Starting /dee2/code/volunteer_pipeline.sh SRR12670993 current disk space = 3051039772672 free memory = 1469881612 SRR12670993 SRAfilesize 537c36390a70458e72fcd2cba1e64770 SRR12670993.sra SRR12670993.sra file validated SRR12670993 is paired end SRR12670993 is conventional basespace SRR12670993 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.485 37.0 37.0 37.0 37.0 37.0 2 36.4465 37.0 37.0 37.0 37.0 37.0 3 36.465 37.0 37.0 37.0 37.0 37.0 4 36.6155 37.0 37.0 37.0 37.0 37.0 5 36.622 37.0 37.0 37.0 37.0 37.0 6 36.582 37.0 37.0 37.0 37.0 37.0 7 36.581 37.0 37.0 37.0 37.0 37.0 8 36.5505 37.0 37.0 37.0 37.0 37.0 9 36.615 37.0 37.0 37.0 37.0 37.0 10-14 36.625299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6038 37.0 37.0 37.0 37.0 37.0 20-24 36.599599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4946 37.0 37.0 37.0 37.0 37.0 30-34 36.4876 37.0 37.0 37.0 37.0 37.0 35-39 36.4747 37.0 37.0 37.0 37.0 37.0 40-44 36.430499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.443200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4237 37.0 37.0 37.0 37.0 37.0 55-59 36.3466 37.0 37.0 37.0 37.0 37.0 60-64 36.35609999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.379 37.0 37.0 37.0 37.0 37.0 70-74 36.4002 37.0 37.0 37.0 37.0 37.0 75-79 36.2988 37.0 37.0 37.0 37.0 37.0 80-84 36.280899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.232099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.237 37.0 37.0 37.0 37.0 37.0 95-99 36.204899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.163700000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0952 37.0 37.0 37.0 37.0 37.0 110-114 36.16270000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0432 37.0 37.0 37.0 37.0 37.0 120-124 36.0364 37.0 37.0 37.0 37.0 37.0 125-129 35.9927 37.0 37.0 37.0 37.0 37.0 130-134 35.897 37.0 37.0 37.0 37.0 37.0 135-139 35.9131 37.0 37.0 37.0 37.0 37.0 140-144 35.9251 37.0 37.0 37.0 37.0 37.0 145-149 35.7322 37.0 37.0 37.0 37.0 37.0 150-151 35.601749999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 2.0 23 4.0 24 3.0 25 1.0 26 6.0 27 7.0 28 16.0 29 22.0 30 24.0 31 37.0 32 54.0 33 85.0 34 111.0 35 261.0 36 2656.0 37 708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.25 10.975 6.25 38.525 2 18.575 11.450000000000001 37.75 32.225 3 17.45 14.325 27.250000000000004 40.975 4 22.55 21.825 23.325000000000003 32.300000000000004 5 24.224999999999998 30.45 23.95 21.375 6 21.3 33.225 22.875 22.6 7 14.899999999999999 26.625 40.8 17.675 8 17.575 26.775 31.874999999999996 23.775 9 16.875 24.7 34.875 23.549999999999997 10-14 19.27 30.14 28.134999999999998 22.455 15-19 19.73 28.305000000000003 27.705000000000002 24.26 20-24 19.814999999999998 28.04 28.720000000000002 23.425 25-29 20.21 28.535 27.905 23.35 30-34 19.78 28.194999999999997 27.689999999999998 24.335 35-39 19.355 29.17 27.485 23.990000000000002 40-44 19.85 28.645 27.839999999999996 23.665 45-49 20.535 28.785 27.334999999999997 23.345 50-54 20.365 28.410000000000004 27.46 23.765 55-59 20.035 28.305000000000003 28.275 23.385 60-64 20.27 28.89 27.279999999999998 23.56 65-69 19.564999999999998 28.88 27.495000000000005 24.060000000000002 70-74 20.32 28.665000000000003 27.36 23.655 75-79 20.1 28.38 27.884999999999998 23.635 80-84 20.49 28.64 27.565 23.305 85-89 20.66 27.77 27.625 23.945 90-94 20.505000000000003 28.02 28.189999999999998 23.285 95-99 20.7 28.685 26.865 23.75 100-104 20.075000000000003 28.455000000000002 27.415 24.055 105-109 20.43 28.115000000000002 27.41 24.044999999999998 110-114 20.565 27.925 27.93 23.580000000000002 115-119 20.435 28.835 27.224999999999998 23.505000000000003 120-124 20.9 28.57 27.474999999999998 23.055 125-129 20.64 27.875 28.165000000000003 23.32 130-134 20.544999999999998 28.175 27.275 24.005000000000003 135-139 21.025 27.715 27.915 23.345 140-144 20.715 28.175 27.705000000000002 23.405 145-149 21.025 27.92 27.63 23.425 150-151 20.849999999999998 27.437499999999996 27.950000000000003 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.5 9 1.