Starting /dee2/code/volunteer_pipeline.sh SRR12670990 current disk space = 3050913837056 free memory = 1513398692 SRR12670990 SRAfilesize 7945d19a8e4d4a791b0ba0e444142b83 SRR12670990.sra SRR12670990.sra file validated SRR12670990 is paired end SRR12670990 is conventional basespace SRR12670990 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.394 37.0 37.0 37.0 37.0 37.0 2 36.217 37.0 37.0 37.0 37.0 37.0 3 36.3525 37.0 37.0 37.0 37.0 37.0 4 36.4915 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.523 37.0 37.0 37.0 37.0 37.0 7 36.417 37.0 37.0 37.0 37.0 37.0 8 36.502 37.0 37.0 37.0 37.0 37.0 9 36.5695 37.0 37.0 37.0 37.0 37.0 10-14 36.549699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5105 37.0 37.0 37.0 37.0 37.0 20-24 36.4077 37.0 37.0 37.0 37.0 37.0 25-29 36.3594 37.0 37.0 37.0 37.0 37.0 30-34 36.2053 37.0 37.0 37.0 37.0 37.0 35-39 36.1864 37.0 37.0 37.0 37.0 37.0 40-44 36.11900000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.0361 37.0 37.0 37.0 37.0 37.0 50-54 35.940599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9452 37.0 37.0 37.0 37.0 37.0 60-64 35.933 37.0 37.0 37.0 37.0 37.0 65-69 35.92550000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.929 37.0 37.0 37.0 37.0 37.0 75-79 35.889100000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.849599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.7921 37.0 37.0 37.0 37.0 37.0 90-94 35.7675 37.0 37.0 37.0 37.0 37.0 95-99 35.7043 37.0 37.0 37.0 37.0 37.0 100-104 35.7003 37.0 37.0 37.0 37.0 37.0 105-109 35.678700000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.64549999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6207 37.0 37.0 37.0 37.0 37.0 120-124 35.540099999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5801 37.0 37.0 37.0 37.0 37.0 130-134 35.3855 37.0 37.0 37.0 37.0 37.0 135-139 35.3809 37.0 37.0 37.0 37.0 37.0 140-144 35.304899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.136 37.0 37.0 37.0 32.2 37.0 150-151 34.9405 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 5.0 19 3.0 20 6.0 21 13.0 22 11.0 23 10.0 24 16.0 25 23.0 26 11.0 27 14.0 28 27.0 29 28.0 30 30.0 31 62.0 32 61.0 33 77.0 34 127.0 35 281.0 36 2602.0 37 593.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 61.45 11.600000000000001 7.1499999999999995 19.8 2 21.375 10.05 37.375 31.2 3 15.625 23.65 35.375 25.35 4 21.025 24.675 31.3 23.0 5 21.65 34.55 26.3 17.5 6 18.325 34.55 26.025 21.099999999999998 7 14.05 26.700000000000003 44.574999999999996 14.674999999999999 8 13.625000000000002 22.8 37.15 26.424999999999997 9 16.55 21.725 35.925000000000004 25.8 10-14 20.085 27.72 29.56 22.634999999999998 15-19 19.189999999999998 27.284999999999997 29.93 23.595 20-24 19.28 27.685 29.335 23.7 25-29 19.915 27.755000000000003 29.044999999999998 23.285 30-34 19.665 28.685 28.38 23.27 35-39 19.67 28.389999999999997 28.139999999999997 23.799999999999997 40-44 19.175 28.42 28.455000000000002 23.95 45-49 19.96 28.860000000000003 28.405 22.775000000000002 50-54 19.950000000000003 28.095 28.46 23.494999999999997 55-59 19.875 28.560000000000002 27.875 23.69 60-64 19.900000000000002 28.244999999999997 28.765 23.09 65-69 19.865 28.910000000000004 27.725 23.5 70-74 20.74 28.825 27.32 23.115 75-79 20.26 28.79 27.634999999999998 23.315 80-84 20.29 