AG | 13915144 Number of splices: GC/AG | 233534 Number of splices: AT/AC | 8311 Number of splices: Non-canonical | 38621 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332326 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 145090 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 450187 450187 450187 N_multimapping 332326 332326 332326 N_noFeature 553497 13530225 609804 N_ambiguous 247694 974 92438 UnstrandedReadsAssigned:12940050 PositiveStrandReadsAssigned:210042 NegativeStrandReadsAssigned:13038999 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670988 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670988-trimmed-pair1.fastq SRR12670988-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,523,754 reads, 13,024,285 reads pseudoaligned [quant] estimated average fragment length: 300.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR12670988.ke.tsv 34699 SRR12670988.se.tsv 87100 total ==> SRR12670988.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.66 531 20.055 Potri.005G024800.1.v4.1 1035 735.658 139 12.2647 Potri.004G059700.1.v4.1 961 661.99 5 0.490272 Potri.007G009000.2.v4.1 1416 1116.66 0 0 Potri.003G141000.2.v4.1 2943 2643.66 885 21.7298 Potri.016G087400.1.v4.1 270 68.0713 666 635.08 Potri.015G069301.1.v4.1 564 285.609 0 0 Potri.010G195200.1.v4.1 1773 1473.66 92 4.05237 Potri.012G127500.1.v4.1 977 677.839 106 10.1507 ==> SRR12670988.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 147 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12670988 completed mapping pipeline successfully