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 4.5 26 6.5 27 7.5 28 11.0 29 13.0 30 17.0 31 28.5 32 40.0 33 42.5 34 47.5 35 66.0 36 76.5 37 93.0 38 125.0 39 154.5 40 179.0 41 203.5 42 221.0 43 256.5 44 274.5 45 261.0 46 261.5 47 254.5 48 228.5 49 200.0 50 176.0 51 157.5 52 129.5 53 98.5 54 83.5 55 68.0 56 57.0 57 46.5 58 31.5 59 22.0 60 16.0 61 7.5 62 3.0 63 2.5 64 2.0 65 2.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.75 #Duplication Level Percentage of deduplicated Percentage of total 1 89.86072423398329 80.65 2 9.080779944289693 16.3 3 0.8635097493036212 2.325 4 0.1671309192200557 0.6 5 0.02785515320334262 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAGCAGAGGTTCATTATCCTTGGAGAGACTTAGAAGAGATAGTAGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.1500000000000004 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.2875 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAAT 10 0.006830828 145.0 6 >>END_MODULE SRR12670993 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670993_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2485 37.0 37.0 37.0 37.0 37.0 2 36.253 37.0 37.0 37.0 37.0 37.0 3 36.38 37.0 37.0 37.0 37.0 37.0 4 36.395 37.0 37.0 37.0 37.0 37.0 5 36.445 37.0 37.0 37.0 37.0 37.0 6 36.366 37.0 37.0 37.0 37.0 37.0 7 36.4265 37.0 37.0 37.0 37.0 37.0 8 36.4185 37.0 37.0 37.0 37.0 37.0 9 36.3695 37.0 37.0 37.0 37.0 37.0 10-14 36.414699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.407500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.353500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3504 37.0 37.0 37.0 37.0 37.0 30-34 36.379200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.308 37.0 37.0 37.0 37.0 37.0 40-44 36.2626 37.0 37.0 37.0 37.0 37.0 45-49 36.2506 37.0 37.0 37.0 37.0 37.0 50-54 36.2251 37.0 37.0 37.0 37.0 37.0 55-59 36.2442 37.0 37.0 37.0 37.0 37.0 60-64 36.1905 37.0 37.0 37.0 37.0 37.0 65-69 36.172999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1637 37.0 37.0 37.0 37.0 37.0 75-79 36.122400000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.117399999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.062200000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.092600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0949 37.0 37.0 37.0 37.0 37.0 100-104 36.043400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9285 37.0 37.0 37.0 37.0 37.0 110-114 35.957899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.93525 37.0 37.0 37.0 37.0 37.0 120-124 35.88440000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.812 37.0 37.0 37.0 37.0 37.0 130-134 35.8387 37.0 37.0 37.0 37.0 37.0 135-139 35.7791 37.0 37.0 37.0 37.0 37.0 140-144 35.71810000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.5698 37.0 37.0 37.0 37.0 37.0 150-151 35.39925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 4.0 16 2.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 2.0 24 6.0 25 6.0 26 6.0 27 11.0 28 16.0 29 20.0 30 24.0 31 28.0 32 54.0 33 77.0 34 135.0 35 335.0 36 2695.0 37 563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.5 26.025 9.125 24.349999999999998 2 26.25 26.75 31.6 15.4 3 21.099999999999998 26.650000000000002 33.7 18.55 4 22.725 33.575 24.975 18.725 5 25.1 37.6 21.9 15.4 6 20.200000000000003 39.7 22.175 17.925 7 19.525000000000002 24.625 37.125 18.725 8 20.5 26.25 28.375 24.875 9 21.75 25.724999999999998 29.775000000000002 22.75 10-14 23.02 30.349999999999998 26.105 20.525 15-19 22.93 28.610000000000003 27.525 20.935000000000002 20-24 23.04 29.459999999999997 27.060000000000002 20.44 25-29 22.59 28.595 28.02 20.794999999999998 30-34 22.54 28.185 28.26 21.015 35-39 22.17 28.050000000000004 28.04 21.740000000000002 40-44 23.03 28.754999999999995 27.655 20.560000000000002 45-49 22.645 28.24 27.975 21.14 