Starting /dee2/code/volunteer_pipeline.sh SRR12670995 current disk space = 3051063320576 free memory = 1461954752 SRR12670995 SRAfilesize ba2483e70435b4f742091c93f311fcea SRR12670995.sra SRR12670995.sra file validated SRR12670995 is paired end SRR12670995 is conventional basespace SRR12670995 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.413 37.0 37.0 37.0 37.0 37.0 2 36.4675 37.0 37.0 37.0 37.0 37.0 3 36.5035 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.6365 37.0 37.0 37.0 37.0 37.0 6 36.6495 37.0 37.0 37.0 37.0 37.0 7 36.6505 37.0 37.0 37.0 37.0 37.0 8 36.606 37.0 37.0 37.0 37.0 37.0 9 36.634 37.0 37.0 37.0 37.0 37.0 10-14 36.6133 37.0 37.0 37.0 37.0 37.0 15-19 36.6545 37.0 37.0 37.0 37.0 37.0 20-24 36.586800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.566900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.551300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.533 37.0 37.0 37.0 37.0 37.0 40-44 36.532000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4674 37.0 37.0 37.0 37.0 37.0 50-54 36.4768 37.0 37.0 37.0 37.0 37.0 55-59 36.4615 37.0 37.0 37.0 37.0 37.0 60-64 36.4485 37.0 37.0 37.0 37.0 37.0 65-69 36.3867 37.0 37.0 37.0 37.0 37.0 70-74 36.406600000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.39489999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3192 37.0 37.0 37.0 37.0 37.0 85-89 36.2851 37.0 37.0 37.0 37.0 37.0 90-94 36.322 37.0 37.0 37.0 37.0 37.0 95-99 36.24060000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2967 37.0 37.0 37.0 37.0 37.0 105-109 36.2005 37.0 37.0 37.0 37.0 37.0 110-114 36.2413 37.0 37.0 37.0 37.0 37.0 115-119 36.146899999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.126599999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.1294 37.0 37.0 37.0 37.0 37.0 130-134 35.95569999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.945 37.0 37.0 37.0 37.0 37.0 140-144 35.9126 37.0 37.0 37.0 37.0 37.0 145-149 35.848699999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.655249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 2.0 26 6.0 27 6.0 28 13.0 29 12.0 30 26.0 31 47.0 32 40.0 33 71.0 34 121.0 35 255.0 36 2709.0 37 689.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.575 10.125 5.625 47.675 2 17.075000000000003 13.025 39.625 30.275000000000002 3 17.75 14.05 27.375 40.825 4 22.85 23.375 21.725 32.05 5 22.75 31.924999999999997 24.775 20.549999999999997 6 20.275000000000002 34.375 23.474999999999998 21.875 7 14.2 28.249999999999996 41.225 16.325 8 16.975 25.424999999999997 34.675 22.925 9 18.025 22.95 34.525 24.5 10-14 19.62 30.14 27.865000000000002 22.375 15-19 20.5 28.050000000000004 27.29 24.16 20-24 19.82 28.37 28.18 23.630000000000003 25-29 19.52 28.18 28.02 24.279999999999998 30-34 19.84 28.389999999999997 27.35 24.42 35-39 20.31 27.935 27.384999999999998 24.37 40-44 20.380000000000003 28.565 27.015 24.04 45-49 19.775000000000002 29.025000000000002 27.13 24.07 50-54 20.26 28.810000000000002 27.650000000000002 23.28 55-59 20.335 28.315 27.61 23.74 60-64 19.865 28.23 27.689999999999998 24.215 65-69 20.055 28.49 27.060000000000002 24.395 70-74 19.875 28.444999999999997 27.35 24.33 75-79 20.135 28.01 27.839999999999996 24.015 80-84 20.41 28.389999999999997 27.665 23.535 85-89 19.485 28.244999999999997 28.235 24.035 90-94 20.51 27.76 27.79 23.94 95-99 20.03 27.650000000000002 29.099999999999998 23.22 100-104 19.97 28.78 27.305 23.945 105-109 20.41 28.165000000000003 27.845 23.580000000000002 110-114 20.36 28.439999999999998 28.249999999999996 22.95 115-119 20.200000000000003 28.694999999999997 26.99 24.115000000000002 120-124 20.105 28.244999999999997 27.265 24.385 125-129 20.669999999999998 28.595 26.924999999999997 23.810000000000002 130-134 20.695 28.395 27.715 23.195 135-139 20.96 28.084999999999997 28.025 22.93 140-144 20.96 28.375 27.82 22.845 145-149 20.785 28.34 27.700000000000003 23.175 150-151 21.1625 28.1125 27.3 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 4.0 26 5.5 27 6.5 28 6.5 29 9.0 30 18.0 31 30.5 32 35.5 33 37.5 34 49.0 35 69.0 36 86.5 37 100.0 38 116.5 39 135.0 40 155.5 41 210.0 42 243.0 43 256.0 44 277.0 45 276.0 46 275.0 47 254.0 48 220.5 49 207.5 50 192.0 51 162.5 52 130.5 53 100.0 54 81.0 55 64.5 56 45.5 57 33.5 58 29.5 59 25.0 60 19.5 61 12.0 62 5.0 63 0.5 64 0.5 65 1.0 66 0.5 67 1.0 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.3413821815154 81.375 2 8.52067721343325 15.35 3 0.971412711629198 2.625 4 0.11101859561476549 