Starting /dee2/code/volunteer_pipeline.sh SRR12670994 current disk space = 3050684518400 free memory = 1579897092 SRR12670994 SRAfilesize c55d9785580417c631ac69bdceafd325 SRR12670994.sra SRR12670994.sra file validated SRR12670994 is paired end SRR12670994 is conventional basespace SRR12670994 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.30525 37.0 37.0 37.0 37.0 37.0 2 36.3255 37.0 37.0 37.0 37.0 37.0 3 36.5015 37.0 37.0 37.0 37.0 37.0 4 36.518 37.0 37.0 37.0 37.0 37.0 5 36.6065 37.0 37.0 37.0 37.0 37.0 6 36.6155 37.0 37.0 37.0 37.0 37.0 7 36.572 37.0 37.0 37.0 37.0 37.0 8 36.581 37.0 37.0 37.0 37.0 37.0 9 36.5655 37.0 37.0 37.0 37.0 37.0 10-14 36.5988 37.0 37.0 37.0 37.0 37.0 15-19 36.5451 37.0 37.0 37.0 37.0 37.0 20-24 36.5112 37.0 37.0 37.0 37.0 37.0 25-29 36.5298 37.0 37.0 37.0 37.0 37.0 30-34 36.446000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.48180000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4345 37.0 37.0 37.0 37.0 37.0 45-49 36.4264 37.0 37.0 37.0 37.0 37.0 50-54 36.372699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.352 37.0 37.0 37.0 37.0 37.0 60-64 36.3592 37.0 37.0 37.0 37.0 37.0 65-69 36.324400000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3123 37.0 37.0 37.0 37.0 37.0 75-79 36.265699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.19879999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.206 37.0 37.0 37.0 37.0 37.0 90-94 36.1418 37.0 37.0 37.0 37.0 37.0 95-99 36.1448 37.0 37.0 37.0 37.0 37.0 100-104 36.1736 37.0 37.0 37.0 37.0 37.0 105-109 36.1337 37.0 37.0 37.0 37.0 37.0 110-114 36.0664 37.0 37.0 37.0 37.0 37.0 115-119 36.035799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.9902 37.0 37.0 37.0 37.0 37.0 125-129 35.977500000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8404 37.0 37.0 37.0 37.0 37.0 135-139 35.8589 37.0 37.0 37.0 37.0 37.0 140-144 35.8593 37.0 37.0 37.0 37.0 37.0 145-149 35.637299999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.52375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 4.0 26 7.0 27 13.0 28 14.0 29 25.0 30 37.0 31 45.0 32 44.0 33 74.0 34 138.0 35 260.0 36 2733.0 37 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.936484121030254 10.277569392348088 5.676419104776194 38.10952738184546 2 16.775000000000002 12.15 37.625 33.45 3 17.375 16.525000000000002 28.1 38.0 4 22.3 23.3 23.7 30.7 5 23.200000000000003 30.125 24.55 22.125 6 21.375 33.175 23.1 22.35 7 15.2 26.025 42.425000000000004 16.35 8 16.3 26.3 34.325 23.075000000000003 9 15.775 23.150000000000002 38.074999999999996 23.0 10-14 19.37 29.54 29.060000000000002 22.03 15-19 19.765 28.575 28.189999999999998 23.47 20-24 19.400000000000002 29.42 28.255000000000003 22.925 25-29 19.405 28.854999999999997 27.725 24.015 30-34 19.72 29.4 26.995 23.885 35-39 19.97 28.754999999999995 27.68 23.595 40-44 19.439999999999998 28.77 28.64 23.150000000000002 45-49 19.259999999999998 29.054999999999996 27.555000000000003 24.13 50-54 19.81 28.87 28.105000000000004 23.215 55-59 19.38 28.32 28.52 23.78 60-64 20.04 29.099999999999998 27.16 23.7 65-69 19.75 28.27 28.084999999999997 23.895 70-74 19.545 29.07 27.305 24.08 75-79 19.85 28.939999999999998 27.455000000000002 23.755000000000003 80-84 