50-54 22.275 28.73 27.655 21.34 55-59 22.765 28.110000000000003 28.155 20.97 60-64 22.814999999999998 27.54 27.905 21.740000000000002 65-69 22.770000000000003 27.68 28.035 21.515 70-74 23.150000000000002 28.12 27.055 21.675 75-79 22.79 27.794999999999998 27.339999999999996 22.075 80-84 22.81 28.060000000000002 27.22 21.91 85-89 23.86 27.615000000000002 27.595 20.93 90-94 23.365 28.18 27.43 21.025 95-99 23.135 28.810000000000002 27.284999999999997 20.77 100-104 23.415 27.794999999999998 27.400000000000002 21.39 105-109 23.96 27.905 27.425 20.71 110-114 23.215 27.529999999999998 28.389999999999997 20.865000000000002 115-119 23.691184559227963 28.356417820891046 27.086354317715887 20.866043302165107 120-124 23.745 28.875 27.16 20.22 125-129 23.305 28.43 27.589999999999996 20.674999999999997 130-134 24.01 28.060000000000002 27.52 20.41 135-139 24.349999999999998 27.275 27.975 20.4 140-144 24.535 28.12 27.700000000000003 19.645000000000003 145-149 24.33 27.955000000000002 27.665 20.05 150-151 24.825 28.1375 27.0 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 1.5 16 1.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.0 23 1.5 24 1.5 25 1.0 26 2.0 27 2.5 28 7.0 29 12.0 30 17.5 31 24.0 32 29.5 33 34.0 34 45.0 35 62.0 36 98.0 37 136.5 38 139.5 39 164.5 40 195.0 41 223.0 42 260.0 43 282.0 44 304.5 45 278.5 46 240.0 47 238.5 48 222.0 49 178.5 50 142.5 51 123.0 52 112.5 53 96.0 54 83.0 55 62.5 56 35.0 57 29.0 58 26.0 59 23.5 60 16.0 61 7.0 62 8.5 63 6.0 64 1.0 65 1.0 66 2.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.425 #Duplication Level Percentage of deduplicated Percentage of total 1 90.01956947162427 80.5 2 8.666480290746435 15.5 3 1.034386357282639 2.775 4 0.13978194017332962 0.5 5 0.08386916410399776 0.375 6 0.0 0.0 7 0.05591277606933184 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 7 0.17500000000000002 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.3625 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTAAC 10 0.006830828 145.0 1 >>END_MODULE Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790216 spots for SRR12670993.sra Written 790216 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra Read 790206 spots for SRR12670993.sra Written 790206 spots for SRR12670993.sra SRR ids: ['SRR12670993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vsrig5pk SRR12670993.sra spots: 15804130 blocks: [[1, 790206], [790207, 1580412], [1580413, 2370618], [2370619, 3160824], [3160825, 3951030], [3951031, 4741236], [4741237, 5531442], [5531443, 6321648], [6321649, 7111854], [7111855, 7902060], [7902061, 8692266], [8692267, 9482472], [9482473, 10272678], [10272679, 11062884], [11062885, 11853090], [11853091, 12643296], [12643297, 13433502], [13433503, 14223708], [14223709, 15013914], [15013915, 15804130]] SRR12670993 file size 5349234 SRR12670993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670993 SRR12670993_1.fastq SRR12670993_2.fastq Input file: SRR12670993_1.fastq Paired file: SRR12670993_2.fastq trimmed: SRR12670993-trimmed-pair1.fastq, SRR12670993-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:12:31 2025 >> started Tue Feb 11 12:12:58 2025 >> done (26.397s) 15804130 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 3609 ( 0.02%) empty read pairs filtered out after trimming by size control 15800449 (99.98%) read pairs available; of these: 837627 ( 5.30%) trimmed read pairs available after processing 14962822 (94.