Starting /dee2/code/volunteer_pipeline.sh SRR12670992 current disk space = 3051193909248 free memory = 1117918064 SRR12670992 SRAfilesize 93cc1999a94386232b8747c22f93a355 SRR12670992.sra SRR12670992.sra file validated SRR12670992 is paired end SRR12670992 is conventional basespace SRR12670992 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46425 37.0 37.0 37.0 37.0 37.0 2 36.401 37.0 37.0 37.0 37.0 37.0 3 36.546 37.0 37.0 37.0 37.0 37.0 4 36.64 37.0 37.0 37.0 37.0 37.0 5 36.672 37.0 37.0 37.0 37.0 37.0 6 36.7265 37.0 37.0 37.0 37.0 37.0 7 36.6195 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.6155 37.0 37.0 37.0 37.0 37.0 10-14 36.6269 37.0 37.0 37.0 37.0 37.0 15-19 36.6089 37.0 37.0 37.0 37.0 37.0 20-24 36.583 37.0 37.0 37.0 37.0 37.0 25-29 36.5012 37.0 37.0 37.0 37.0 37.0 30-34 36.4959 37.0 37.0 37.0 37.0 37.0 35-39 36.5187 37.0 37.0 37.0 37.0 37.0 40-44 36.4362 37.0 37.0 37.0 37.0 37.0 45-49 36.422700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.4148 37.0 37.0 37.0 37.0 37.0 55-59 36.438 37.0 37.0 37.0 37.0 37.0 60-64 36.3904 37.0 37.0 37.0 37.0 37.0 65-69 36.384699999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.376099999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.334199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2625 37.0 37.0 37.0 37.0 37.0 85-89 36.253099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2455 37.0 37.0 37.0 37.0 37.0 95-99 36.1925 37.0 37.0 37.0 37.0 37.0 100-104 36.1991 37.0 37.0 37.0 37.0 37.0 105-109 36.1985 37.0 37.0 37.0 37.0 37.0 110-114 36.1484 37.0 37.0 37.0 37.0 37.0 115-119 36.1389 37.0 37.0 37.0 37.0 37.0 120-124 36.0767 37.0 37.0 37.0 37.0 37.0 125-129 35.9763 37.0 37.0 37.0 37.0 37.0 130-134 35.9076 37.0 37.0 37.0 37.0 37.0 135-139 35.9293 37.0 37.0 37.0 37.0 37.0 140-144 35.844800000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.7801 37.0 37.0 37.0 37.0 37.0 150-151 35.55 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 4.0 24 0.0 25 7.0 26 1.0 27 11.0 28 10.0 29 23.0 30 30.0 31 37.0 32 43.0 33 80.0 34 120.0 35 263.0 36 2699.0 37 669.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.388347086771695 11.977994498624655 4.7011752938234554 29.932483120780194 2 19.625 11.5 36.199999999999996 32.675 3 16.150000000000002 17.65 29.525000000000002 36.675000000000004 4 21.7 23.95 25.474999999999998 28.875 5 24.5 31.175000000000004 22.95 21.375 6 20.05 33.5 23.3 23.150000000000002 7 14.224999999999998 27.1 42.449999999999996 16.225 8 16.525000000000002 25.025 33.525 24.925 9 16.950000000000003 21.9 36.775000000000006 24.375 10-14 19.77 29.765000000000004 27.73 22.735 15-19 20.035 28.115000000000002 28.175 23.674999999999997 20-24 20.645 28.38 27.405 23.57 25-29 20.285 28.410000000000004 27.32 23.985 30-34 20.13 28.735 28.225 22.91 35-39 20.115 28.23 27.505000000000003 24.15 40-44 20.015 28.305000000000003 28.194999999999997 23.485 45-49 20.405 28.29 27.605 23.7 50-54 19.93 28.875 27.779999999999998 23.415 55-59 19.955000000000002 28.249999999999996 28.134999999999998 23.66 60-64 20.150000000000002 28.975 27.155 23.72 65-69 20.255000000000003 28.939999999999998 27.22 23.585 70-74 20.05 28.765 27.46 23.724999999999998 75-79 20.46 28.305000000000003 27.525 23.71 80-84 20.09 28.660000000000004 27.515 23.735 85-89 20.05 28.98 27.800000000000004 23.169999999999998 90-94 20.07 27.779999999999998 28.244999999999997 23.905 95-99 20.155 28.395 27.73 23.72 100-104 20.419999999999998 28.73 27.175 23.674999999999997 105-109 21.14 28.935 26.584999999999997 23.34 110-114 20.95 28.51 27.165 23.375 115-119 21.085 28.185 27.095000000000002 23.635 120-124 20.105 28.849999999999998 27.700000000000003 23.345 125-129 21.02 28.634999999999998 26.71 23.635 130-134 20.485 28.505000000000003 27.485 23.525 135-139 20.84 27.96 27.055 24.145 140-144 21.37 27.905 26.919999999999998 