20.474999999999998 28.849999999999998 27.37 23.305 85-89 20.105 28.835 27.48 23.580000000000002 90-94 19.96 28.64 27.810000000000002 23.59 95-99 19.855 28.74 27.43 23.974999999999998 100-104 20.395 29.4 27.250000000000004 22.955000000000002 105-109 20.145 27.99 28.244999999999997 23.62 110-114 20.445 28.76 27.755000000000003 23.04 115-119 20.11 28.715000000000003 27.175 24.0 120-124 20.405 28.505000000000003 27.639999999999997 23.45 125-129 20.115 28.585 27.485 23.815 130-134 20.175 29.2 27.474999999999998 23.150000000000002 135-139 20.505000000000003 27.775 27.525 24.195 140-144 20.755000000000003 28.98 27.1 23.165 145-149 21.07 28.32 27.065 23.544999999999998 150-151 20.1625 27.8625 28.125 23.849999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 1.5 25 3.0 26 6.5 27 8.0 28 11.5 29 22.5 30 29.5 31 29.0 32 29.5 33 39.5 34 50.5 35 66.5 36 86.5 37 97.5 38 128.0 39 166.5 40 204.0 41 252.0 42 258.0 43 246.5 44 248.0 45 262.0 46 278.0 47 259.0 48 230.0 49 213.0 50 183.5 51 123.5 52 95.0 53 86.0 54 69.5 55 63.5 56 45.5 57 26.5 58 18.0 59 14.0 60 10.0 61 5.5 62 5.5 63 5.0 64 3.0 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.47540983606557 83.7 2 7.868852459016394 14.399999999999999 3 0.546448087431694 1.5 4 0.1092896174863388 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGGTA 10 0.006830828 145.0 1 CCATTCG 10 0.006830828 145.0 3 TCCATAT 10 0.006830828 145.0 7 CCATATG 10 0.006830828 145.0 8 >>END_MODULE SRR12670994 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670994_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.173 37.0 37.0 37.0 37.0 37.0 2 36.21 37.0 37.0 37.0 37.0 37.0 3 36.3405 37.0 37.0 37.0 37.0 37.0 4 36.202 37.0 37.0 37.0 37.0 37.0 5 36.3805 37.0 37.0 37.0 37.0 37.0 6 36.3755 37.0 37.0 37.0 37.0 37.0 7 36.299 37.0 37.0 37.0 37.0 37.0 8 36.4015 37.0 37.0 37.0 37.0 37.0 9 36.36 37.0 37.0 37.0 37.0 37.0 10-14 36.2813 37.0 37.0 37.0 37.0 37.0 15-19 36.2947 37.0 37.0 37.0 37.0 37.0 20-24 36.346999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.233799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.1688 37.0 37.0 37.0 37.0 37.0 35-39 36.1515 37.0 37.0 37.0 37.0 37.0 40-44 36.1032 37.0 37.0 37.0 37.0 37.0 45-49 36.1122 37.0 37.0 37.0 37.0 37.0 50-54 36.0782 37.0 37.0 37.0 37.0 37.0 55-59 36.0344 37.0 37.0 37.0 37.0 37.0 60-64 36.0195 37.0 37.0 37.0 37.0 37.0 65-69 36.0757 37.0 37.0 37.0 37.0 37.0 70-74 36.0299 37.0 37.0 37.0 37.0 37.0 75-79 35.9433 37.0 37.0 37.0 37.0 37.0 80-84 35.9456 37.0 37.0 37.0 37.0 37.0 85-89 35.870400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.915499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8958 37.0 37.0 37.0 37.0 37.0 100-104 35.847500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7715 37.0 37.0 37.0 37.0 37.0 110-114 35.7966 37.0 37.0 37.0 37.0 37.0 115-119 35.7772 37.0 37.0 37.0 37.0 37.0 120-124 35.6563 37.0 37.0 37.0 37.0 37.0 125-129 35.5838 37.0 37.0 37.0 37.0 37.0 130-134 35.6327 37.0 37.0 37.0 37.0 37.0 135-139 35.6398 37.0 37.0 37.0 37.0 37.0 140-144 35.5168 37.0 37.0 37.0 37.0 37.0 145-149 35.4137 37.0 37.0 37.0 37.0 37.0 150-151 35.039 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 3.0 15 1.0 16 0.0 17 1.0 18 2.0 19 2.0 20 3.0 21 