Starting /dee2/code/volunteer_pipeline.sh SRR12670991 current disk space = 3051200888832 free memory = 1489658628 SRR12670991 SRAfilesize d14c9b5ef793451a4acd004e641b517a SRR12670991.sra SRR12670991.sra file validated SRR12670991 is paired end SRR12670991 is conventional basespace SRR12670991 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.40225 37.0 37.0 37.0 37.0 37.0 2 36.4165 37.0 37.0 37.0 37.0 37.0 3 36.494 37.0 37.0 37.0 37.0 37.0 4 36.466 37.0 37.0 37.0 37.0 37.0 5 36.6695 37.0 37.0 37.0 37.0 37.0 6 36.592 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.553 37.0 37.0 37.0 37.0 37.0 10-14 36.5761 37.0 37.0 37.0 37.0 37.0 15-19 36.5466 37.0 37.0 37.0 37.0 37.0 20-24 36.5343 37.0 37.0 37.0 37.0 37.0 25-29 36.4858 37.0 37.0 37.0 37.0 37.0 30-34 36.44350000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.476 37.0 37.0 37.0 37.0 37.0 40-44 36.423700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3448 37.0 37.0 37.0 37.0 37.0 50-54 36.3346 37.0 37.0 37.0 37.0 37.0 55-59 36.3157 37.0 37.0 37.0 37.0 37.0 60-64 36.3241 37.0 37.0 37.0 37.0 37.0 65-69 36.2605 37.0 37.0 37.0 37.0 37.0 70-74 36.23650000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2167 37.0 37.0 37.0 37.0 37.0 80-84 36.126000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.192899999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.166000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1311 37.0 37.0 37.0 37.0 37.0 100-104 36.0886 37.0 37.0 37.0 37.0 37.0 105-109 36.062799999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.062799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.05195 37.0 37.0 37.0 37.0 37.0 120-124 35.93900000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9116 37.0 37.0 37.0 37.0 37.0 130-134 35.8352 37.0 37.0 37.0 37.0 37.0 135-139 35.8262 37.0 37.0 37.0 37.0 37.0 140-144 35.815 37.0 37.0 37.0 37.0 37.0 145-149 35.6448 37.0 37.0 37.0 37.0 37.0 150-151 35.393 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 2.0 24 4.0 25 6.0 26 3.0 27 17.0 28 20.0 29 23.0 30 31.0 31 51.0 32 49.0 33 73.0 34 123.0 35 267.0 36 2724.0 37 603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.635408852213054 11.0527631907977 6.501625406351589 40.81020255063766 2 19.025 10.975 38.475 31.525 3 16.325 14.75 27.375 41.55 4 22.15 21.85 25.3 30.7 5 24.7 29.375 23.825 22.1 6 19.775000000000002 32.625 25.224999999999998 22.375 7 14.799999999999999 28.449999999999996 39.95 16.8 8 15.8 26.75 33.324999999999996 24.125 9 16.25 23.875 36.275 23.599999999999998 10-14 19.54 29.64 28.405 22.415 15-19 19.975 27.18 28.884999999999998 23.96 20-24 19.915 28.305000000000003 28.125 23.655 25-29 19.505 28.18 28.255000000000003 24.060000000000002 30-34 19.725 28.32 28.139999999999997 23.815 35-39 20.26 27.944999999999997 27.935 23.86 40-44 20.369999999999997 28.34 27.58 23.71 45-49 20.285 28.310000000000002 28.13 23.275000000000002 50-54 19.675 28.825 27.755000000000003 23.745 55-59 19.650000000000002 28.325 27.955000000000002 24.07 60-64 19.939999999999998 28.525 27.944999999999997 23.59 65-69 20.09 28.92 27.875 23.115 70-74 20.880000000000003 28.455000000000002 26.889999999999997 23.775 75-79 19.869999999999997 28.16 27.944999999999997 24.025 80-84 20.265 28.43 27.560000000000002 23.745 85-89 20.07 28.410000000000004 27.655 23.865 90-94 20.255000000000003 27.85 27.22 24.675 95-99 20.43 28.005000000000003 27.884999999999998 23.68 100-104 20.135 28.535 27.575 23.755000000000003 105-109 20.225 28.475 27.575 23.724999999999998 110-114 20.505000000000003 28.34 27.83 23.325000000000003 115-119 21.086054302715134 28.651432571628582 27.40137006850343 22.86114305715286 120-124 20.525 29.104999999999997 27.315 23.055 125-129 21.015 28.005000000000003 27.43 23.549999999999997 130-134 20.605 27.96 27.72 23.715 135-139 20.29 28.000000000000004 27.950000000000003 23.76 140-144 20.945 27.71 27.96 23.385 145-149 21.34713471347135 28.152815281528156 26.762676267626762 23.737373737373737 150-151 20.7375 28.15 27.075 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.5 3 2.0 4 1.5 5 1.