23.805 145-149 21.18 28.23 27.12 23.47 150-151 20.95 27.487499999999997 27.175 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 3.0 22 2.5 23 0.5 24 2.5 25 4.0 26 5.5 27 8.0 28 10.5 29 15.0 30 21.0 31 30.0 32 35.5 33 34.5 34 45.5 35 69.5 36 89.0 37 115.5 38 140.5 39 153.5 40 181.0 41 205.5 42 227.5 43 249.5 44 250.5 45 254.5 46 260.5 47 257.0 48 237.0 49 214.0 50 193.0 51 148.5 52 111.0 53 93.0 54 77.0 55 60.5 56 49.5 57 38.0 58 27.5 59 25.5 60 17.0 61 11.0 62 9.0 63 4.0 64 1.0 65 0.0 66 0.5 67 1.5 68 2.0 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 90.45643153526972 81.75 2 8.575380359612724 15.5 3 0.8298755186721992 2.25 4 0.13831258644536654 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.5375 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.387499999999999 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670992 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670992_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2195 37.0 37.0 37.0 37.0 37.0 2 35.9665 37.0 37.0 37.0 37.0 37.0 3 36.1905 37.0 37.0 37.0 37.0 37.0 4 36.2375 37.0 37.0 37.0 37.0 37.0 5 36.24 37.0 37.0 37.0 37.0 37.0 6 36.217 37.0 37.0 37.0 37.0 37.0 7 36.2615 37.0 37.0 37.0 37.0 37.0 8 36.294 37.0 37.0 37.0 37.0 37.0 9 36.361 37.0 37.0 37.0 37.0 37.0 10-14 36.314600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.321600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.304700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.225699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.199400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1952 37.0 37.0 37.0 37.0 37.0 40-44 36.16330000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1854 37.0 37.0 37.0 37.0 37.0 50-54 36.1552 37.0 37.0 37.0 37.0 37.0 55-59 36.167199999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.145799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.13850000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.0664 37.0 37.0 37.0 37.0 37.0 75-79 36.0868 37.0 37.0 37.0 37.0 37.0 80-84 36.0817 37.0 37.0 37.0 37.0 37.0 85-89 35.980599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.943200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.9482 37.0 37.0 37.0 37.0 37.0 100-104 35.9397 37.0 37.0 37.0 37.0 37.0 105-109 35.9327 37.0 37.0 37.0 37.0 37.0 110-114 35.9369 37.0 37.0 37.0 37.0 37.0 115-119 35.8557 37.0 37.0 37.0 37.0 37.0 120-124 35.8159 37.0 37.0 37.0 37.0 37.0 125-129 35.744800000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.7251 37.0 37.0 37.0 37.0 37.0 135-139 35.677099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.605000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.4024 37.0 37.0 37.0 37.0 37.0 150-151 35.1215 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 3.0 15 3.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 7.0 24 9.0 25 7.0 26 8.0 27 11.0 28 12.0 29 29.0 30 20.0 31 38.0 32 51.0 33 92.0 34 170.0 35 454.0 36 2577.0 37 501.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.65 26.400000000000002 6.625 18.325 2 29.95 23.225 30.099999999999998 16.725 3 20.8 27.250000000000004 35.325 16.625 4 24.7 34.075 22.5 18.725 5 25.15 37.574999999999996 21.375 15.9 6 20.925 40.45 21.275 17.349999999999998 7 21.025 23.65 38.475 16.85 8 19.75 26.3 28.675 25.275 9 21.2 23.175 31.4 24.224999999999998 10-14 23.705000000000002 28.76 27.169999999999998 20.365 15-19 23.76 28.194999999999997 27.145000000000003 20.9 20-24 23.325000000000003 29.160000000000004 26.995 20.52 25-29 22.994999999999997 28.305000000000003 28.044999999999998 20.655 30-34 23.25 28.810000000000002 27.474999999999998 20.465 35-39 23.085 28.189999999999998 27.925 20.8 40-44 22.865 28.73 27.785 20.62 45-49 23.05 28.249999999999996 27.425 21.275 50-54 22.735 28.189999999999998 28.000000000000004 21.075 55-59 22.97 27.42 