6.0 22 3.0 23 4.0 24 11.0 25 10.0 26 11.0 27 14.0 28 17.0 29 26.0 30 28.0 31 48.0 32 53.0 33 79.0 34 161.0 35 406.0 36 2587.0 37 518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 23.175 9.725 27.025 2 25.3 27.474999999999998 32.025 15.2 3 20.849999999999998 28.7 31.624999999999996 18.825 4 25.6 34.699999999999996 22.125 17.575 5 24.375 38.175 22.0 15.45 6 19.875 41.0 22.625 16.5 7 20.05 21.525 38.75 19.675 8 20.225 26.674999999999997 29.725 23.375 9 22.1 23.75 30.049999999999997 24.099999999999998 10-14 23.165 29.385 26.525 20.925 15-19 23.119999999999997 28.849999999999998 27.61 20.419999999999998 20-24 22.78 28.88 27.689999999999998 20.65 25-29 22.645 28.410000000000004 28.15 20.794999999999998 30-34 22.8 28.215 27.994999999999997 20.990000000000002 35-39 22.27 28.12 28.194999999999997 21.415 40-44 22.155 28.395 28.585 20.865000000000002 45-49 22.46 28.349999999999998 28.055000000000003 21.135 50-54 22.545 28.58 27.905 20.97 55-59 22.725 28.525 28.125 20.625 60-64 22.865 27.634999999999998 28.744999999999997 20.755000000000003 65-69 22.73 28.349999999999998 27.82 21.099999999999998 70-74 22.795 28.265 27.694999999999997 21.245 75-79 23.01 27.91 28.110000000000003 20.97 80-84 23.22 27.83 28.675 20.275000000000002 85-89 22.615 28.689999999999998 27.67 21.025 90-94 23.41 27.675 27.82 21.095 95-99 22.905 29.049999999999997 26.985 21.060000000000002 100-104 23.125 28.275 27.474999999999998 21.125 105-109 23.549999999999997 27.82 27.77 20.86 110-114 23.375 28.499999999999996 27.544999999999998 20.580000000000002 115-119 23.080000000000002 28.09 28.18 20.65 120-124 23.150000000000002 28.365000000000002 27.865000000000002 20.62 125-129 23.895 27.700000000000003 28.000000000000004 20.405 130-134 24.215 28.110000000000003 27.38 20.294999999999998 135-139 23.64 28.425 27.915 20.02 140-144 23.66 28.050000000000004 27.705000000000002 20.585 145-149 24.62 27.625 27.57 20.185 150-151 24.087500000000002 28.075 28.1875 19.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 1.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 3.0 24 4.0 25 5.0 26 8.0 27 10.5 28 11.0 29 16.0 30 21.0 31 25.0 32 32.0 33 36.0 34 54.0 35 75.5 36 81.5 37 101.5 38 138.5 39 185.0 40 212.0 41 233.5 42 270.5 43 279.0 44 270.0 45 264.0 46 255.5 47 247.0 48 212.0 49 178.5 50 165.0 51 130.0 52 108.0 53 88.5 54 63.5 55 47.5 56 33.5 57 25.5 58 18.5 59 19.5 60 17.5 61 10.0 62 8.0 63 5.5 64 2.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 1.0 95 0.5 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6210295728368 83.65 2 7.530120481927711 13.750000000000002 3 0.6297918948521358 1.725 4 0.16429353778751368 0.6 5 0.027382256297918947 0.125 6 0.027382256297918947 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.037500000000000006 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.075 0.0 0.0 0.025 0.0 88-89 0.1 0.0 0.0 0.025 0.0 90-91 0.1125 0.0 0.0 0.025 0.0 92-93 0.16249999999999998 0.0 0.0 0.025 0.0 94-95 0.2 0.0 0.0 0.025 0.0 96-97 0.275 0.0 0.0 0.025 0.0 98-99 0.35 0.0 0.0 0.025 0.0 100-101 0.42500000000000004 0.0 0.0 0.025 0.0 102-103 0.475 0.0 0.0 0.025 0.0 104-105 0.5625 0.0 0.0 0.025 0.0 106-107 0.5874999999999999 0.0 0.0 0.025 0.0 108-109 0.675 0.0 0.0 0.025 0.0 