28.494999999999997 27.250000000000004 23.965 85-89 20.355 28.08 27.05 24.515 90-94 20.380000000000003 28.865000000000002 27.810000000000002 22.945 95-99 20.349999999999998 28.685 27.295 23.669999999999998 100-104 20.175 29.585 27.0 23.24 105-109 20.745 29.085 27.1 23.07 110-114 20.36 29.054999999999996 27.529999999999998 23.055 115-119 20.705000000000002 28.299999999999997 27.48 23.515 120-124 20.87 28.389999999999997 27.689999999999998 23.05 125-129 20.62 28.799999999999997 27.195000000000004 23.385 130-134 20.575 28.73 27.41 23.285 135-139 21.099999999999998 28.865000000000002 27.224999999999998 22.81 140-144 21.205 27.950000000000003 27.92 22.925 145-149 20.615 28.835 27.389999999999997 23.16 150-151 21.475 28.775000000000002 26.525 23.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 5.5 2 3.0 3 2.0 4 2.5 5 4.0 6 3.0 7 3.0 8 4.0 9 2.5 10 4.0 11 4.0 12 3.0 13 4.0 14 3.0 15 2.0 16 3.5 17 5.0 18 5.5 19 4.5 20 3.5 21 4.0 22 7.5 23 8.0 24 4.0 25 5.5 26 8.0 27 15.0 28 19.0 29 19.5 30 27.5 31 33.0 32 31.5 33 40.5 34 53.0 35 61.5 36 75.0 37 101.0 38 127.0 39 143.0 40 166.5 41 193.5 42 218.0 43 226.5 44 239.0 45 258.5 46 253.0 47 243.0 48 233.5 49 226.5 50 190.5 51 136.5 52 125.5 53 102.0 54 67.5 55 62.5 56 55.0 57 38.5 58 29.0 59 21.5 60 15.0 61 10.0 62 6.0 63 7.5 64 7.0 65 3.0 66 0.5 67 1.5 68 1.5 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.30794701986756 82.72500000000001 2 7.836644591611479 14.2 3 0.6622516556291391 1.7999999999999998 4 0.05518763796909492 0.2 5 0.05518763796909492 0.25 6 0.0 0.0 7 0.02759381898454746 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05518763796909492 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 15 0.375 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 11 0.27499999999999997 No Hit GTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCT 7 0.17500000000000002 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.7625000000000002 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5875000000000004 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670990 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670990_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.886 37.0 37.0 37.0 37.0 37.0 2 35.96 37.0 37.0 37.0 37.0 37.0 3 36.069 37.0 37.0 37.0 37.0 37.0 4 35.9975 37.0 37.0 37.0 37.0 37.0 5 36.1105 37.0 37.0 37.0 37.0 37.0 6 36.056 37.0 37.0 37.0 37.0 37.0 7 36.024 37.0 37.0 37.0 37.0 37.0 8 36.013 37.0 37.0 37.0 37.0 37.0 9 35.9805 37.0 37.0 37.0 37.0 37.0 10-14 35.9485 37.0 37.0 37.0 37.0 37.0 15-19 35.800200000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.7521 37.0 37.0 37.0 37.0 37.0 25-29 35.6789 37.0 37.0 37.0 37.0 37.0 30-34 35.64139999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.5543 37.0 37.0 37.0 37.0 37.0 40-44 35.5188 37.0 37.0 37.0 37.0 37.0 45-49 35.5723 37.0 37.0 37.0 37.0 37.0 50-54 35.4976 37.0 37.0 37.0 37.0 37.0 55-59 35.4862 37.0 37.0 37.0 37.0 37.0 60-64 35.4858 37.0 37.0 37.0 37.0 37.0 65-69 35.4916 37.0 37.0 37.0 37.0 37.0 70-74 35.382000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.40140000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.426300000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.321299999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.3834 37.0 37.0 37.0 37.0 37.0 95-99 