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 4.5 26 6.5 27 8.0 28 9.5 29 12.0 30 19.5 31 25.5 32 28.0 33 50.5 34 69.5 35 73.5 36 92.5 37 101.0 38 132.0 39 165.0 40 172.0 41 187.5 42 219.5 43 241.5 44 254.5 45 267.5 46 260.5 47 249.0 48 234.5 49 220.5 50 182.0 51 125.0 52 99.0 53 89.5 54 83.0 55 76.5 56 57.0 57 42.0 58 37.0 59 26.0 60 15.5 61 14.0 62 8.5 63 5.0 64 3.5 65 3.5 66 4.0 67 2.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.01112966054535 80.875 2 8.87590428491931 15.950000000000001 3 1.001669449081803 2.7 4 0.08347245409015025 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02782415136338342 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCACAAATTGTTGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATGA 10 0.006830828 145.0 145 >>END_MODULE SRR12670991 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670991_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.191 37.0 37.0 37.0 37.0 37.0 2 36.0865 37.0 37.0 37.0 37.0 37.0 3 36.2325 37.0 37.0 37.0 37.0 37.0 4 36.3145 37.0 37.0 37.0 37.0 37.0 5 36.3175 37.0 37.0 37.0 37.0 37.0 6 36.321 37.0 37.0 37.0 37.0 37.0 7 36.306 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.407 37.0 37.0 37.0 37.0 37.0 10-14 36.3541 37.0 37.0 37.0 37.0 37.0 15-19 36.3217 37.0 37.0 37.0 37.0 37.0 20-24 36.3223 37.0 37.0 37.0 37.0 37.0 25-29 36.2736 37.0 37.0 37.0 37.0 37.0 30-34 36.2801 37.0 37.0 37.0 37.0 37.0 35-39 36.2238 37.0 37.0 37.0 37.0 37.0 40-44 36.2151 37.0 37.0 37.0 37.0 37.0 45-49 36.1225 37.0 37.0 37.0 37.0 37.0 50-54 36.125299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.156000000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.14489999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1527 37.0 37.0 37.0 37.0 37.0 70-74 36.1578 37.0 37.0 37.0 37.0 37.0 75-79 36.0705 37.0 37.0 37.0 37.0 37.0 80-84 36.015 37.0 37.0 37.0 37.0 37.0 85-89 35.94005 37.0 37.0 37.0 37.0 37.0 90-94 36.005 37.0 37.0 37.0 37.0 37.0 95-99 35.981 37.0 37.0 37.0 37.0 37.0 100-104 35.9827 37.0 37.0 37.0 37.0 37.0 105-109 35.860699999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.900800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.849650000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.743900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6973 37.0 37.0 37.0 37.0 37.0 130-134 35.6969 37.0 37.0 37.0 37.0 37.0 135-139 35.6827 37.0 37.0 37.0 37.0 37.0 140-144 35.67165 37.0 37.0 37.0 37.0 37.0 145-149 35.436699999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.19775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 3.0 22 5.0 23 5.0 24 6.0 25 7.0 26 9.0 27 11.0 28 13.0 29 28.0 30 18.0 31 46.0 32 64.0 33 88.0 34 188.0 35 422.0 36 2598.0 37 484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.925000000000004 22.925 11.625 29.525000000000002 2 26.025 26.924999999999997 31.95 15.1 3 20.9 26.825 32.025 20.25 4 24.875 33.675 22.8 18.65 5 24.325 37.05 21.825 16.8 6 20.1 39.324999999999996 22.575 18.0 7 19.950000000000003 20.575 40.65 18.825 8 19.775000000000002 26.575 29.825000000000003 23.825 9 22.825 23.925 29.875 23.375 10-14 22.634999999999998 29.62 26.400000000000002 21.345 15-19 22.685 28.494999999999997 27.589999999999996 21.23 20-24 23.125 28.09 27.900000000000002 20.885 25-29 23.36 28.26 27.61 20.77 30-34 22.8 28.485 28.044999999999998 20.669999999999998 35-39 23.265 28.084999999999997 27.54 21.11 40-44 22.830000000000002 28.249999999999996 27.91 21.01 45-49 23.02 28.470000000000002 27.6 20.91 50-54 22.884999999999998 28.23 28.205000000000002 20.68 55-59 22.875 27.96 27.51 21.654999999999998 60-64 23.39 27.839999999999996 28.075 20.695 65-69 23.169999999999998 28.29 27.515 21.025 70-74 23.294999999999998 27.544999999999998 