110-111 0.8 0.0 0.0 0.025 0.0 112-113 1.0 0.0 0.0 0.025 0.0 114-115 1.1375 0.0 0.0 0.025 0.0 116-117 1.275 0.0 0.0 0.025 0.0 118-119 1.475 0.0 0.0 0.025 0.0 120-121 1.6375000000000002 0.0 0.0 0.025 0.0 122-123 1.775 0.0 0.0 0.025 0.0 124-125 1.975 0.0 0.0 0.025 0.0 126-127 2.2625 0.0 0.0 0.025 0.0 128-129 2.425 0.0 0.0 0.025 0.0 130-131 2.6125 0.0 0.0 0.025 0.0 132-133 2.8499999999999996 0.0 0.0 0.025 0.0 134-135 3.0999999999999996 0.0 0.0 0.025 0.0 136-137 3.325 0.0 0.0 0.025 0.0 138-139 3.5 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGTTA 10 0.006830828 145.0 9 >>END_MODULE Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799252 spots for SRR12670994.sra Written 799252 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra Read 799251 spots for SRR12670994.sra Written 799251 spots for SRR12670994.sra SRR ids: ['SRR12670994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7737lftt SRR12670994.sra spots: 15985021 blocks: [[1, 799251], [799252, 1598502], [1598503, 2397753], [2397754, 3197004], [3197005, 3996255], [3996256, 4795506], [4795507, 5594757], [5594758, 6394008], [6394009, 7193259], [7193260, 7992510], [7992511, 8791761], [8791762, 9591012], [9591013, 10390263], [10390264, 11189514], [11189515, 11988765], [11988766, 12788016], [12788017, 13587267], [13587268, 14386518], [14386519, 15185769], [15185770, 15985021]] SRR12670994 file size 5410709 SRR12670994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670994 SRR12670994_1.fastq SRR12670994_2.fastq Input file: SRR12670994_1.fastq Paired file: SRR12670994_2.fastq trimmed: SRR12670994-trimmed-pair1.fastq, SRR12670994-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:53:16 2025 >> started Tue Feb 11 12:53:33 2025 >> done (17.415s) 15985021 read pairs processed; of these: 103 ( 0.00%) short read pairs filtered out after trimming by size control 4356 ( 0.03%) empty read pairs filtered out after trimming by size control 15980562 (99.97%) read pairs available; of these: 885739 ( 5.54%) trimmed read pairs available after processing 15094823 (94.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 12 0.00% 21 8 0.00% 22 5 0.00% 23 10 0.00% 24 4 0.00% 25 11 0.00% 26 17 0.00% 27 11 0.00% 28 16 0.00% 29 10 0.00% 30 12 0.00% 31 12 0.00% 32 11 0.00% 33 16 0.00% 34 10 0.00% 35 7 0.00% 36 22 0.00% 37 11 0.00% 38 15 0.00% 39 22 0.00% 40 17 0.00% 41 22 0.00% 42 16 0.00% 43 22 0.00% 44 15 0.00% 45 17 0.00% 46 23 0.00% 47 24 0.00% 48 26 0.00% 49 38 0.00% 50 34 0.00% 51 36 0.00% 52 52 0.00% 53 42 0.00% 54 52 0.00% 55 52 0.00% 56 44 0.00% 57 50 0.00% 58 76 0.00% 59 92 0.00% 60 86 0.00% 61 114 0.00% 62 116 0.00% 63 135 0.00% 64 160 0.00% 65 179 0.00% 66 197 0.00% 67 202 0.00% 68 250 0.00% 69 272 0.00% 70 328 0.00% 71 357 0.00% 72 419 0.00% 73 489 0.00% 74 473 0.00% 75 615 0.00% 76 633 0.00% 77 783 0.00% 78 767 0.00% 79 838 0.01% 80 934 0.01% 81 1090 0.01% 82 1239 0.01% 83 1368 0.01% 84 1570 0.01% 85 1774 0.01% 86 1900 0.01% 87 2048 0.01% 88 2235 0.01% 89 2253 0.01% 90 2595 0.02% 91 2806 0.02% 92 3031 0.02% 93 3304 0.02% 94 3566 0.02% 95 3898 0.02% 96 4194 0.03% 97 4541 0.03% 98 4718 0.03% 99 5001 0.03% 100 5457 0.03% 101 5428 0.03% 102 5989 0.04% 103 6406 0.04% 104 6646 0.04% 105 7058 