27.93 21.68 60-64 23.025000000000002 27.975 27.950000000000003 21.05 65-69 23.565 27.400000000000002 27.224999999999998 21.81 70-74 23.165 28.560000000000002 27.025 21.25 75-79 23.200000000000003 27.950000000000003 28.02 20.830000000000002 80-84 23.015 28.18 27.215 21.59 85-89 23.18 28.060000000000002 27.605 21.154999999999998 90-94 23.46 27.615000000000002 27.744999999999997 21.18 95-99 23.465 28.29 27.29 20.955 100-104 23.48 27.650000000000002 28.050000000000004 20.82 105-109 23.645 27.889999999999997 27.715 20.75 110-114 23.875 28.194999999999997 27.68 20.25 115-119 24.02 28.134999999999998 27.295 20.549999999999997 120-124 23.555 28.355000000000004 27.01 21.08 125-129 23.76 27.67 27.975 20.595 130-134 24.345 27.450000000000003 27.634999999999998 20.57 135-139 24.235 27.58 27.584999999999997 20.599999999999998 140-144 24.6 27.6 27.775 20.025000000000002 145-149 24.645 28.1 27.155 20.1 150-151 24.9375 27.8625 27.762500000000003 19.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 1.5 13 1.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 3.0 21 4.5 22 4.0 23 3.0 24 2.5 25 3.0 26 4.0 27 4.5 28 7.5 29 11.5 30 15.5 31 21.0 32 31.0 33 45.0 34 51.0 35 66.0 36 89.0 37 95.0 38 119.5 39 157.5 40 183.0 41 216.0 42 247.5 43 264.0 44 263.0 45 280.5 46 289.0 47 256.5 48 226.5 49 200.5 50 173.5 51 138.5 52 105.0 53 93.0 54 76.5 55 53.5 56 42.5 57 35.5 58 26.0 59 19.5 60 17.5 61 11.0 62 6.5 63 6.5 64 5.0 65 1.5 66 0.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.10315026484528 80.80000000000001 2 8.670197936994702 15.55 3 1.0315026484527459 2.775 4 0.1115137998327293 0.4 5 0.027878449958182325 0.125 6 0.027878449958182325 0.15 7 0.0 0.0 8 0.027878449958182325 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.5375 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.387499999999999 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGATGG 10 0.006830828 145.0 1 >>END_MODULE Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668248 spots for SRR12670992.sra Written 668248 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra Read 668229 spots for SRR12670992.sra Written 668229 spots for SRR12670992.sra SRR ids: ['SRR12670992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w8h2dl69 SRR12670992.sra spots: 13364599 blocks: [[1, 668229], [668230, 1336458], [1336459, 2004687], [2004688, 2672916], [2672917, 3341145], [3341146, 4009374], [4009375, 4677603], [4677604, 5345832], [5345833, 6014061], [6014062, 6682290], [6682291, 7350519], [7350520, 8018748], [8018749, 8686977], [8686978, 9355206], [9355207, 10023435], [10023436, 10691664], [10691665, 11359893], [11359894, 12028122], [12028123, 12696351], [12696352, 13364599]] SRR12670992 file size 4520175 SRR12670992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670992 SRR12670992_1.fastq SRR12670992_2.fastq Input file: SRR12670992_1.fastq Paired file: SRR12670992_2.fastq trimmed: SRR12670992-trimmed-pair1.fastq, SRR12670992-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:05:01 2025 >> started Tue Feb 11 12:05:17 2025 >> done (15.738s) 13364599 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 2030 ( 0.02%) empty read pairs filtered out after trimming by size control 13362442 (99.98%) read pairs available; of these: 1089788 ( 8.16%) trimmed read pairs available after processing 12272654 (91.