35.281400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.3201 37.0 37.0 37.0 37.0 37.0 105-109 35.189299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.2387 37.0 37.0 37.0 37.0 37.0 115-119 35.1958 37.0 37.0 37.0 37.0 37.0 120-124 35.1045 37.0 37.0 37.0 32.2 37.0 125-129 35.049099999999996 37.0 37.0 37.0 29.8 37.0 130-134 35.0783 37.0 37.0 37.0 27.4 37.0 135-139 35.035799999999995 37.0 37.0 37.0 27.4 37.0 140-144 34.9773 37.0 37.0 37.0 27.4 37.0 145-149 34.778200000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.551500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 8.0 13 19.0 14 12.0 15 16.0 16 10.0 17 9.0 18 7.0 19 4.0 20 7.0 21 11.0 22 8.0 23 22.0 24 14.0 25 10.0 26 14.0 27 18.0 28 23.0 29 25.0 30 28.0 31 46.0 32 65.0 33 93.0 34 179.0 35 348.0 36 2525.0 37 479.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 68.27499999999999 14.224999999999998 4.8 12.7 2 30.875000000000004 14.499999999999998 31.65 22.975 3 22.875 23.9 37.574999999999996 15.65 4 26.6 31.125000000000004 22.650000000000002 19.625 5 26.1 37.375 19.975 16.55 6 22.1 38.0 20.9 19.0 7 23.825 22.675 36.175000000000004 17.325 8 20.025000000000002 24.525 29.25 26.200000000000003 9 24.75 21.95 28.625 24.675 10-14 25.11 27.72 26.445 20.724999999999998 15-19 24.765 27.615000000000002 27.650000000000002 19.97 20-24 24.435000000000002 28.465 26.955000000000002 20.145 25-29 24.065 28.225 28.01 19.7 30-34 24.01 27.62 28.22 20.150000000000002 35-39 23.715 27.905 27.935 20.445 40-44 23.830000000000002 28.07 27.32 20.78 45-49 23.41 28.904999999999998 26.979999999999997 20.705000000000002 50-54 23.485 27.834999999999997 27.76 20.919999999999998 55-59 23.74 28.199999999999996 27.57 20.49 60-64 23.830000000000002 28.315 27.310000000000002 20.544999999999998 65-69 23.29 27.560000000000002 28.01 21.14 70-74 22.61 28.32 27.425 21.645 75-79 23.785 28.665000000000003 27.025 20.525 80-84 23.745 28.57 26.69 20.995 85-89 24.145 28.715000000000003 26.32 20.82 90-94 23.595 28.51 26.915 20.979999999999997 95-99 23.93 28.139999999999997 27.32 20.61 100-104 23.59 28.255000000000003 27.295 20.86 105-109 24.315 27.91 27.765 20.01 110-114 23.735 29.494999999999997 26.279999999999998 20.49 115-119 23.77 28.375 27.365000000000002 20.49 120-124 24.235 28.685 26.919999999999998 20.16 125-129 24.04 29.29 26.575 20.095 130-134 24.645 28.505000000000003 26.83 20.02 135-139 24.85 28.610000000000003 26.26 20.28 140-144 24.025 29.2 26.865 19.91 145-149 24.955 29.015 25.965 20.064999999999998 150-151 25.637500000000003 29.049999999999997 25.337500000000002 19.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 1.5 6 2.0 7 1.5 8 1.5 9 2.0 10 2.5 11 1.5 12 1.0 13 2.0 14 2.0 15 1.5 16 2.5 17 3.5 18 3.0 19 3.5 20 3.5 21 4.0 22 4.0 23 3.5 24 5.0 25 5.5 26 8.0 27 11.0 28 11.0 29 15.5 30 17.5 31 18.0 32 21.0 33 36.5 34 53.0 35 59.5 36 78.0 37 100.0 38 120.5 39 152.0 40 190.5 41 204.0 42 212.5 43 231.5 44 253.0 45 254.5 46 263.5 47 258.0 48 220.0 49 196.0 50 160.0 51 130.5 52 114.0 53 106.0 54 90.5 55 71.5 56 66.5 57 46.0 58 24.0 59 21.0 60 16.5 61 14.0 62 12.0 63 6.5 64 3.5 65 3.5 66 3.0 67 1.5 68 2.0 69 1.5 70 1.0 71 1.5 72 1.5 73 0.5 74 0.5 75 1.5 76 1.5 77 1.5 78 1.0 79 0.5 80 0.5 81 1.0 82 1.5 83 1.0 84 1.0 85 0.5 86 1.0 87 1.5 88 1.0 89 1.5 90 2.0 91 2.5 92 2.0 93 1.5 94 1.5 95 1.5 96 1.0 97 0.0 98 0.0 99 0.5 100 14.