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 10 0.00% 25 10 0.00% 26 10 0.00% 27 14 0.00% 28 18 0.00% 29 12 0.00% 30 7 0.00% 31 13 0.00% 32 9 0.00% 33 13 0.00% 34 18 0.00% 35 19 0.00% 36 8 0.00% 37 17 0.00% 38 15 0.00% 39 16 0.00% 40 22 0.00% 41 18 0.00% 42 17 0.00% 43 22 0.00% 44 23 0.00% 45 24 0.00% 46 20 0.00% 47 27 0.00% 48 31 0.00% 49 29 0.00% 50 37 0.00% 51 30 0.00% 52 53 0.00% 53 60 0.00% 54 58 0.00% 55 52 0.00% 56 86 0.00% 57 75 0.00% 58 81 0.00% 59 119 0.00% 60 123 0.00% 61 133 0.00% 62 137 0.00% 63 177 0.00% 64 196 0.00% 65 188 0.00% 66 268 0.00% 67 285 0.00% 68 269 0.00% 69 288 0.00% 70 320 0.00% 71 408 0.00% 72 507 0.00% 73 577 0.00% 74 599 0.00% 75 675 0.00% 76 761 0.00% 77 807 0.01% 78 886 0.01% 79 1064 0.01% 80 1081 0.01% 81 1259 0.01% 82 1456 0.01% 83 1570 0.01% 84 1714 0.01% 85 2007 0.01% 86 2093 0.01% 87 2322 0.01% 88 2541 0.02% 89 2523 0.02% 90 2814 0.02% 91 2947 0.02% 92 3145 0.02% 93 3397 0.02% 94 3643 0.02% 95 4071 0.03% 96 4187 0.03% 97 4394 0.03% 98 4745 0.03% 99 5005 0.03% 100 5264 0.03% 101 5454 0.03% 102 5644 0.04% 103 5923 0.04% 104 6282 0.04% 105 6739 0.04% 106 7070 0.04% 107 7416 0.05% 108 7561 0.05% 109 7926 0.05% 110 7908 0.05% 111 8746 0.06% 112 8824 0.06% 113 8862 0.06% 114 9629 0.06% 115 9950 0.06% 116 10196 0.06% 117 11147 0.07% 118 11315 0.07% 119 11789 0.07% 120 12022 0.08% 121 12680 0.08% 122 12992 0.08% 123 13220 0.08% 124 13738 0.09% 125 14041 0.09% 126 14843 0.09% 127 15364 0.10% 128 15700 0.10% 129 16239 0.10% 130 16885 0.11% 131 16854 0.11% 132 17502 0.11% 133 17971 0.11% 134 18189 0.12% 135 19019 0.12% 136 19316 0.12% 137 20062 0.13% 138 20773 0.13% 139 21753 0.14% 140 22229 0.14% 141 23063 0.15% 142 23259 0.15% 143 23642 0.15% 144 24568 0.16% 145 24972 0.16% 146 25585 0.16% 147 26287 0.17% 148 27473 0.17% 149 27581 0.17% 150 29458 0.19% 151 14962822 94.70% 15800449 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=7.41 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.2 sequence=CCAATTCTCGAGC criterion=sequence-density sequence-density=1.41 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=31 prefix-density=1.40 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=29.78 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.1 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR12670993 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:13:48 Started mapping on | Feb 11 12:13:49 Finished on | Feb 11 12:18:02 Mapping speed, Million of reads per hour | 224.83 Number of input reads | 15800449 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14743131 Uniquely mapped reads % | 93.31% Average mapped length | 298.20 Number of splices: Total | 14634056 Number of splices: Annotated (sjdb) | 14329477 Number of splices: GT/AG | 14352497 Number of splices: GC/AG | 230745 Number of splices: AT/AC | 9749 Number of splices: Non-canonical | 41065 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372158 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 49333 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685160 685160 685160 N_multimapping 372158 372158 372158 N_noFeature 542878 14487103 614808 N_ambiguous 277478 977 92807 UnstrandedReadsAssigned:13922775 PositiveStrandReadsAssigned:255051 NegativeStrandReadsAssigned:14035516 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670993 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670993-trimmed-pair1.fastq SRR12670993-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,800,449 reads, 13,978,856 reads pseudoaligned [quant] estimated average fragment length: 278.138 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12670993.ke.tsv 34699 SRR12670993.se.tsv 87100 total ==> SRR12670993.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.86 347 10.6582 Potri.005G024800.1.v4.1 1035 757.862 182 12.841 Potri.004G059700.1.v4.1 961 684.032 7 0.547191 Potri.007G009000.2.v4.1 1416 1138.86 0 0 Potri.003G141000.2.v4.1 2943 2665.86 613.464 12.3046 Potri.016G087400.1.v4.1 270 71.7325 816 608.263 Potri.015G069301.1.v4.1 564 299.981 0 0 Potri.010G195200.1.v4.1 1773 1495.86 119 4.25375 Potri.012G127500.1.v4.1 977 699.965 89 6.79877 ==> SRR12670993.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 170 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 60 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12670993 completed mapping pipeline successfully