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 9 0.00% 21 25 0.00% 22 21 0.00% 23 25 0.00% 24 14 0.00% 25 19 0.00% 26 31 0.00% 27 36 0.00% 28 29 0.00% 29 29 0.00% 30 28 0.00% 31 27 0.00% 32 28 0.00% 33 39 0.00% 34 18 0.00% 35 26 0.00% 36 20 0.00% 37 24 0.00% 38 14 0.00% 39 22 0.00% 40 28 0.00% 41 19 0.00% 42 27 0.00% 43 35 0.00% 44 23 0.00% 45 39 0.00% 46 33 0.00% 47 28 0.00% 48 45 0.00% 49 35 0.00% 50 50 0.00% 51 55 0.00% 52 63 0.00% 53 65 0.00% 54 67 0.00% 55 75 0.00% 56 74 0.00% 57 84 0.00% 58 106 0.00% 59 139 0.00% 60 144 0.00% 61 163 0.00% 62 207 0.00% 63 199 0.00% 64 257 0.00% 65 254 0.00% 66 257 0.00% 67 289 0.00% 68 345 0.00% 69 396 0.00% 70 534 0.00% 71 572 0.00% 72 642 0.00% 73 721 0.01% 74 782 0.01% 75 902 0.01% 76 1024 0.01% 77 979 0.01% 78 1171 0.01% 79 1284 0.01% 80 1482 0.01% 81 1648 0.01% 82 1932 0.01% 83 2112 0.02% 84 2331 0.02% 85 2574 0.02% 86 2678 0.02% 87 2882 0.02% 88 3149 0.02% 89 3302 0.02% 90 3644 0.03% 91 3974 0.03% 92 4098 0.03% 93 4603 0.03% 94 5070 0.04% 95 5576 0.04% 96 5661 0.04% 97 5950 0.04% 98 5940 0.04% 99 6632 0.05% 100 6968 0.05% 101 7193 0.05% 102 7830 0.06% 103 8260 0.06% 104 8561 0.06% 105 9163 0.07% 106 9437 0.07% 107 9705 0.07% 108 10166 0.08% 109 10591 0.08% 110 10895 0.08% 111 11504 0.09% 112 11878 0.09% 113 12393 0.09% 114 13056 0.10% 115 13521 0.10% 116 14232 0.11% 117 14815 0.11% 118 15463 0.12% 119 15545 0.12% 120 15997 0.12% 121 16802 0.13% 122 17430 0.13% 123 17993 0.13% 124 18960 0.14% 125 19127 0.14% 126 20349 0.15% 127 20683 0.15% 128 20655 0.15% 129 21508 0.16% 130 21638 0.16% 131 22159 0.17% 132 23088 0.17% 133 23687 0.18% 134 24175 0.18% 135 25175 0.19% 136 25562 0.19% 137 26213 0.20% 138 26606 0.20% 139 28033 0.21% 140 27555 0.21% 141 28771 0.22% 142 29576 0.22% 143 29833 0.22% 144 31212 0.23% 145 31518 0.24% 146 31951 0.24% 147 32564 0.24% 148 33875 0.25% 149 33485 0.25% 150 34483 0.26% 151 12272654 91.84% 13362442 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=17 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=36.99 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCA criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=27 prefix-density=1.09 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=31.53 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR12670992 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:06:02 Started mapping on | Feb 11 12:06:02 Finished on | Feb 11 12:07:33 Mapping speed, Million of reads per hour | 528.62 Number of input reads | 13362442 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12496902 Uniquely mapped reads % | 93.52% Average mapped length | 296.69 Number of splices: Total | 12747965 Number of splices: Annotated (sjdb) | 12496640 Number of splices: GT/AG | 12506698 Number of splices: GC/AG | 201439 Number of splices: AT/AC | 7790 Number of splices: Non-canonical | 32038 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269149 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 82736 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 596391 596391 596391 N_multimapping 269149 269149 269149 N_noFeature 497663 12303858 551548 N_ambiguous 210441 838 70922 UnstrandedReadsAssigned:11788798 PositiveStrandReadsAssigned:192206 NegativeStrandReadsAssigned:11874432 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670992 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670992-trimmed-pair1.fastq SRR12670992-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,362,442 reads, 11,875,312 reads pseudoaligned [quant] estimated average fragment length: 270.635 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR12670992.ke.tsv 34699 SRR12670992.se.tsv 87100 total ==> SRR12670992.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.36 370 15.1731 Potri.005G024800.1.v4.1 1035 765.365 119 11.1477 Potri.004G059700.1.v4.1 961 691.712 3 0.310958 Potri.007G009000.2.v4.1 1416 1146.36 0 0 Potri.003G141000.2.v4.1 2943 2673.36 443 11.8809 Potri.016G087400.1.v4.1 270 80.522 513 456.781 Potri.015G069301.1.v4.1 564 311.759 0 0 Potri.010G195200.1.v4.1 1773 1503.36 57.9356 2.76303 Potri.012G127500.1.v4.1 977 707.527 94 9.52554 ==> SRR12670992.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 139 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670992 completed mapping pipeline successfully