0.04% 106 7439 0.05% 107 7696 0.05% 108 8111 0.05% 109 8407 0.05% 110 8852 0.06% 111 9013 0.06% 112 9640 0.06% 113 9810 0.06% 114 10463 0.07% 115 10774 0.07% 116 11332 0.07% 117 12010 0.08% 118 12448 0.08% 119 12603 0.08% 120 12958 0.08% 121 13626 0.09% 122 13960 0.09% 123 14251 0.09% 124 14975 0.09% 125 15336 0.10% 126 16412 0.10% 127 16603 0.10% 128 16874 0.11% 129 17656 0.11% 130 17923 0.11% 131 18129 0.11% 132 18908 0.12% 133 19356 0.12% 134 20051 0.13% 135 20466 0.13% 136 20890 0.13% 137 21481 0.13% 138 22551 0.14% 139 23249 0.15% 140 23368 0.15% 141 24048 0.15% 142 24837 0.16% 143 25205 0.16% 144 26018 0.16% 145 26241 0.16% 146 27028 0.17% 147 27773 0.17% 148 28685 0.18% 149 28391 0.18% 150 30422 0.19% 151 15094823 94.46% 15980562 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.43 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=21.36 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.6 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=28 prefix-density=0.54 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=33.82 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.8 sequence=AAAGAAAAGAAAA SRR12670994 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:54:20 Started mapping on | Feb 11 12:54:20 Finished on | Feb 11 12:56:12 Mapping speed, Million of reads per hour | 513.66 Number of input reads | 15980562 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14890234 Uniquely mapped reads % | 93.18% Average mapped length | 298.04 Number of splices: Total | 14728930 Number of splices: Annotated (sjdb) | 14408469 Number of splices: GT/AG | 14453128 Number of splices: GC/AG | 223379 Number of splices: AT/AC | 9165 Number of splices: Non-canonical | 43258 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401906 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 32720 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 688422 688422 688422 N_multimapping 401906 401906 401906 N_noFeature 573084 14679628 632561 N_ambiguous 249636 848 98086 UnstrandedReadsAssigned:14067514 PositiveStrandReadsAssigned:209758 NegativeStrandReadsAssigned:14159587 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670994 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670994-trimmed-pair1.fastq SRR12670994-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,980,562 reads, 14,132,886 reads pseudoaligned [quant] estimated average fragment length: 292.022 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR12670994.ke.tsv 34699 SRR12670994.se.tsv 87100 total ==> SRR12670994.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.98 571 20.7742 Potri.005G024800.1.v4.1 1035 743.978 124 10.4722 Potri.004G059700.1.v4.1 961 670.369 9 0.843535 Potri.007G009000.2.v4.1 1416 1124.98 0 0 Potri.003G141000.2.v4.1 2943 2651.98 694 16.4424 Potri.016G087400.1.v4.1 270 74.2045 696 589.323 Potri.015G069301.1.v4.1 564 295.528 0 0 Potri.010G195200.1.v4.1 1773 1481.98 34 1.44149 Potri.012G127500.1.v4.1 977 686.131 358 32.7831 ==> SRR12670994.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 646 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 156 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670994 completed mapping pipeline successfully