27.725 21.435000000000002 75-79 23.49 28.189999999999998 27.250000000000004 21.07 80-84 24.115000000000002 28.42 26.924999999999997 20.54 85-89 23.801190059502975 28.241412070603527 27.29136456822841 20.66603330166508 90-94 23.06 27.66 27.750000000000004 21.529999999999998 95-99 23.51 27.810000000000002 27.779999999999998 20.9 100-104 23.365 28.384999999999998 27.38 20.87 105-109 23.39 27.715 28.110000000000003 20.785 110-114 23.885 28.395 27.389999999999997 20.330000000000002 115-119 23.741187059352967 28.07140357017851 27.791389569478476 20.39601980099005 120-124 24.085 27.82 27.955000000000002 20.14 125-129 24.12 27.694999999999997 27.245 20.94 130-134 24.42 27.839999999999996 26.705000000000002 21.035 135-139 24.37 27.400000000000002 27.685 20.544999999999998 140-144 23.85619280964048 27.281364068203413 28.07640382019101 20.786039301965097 145-149 24.67 28.28 26.865 20.185 150-151 24.05 28.1875 27.575 20.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.5 22 3.5 23 3.5 24 2.0 25 4.5 26 4.5 27 6.5 28 11.0 29 13.5 30 17.0 31 25.5 32 36.0 33 42.5 34 63.0 35 72.0 36 73.0 37 99.5 38 133.0 39 164.0 40 191.0 41 217.5 42 247.0 43 255.5 44 252.5 45 272.0 46 281.5 47 243.5 48 217.0 49 192.0 50 157.5 51 139.5 52 115.5 53 89.5 54 69.5 55 62.5 56 49.5 57 35.0 58 32.0 59 28.0 60 20.0 61 13.5 62 9.5 63 7.5 64 4.0 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.44035674470457 81.125 2 8.193979933110368 14.7 3 1.0869565217391304 2.9250000000000003 4 0.16722408026755853 0.6 5 0.055741360089186176 0.25 6 0.0 0.0 7 0.027870680044593088 0.17500000000000002 8 0.0 0.0 9 0.027870680044593088 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GCTAAGCGCACAAATTAAGGCTTAAAGATATAGAGAGAAAGAAACAACAT 7 0.17500000000000002 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5750000000000002 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCTTC 10 0.006830828 145.0 2 >>END_MODULE Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra Read 657799 spots for SRR12670991.sra Written 657799 spots for SRR12670991.sra Read 657787 spots for SRR12670991.sra Written 657787 spots for SRR12670991.sra SRR ids: ['SRR12670991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jrpi1u_5 SRR12670991.sra spots: 13155752 blocks: [[1, 657787], [657788, 1315574], [1315575, 1973361], [1973362, 2631148], [2631149, 3288935], [3288936, 3946722], [3946723, 4604509], [4604510, 5262296], [5262297, 5920083], [5920084, 6577870], [6577871, 7235657], [7235658, 7893444], [7893445, 8551231], [8551232, 9209018], [9209019, 9866805], [9866806, 10524592], [10524593, 11182379], [11182380, 11840166], [11840167, 12497953], [12497954, 13155752]] SRR12670991 file size 4449199 SRR12670991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670991 SRR12670991_1.fastq SRR12670991_2.fastq Input file: SRR12670991_1.fastq Paired file: SRR12670991_2.fastq trimmed: SRR12670991-trimmed-pair1.fastq, SRR12670991-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:04:50 2025 >> started Tue Feb 11 12:05:05 2025 >> done (14.691s) 13155752 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 1590 ( 0.01%) empty read pairs filtered out after trimming by size control 13154123 (99.99%) read pairs available; of these: 553017 ( 4.20%) trimmed read pairs available after processing 12601106 (95.