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27404516308893 81.85 2 7.499303038751045 13.450000000000001 3 0.8084750487872874 2.175 4 0.2230275996654586 0.8 5 0.1393922497909116 0.625 6 0.0 0.0 7 0.027878449958182325 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027878449958182325 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 37 0.9249999999999999 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit GAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 5 0.125 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit GCTAGCTAGAAGTGACTCTACCCTTTGCATTACTTTTTCAATCAATCACT 5 0.125 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit GCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAAGC 10 0.006830828 145.0 2 >>END_MODULE Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra Read 664306 spots for SRR12670990.sra Written 664306 spots for SRR12670990.sra SRR ids: ['SRR12670990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nylwdsg5 SRR12670990.sra spots: 13286120 blocks: [[1, 664306], [664307, 1328612], [1328613, 1992918], [1992919, 2657224], [2657225, 3321530], [3321531, 3985836], [3985837, 4650142], [4650143, 5314448], [5314449, 5978754], [5978755, 6643060], [6643061, 7307366], [7307367, 7971672], [7971673, 8635978], [8635979, 9300284], [9300285, 9964590], [9964591, 10628896], [10628897, 11293202], [11293203, 11957508], [11957509, 12621814], [12621815, 13286120]] SRR12670990 file size 4493504 SRR12670990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670990 SRR12670990_1.fastq SRR12670990_2.fastq Input file: SRR12670990_1.fastq Paired file: SRR12670990_2.fastq trimmed: SRR12670990-trimmed-pair1.fastq, SRR12670990-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:18:21 2025 >> started Tue Feb 11 12:18:40 2025 >> done (19.091s) 13286120 read pairs processed; of these: 525 ( 0.00%) short read pairs filtered out after trimming by size control 10133 ( 0.08%) empty read pairs filtered out after trimming by size control 13275462 (99.92%) read pairs available; of these: 817739 ( 6.16%) trimmed read pairs available after processing 12457723 (93.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 56 0.00% 19 46 0.00% 20 56 0.00% 21 55 0.00% 22 67 0.00% 23 76 0.00% 24 94 0.00% 25 77 0.00% 26 99 0.00% 27 82 0.00% 28 118 0.00% 29 80 0.00% 30 72 0.00% 31 79 0.00% 32 55 0.00% 33 56 0.00% 34 86 0.00% 35 51 0.00% 36 43 0.00% 37 71 0.00% 38 60 0.00% 39 86 0.00% 40 57 0.00% 41 67 0.00% 42 62 0.00% 43 65 0.00% 44 62 0.00% 45 49 0.00% 46 60 0.00% 47 89 0.00% 48 77 0.00% 49 98 0.00% 50 88 0.00% 51 123 0.00% 52 104 0.00% 53 129 0.00% 54 126 0.00% 55 147 0.00% 56 138 0.00% 57 143 0.00% 58 209 0.00% 59 210 0.00% 60 241 0.00% 61 297 0.00% 62 306 0.00% 63 369 0.00% 64 357 0.00% 65 389 0.00% 66 409 0.00% 67 455 0.00% 68 577 0.00% 69 661 0.00% 70 708 0.01% 71 817 0.01% 72 914 0.01% 73 1040 0.01% 74 1140 0.01% 75 1202 0.01% 76 1139 0.01% 77 1345 0.01% 78 1471 0.01% 79 1649 0.01% 80 1716 0.01% 81 1926 0.01% 82 2190 0.02% 83 2322 0.02% 84 2532 0.02% 85 2544 0.02% 86 2736 0.02% 87 2840 0.02% 88 2956 0.02% 89 3173 0.02% 90 3425 0.03% 91 3617 0.03% 92 3732 0.03% 93 4398 0.03% 94 4331 0.03% 95 4667 0.04% 96 4895 0.04% 97 4852 0.04% 98 4982 0.04% 99 5233 0.04% 100 5587 0.04% 101 6057 0.05% 102 6329 0.05% 103 6533 0.05% 104 6841 0.05% 105 7018 0.05% 106 6878 0.05% 107 7172 0.05% 108 7477 0.06% 109 7636 0.06% 110 7883 0.06% 111 8504 0.06% 112 8867 0.07% 113 9374 0.07% 114 9844 0.07% 115 9893 0.07% 116 10131 0.08% 117 10581 0.08% 118 10733 0.08% 119 10868 0.08% 120 11493 0.09% 121 11776 0.09% 122 12426 0.09% 123 13260 0.10% 124 14081 0.11% 125 14150 0.11% 126 15003 0.11% 127 14759 0.11% 128 14750 0.11% 129 15315 0.12% 130 15240 0.11% 131 15784 0.12% 132 16466 0.12% 133 17241 0.13% 134 17880 0.13% 135 18767 0.14% 136 18625 0.14% 137 18765 0.14% 138 19135 0.14% 139 19459 0.15% 140 19644 0.15% 141 20432 0.15% 142 20643 0.16% 143 21820 0.16% 144 22830 0.17% 145 23791 0.18% 146 23850 0.18% 147 23797 0.18% 148 24049 0.18% 149 24267 0.18% 150 25814 0.19% 151 12457723 93.84% 13275462 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.74 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.16 sequence-density-rank=15 fanout-score=8.47 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.9 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=22 prefix-density=0.87 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=29.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATG SRR12670990 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:19:27 Started mapping on | Feb 11 12:19:27 Finished on | Feb 11 12:21:40 Mapping speed, Million of reads per hour | 359.34 Number of input reads | 13275462 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11487079 Uniquely mapped reads % | 86.53% Average mapped length | 296.60 Number of splices: Total | 11506264 Number of splices: Annotated (sjdb) | 11276010 Number of splices: GT/AG | 11266819 Number of splices: GC/AG | 198186 Number of splices: AT/AC | 6975 Number of splices: Non-canonical | 34284 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279567 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 54307 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.36% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1508816 1508816 1508816 N_multimapping 279567 279567 279567 N_noFeature 423926 11289829 482374 N_ambiguous 208572 830 69245 UnstrandedReadsAssigned:10854581 PositiveStrandReadsAssigned:196420 NegativeStrandReadsAssigned:10935460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670990 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670990-trimmed-pair1.fastq SRR12670990-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,275,462 reads, 11,183,745 reads pseudoaligned [quant] estimated average fragment length: 283.373 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR12670990.ke.tsv 34699 SRR12670990.se.tsv 87100 total ==> SRR12670990.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.63 542 25.4924 Potri.005G024800.1.v4.1 1035 752.627 284 30.804 Potri.004G059700.1.v4.1 961 678.993 0 0 Potri.007G009000.2.v4.1 1416 1133.63 0 0 Potri.003G141000.2.v4.1 2943 2660.63 605.449 18.5764 Potri.016G087400.1.v4.1 270 77.4918 436.62 459.956 Potri.015G069301.1.v4.1 564 302.6 0 0 Potri.010G195200.1.v4.1 1773 1490.63 53 2.90252 Potri.012G127500.1.v4.1 977 694.845 28 3.28956 ==> SRR12670990.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 73 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12670990 completed mapping pipeline successfully