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 6 0.00% 24 9 0.00% 25 9 0.00% 26 3 0.00% 27 7 0.00% 28 2 0.00% 29 12 0.00% 30 7 0.00% 31 11 0.00% 32 9 0.00% 33 12 0.00% 34 12 0.00% 35 14 0.00% 36 5 0.00% 37 10 0.00% 38 16 0.00% 39 5 0.00% 40 15 0.00% 41 11 0.00% 42 11 0.00% 43 16 0.00% 44 14 0.00% 45 11 0.00% 46 20 0.00% 47 21 0.00% 48 19 0.00% 49 23 0.00% 50 23 0.00% 51 20 0.00% 52 23 0.00% 53 31 0.00% 54 31 0.00% 55 31 0.00% 56 32 0.00% 57 42 0.00% 58 41 0.00% 59 64 0.00% 60 54 0.00% 61 67 0.00% 62 73 0.00% 63 78 0.00% 64 109 0.00% 65 121 0.00% 66 123 0.00% 67 126 0.00% 68 150 0.00% 69 158 0.00% 70 187 0.00% 71 215 0.00% 72 241 0.00% 73 293 0.00% 74 331 0.00% 75 344 0.00% 76 404 0.00% 77 402 0.00% 78 476 0.00% 79 538 0.00% 80 582 0.00% 81 723 0.01% 82 796 0.01% 83 901 0.01% 84 959 0.01% 85 1086 0.01% 86 1129 0.01% 87 1226 0.01% 88 1282 0.01% 89 1385 0.01% 90 1536 0.01% 91 1668 0.01% 92 1778 0.01% 93 1922 0.01% 94 2091 0.02% 95 2327 0.02% 96 2452 0.02% 97 2699 0.02% 98 2811 0.02% 99 3038 0.02% 100 3122 0.02% 101 3227 0.02% 102 3297 0.03% 103 3679 0.03% 104 3717 0.03% 105 4027 0.03% 106 4131 0.03% 107 4560 0.03% 108 4755 0.04% 109 4847 0.04% 110 4939 0.04% 111 5195 0.04% 112 5519 0.04% 113 5701 0.04% 114 6112 0.05% 115 6271 0.05% 116 6601 0.05% 117 6797 0.05% 118 7386 0.06% 119 7416 0.06% 120 7958 0.06% 121 7966 0.06% 122 8356 0.06% 123 8809 0.07% 124 9248 0.07% 125 9152 0.07% 126 10026 0.08% 127 10227 0.08% 128 10614 0.08% 129 10979 0.08% 130 11155 0.08% 131 11147 0.08% 132 11654 0.09% 133 12113 0.09% 134 12253 0.09% 135 12826 0.10% 136 13201 0.10% 137 13594 0.10% 138 13974 0.11% 139 14919 0.11% 140 15296 0.12% 141 15494 0.12% 142 16085 0.12% 143 16386 0.12% 144 17255 0.13% 145 17076 0.13% 146 17932 0.14% 147 18542 0.14% 148 19405 0.15% 149 19860 0.15% 150 20669 0.16% 151 12601106 95.80% 13154123 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=16 prefix-density=0.38 prefix-fanout=2.9 sequence=ACGCTTGTAAGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=515.89 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=24 prefix-density=1.37 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=28.41 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=GGCTATAAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCTATCCACTTGCACTGCTCGAGAATTGGCCGAGCGAG SRR12670991 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:05:49 Started mapping on | Feb 11 12:05:49 Finished on | Feb 11 12:07:31 Mapping speed, Million of reads per hour | 464.26 Number of input reads | 13154123 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12115328 Uniquely mapped reads % | 92.10% Average mapped length | 298.69 Number of splices: Total | 12076082 Number of splices: Annotated (sjdb) | 11785323 Number of splices: GT/AG | 11841862 Number of splices: GC/AG | 182979 Number of splices: AT/AC | 8315 Number of splices: Non-canonical | 42926 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398474 % of reads mapped to multiple loci | 3.03% Number of reads mapped to too many loci | 226288 % of reads mapped to too many loci | 1.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640321 640321 640321 N_multimapping 398474 398474 398474 N_noFeature 620947 11858952 680197 N_ambiguous 300117 1068 102380 UnstrandedReadsAssigned:11194264 PositiveStrandReadsAssigned:255308 NegativeStrandReadsAssigned:11332751 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670991 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670991-trimmed-pair1.fastq SRR12670991-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,154,123 reads, 11,401,103 reads pseudoaligned [quant] estimated average fragment length: 290.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR12670991.ke.tsv 34699 SRR12670991.se.tsv 87100 total ==> SRR12670991.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.02 657 23.5123 Potri.005G024800.1.v4.1 1035 745.017 220 18.2614 Potri.004G059700.1.v4.1 961 671.222 1 0.0921321 Potri.007G009000.2.v4.1 1416 1126.02 0 0 Potri.003G141000.2.v4.1 2943 2653.02 727.533 16.9586 Potri.016G087400.1.v4.1 270 68.8965 540 484.701 Potri.015G069301.1.v4.1 564 291.597 0 0 Potri.010G195200.1.v4.1 1773 1483.02 143 5.96303 Potri.012G127500.1.v4.1 977 687.124 80 7.19999 ==> SRR12670991.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 169 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 137 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670991 completed mapping pipeline successfully