0.4 5 0.05550929780738274 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTC 5 0.125 No Hit GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.2000000000000002 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.7 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.5875000000000004 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.1624999999999996 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670995 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670995_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.286 37.0 37.0 37.0 37.0 37.0 2 36.2945 37.0 37.0 37.0 37.0 37.0 3 36.2965 37.0 37.0 37.0 37.0 37.0 4 36.362 37.0 37.0 37.0 37.0 37.0 5 36.504 37.0 37.0 37.0 37.0 37.0 6 36.5215 37.0 37.0 37.0 37.0 37.0 7 36.489 37.0 37.0 37.0 37.0 37.0 8 36.3925 37.0 37.0 37.0 37.0 37.0 9 36.4345 37.0 37.0 37.0 37.0 37.0 10-14 36.477399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.451 37.0 37.0 37.0 37.0 37.0 20-24 36.4729 37.0 37.0 37.0 37.0 37.0 25-29 36.3857 37.0 37.0 37.0 37.0 37.0 30-34 36.361599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.272800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.279399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.304500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.277300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.239 37.0 37.0 37.0 37.0 37.0 60-64 36.261300000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2045 37.0 37.0 37.0 37.0 37.0 70-74 36.1639 37.0 37.0 37.0 37.0 37.0 75-79 36.1459 37.0 37.0 37.0 37.0 37.0 80-84 36.1488 37.0 37.0 37.0 37.0 37.0 85-89 36.1102 37.0 37.0 37.0 37.0 37.0 90-94 36.08240000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.0887 37.0 37.0 37.0 37.0 37.0 100-104 36.1275 37.0 37.0 37.0 37.0 37.0 105-109 36.01090000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.9601 37.0 37.0 37.0 37.0 37.0 115-119 35.9679 37.0 37.0 37.0 37.0 37.0 120-124 35.8826 37.0 37.0 37.0 37.0 37.0 125-129 35.8538 37.0 37.0 37.0 37.0 37.0 130-134 35.8806 37.0 37.0 37.0 37.0 37.0 135-139 35.852599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7559 37.0 37.0 37.0 37.0 37.0 145-149 35.5837 37.0 37.0 37.0 37.0 37.0 150-151 35.3085 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 4.0 24 9.0 25 7.0 26 15.0 27 7.0 28 14.0 29 15.0 30 18.0 31 47.0 32 48.0 33 89.0 34 134.0 35 399.0 36 2677.0 37 514.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.75 23.724999999999998 11.35 32.175 2 24.75 25.624999999999996 33.775 15.85 3 19.25 26.55 33.15 21.05 4 23.225 32.75 24.025 20.0 5 25.624999999999996 36.675000000000004 22.125 15.575 6 18.0 41.675000000000004 22.35 17.974999999999998 7 18.75 22.875 39.175 19.2 8 20.05 25.275 30.3 24.375 9 22.0 22.925 32.324999999999996 22.75 10-14 22.13 29.310000000000002 27.794999999999998 20.765 15-19 22.18 28.299999999999997 27.845 21.675 20-24 21.279999999999998 29.349999999999998 28.12 21.25 25-29 22.09 28.515 28.12 21.275 30-34 21.59 29.189999999999998 28.299999999999997 20.919999999999998 35-39 22.48 28.67 28.199999999999996 20.65 40-44 22.645 28.685 28.155 20.515 45-49 22.225 27.99 28.48 21.305 50-54 22.62 28.34 28.175 20.865000000000002 55-59 22.689999999999998 27.52 28.73 21.060000000000002 60-64 22.925 27.655 28.52 20.9 65-69 22.24 27.72 28.38 21.66 70-74 23.49 28.299999999999997 27.750000000000004 20.46 75-79 22.770000000000003 27.575 28.395 21.26 80-84 23.615 27.38 27.36 21.645 85-89 23.13 28.544999999999998 27.639999999999997 20.685000000000002 90-94 22.759999999999998 28.449999999999996 26.99 21.8 95-99 23.255 26.939999999999998 28.599999999999998 21.205 100-104 22.605 28.125 28.105000000000004 21.165 105-109 22.97 28.549999999999997 27.42 21.060000000000002 110-114 23.45 27.839999999999996 28.15 20.560000000000002 115-119 23.25 27.755000000000003 28.02 20.974999999999998 120-124 23.61 27.96 27.935 20.495 125-129 24.075 28.22 27.185 20.52 130-134 23.974999999999998 28.134999999999998 27.42 20.47 135-139 23.919999999999998 27.779999999999998 27.944999999999997 20.355 140-144 24.095 28.249999999999996 27.265 20.39 145-149 24.529999999999998 27.99 27.48 20.0 150-151 24.224999999999998 28.675 26.900000000000002 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 3.5 23 4.0 24 6.0 25 7.0 26 4.5 27 6.5 28 12.0 29 16.0 30 20.0 31 28.0 32 35.5 33 41.5 34 51.0 35 69.5 36 94.0 37 115.0 38 148.0 39 186.0 40 198.5 41 219.0 42 253.0 43 271.5 44 282.5 45 275.0 46 262.0 47 237.0 48 202.5 49 185.0 50 157.5 51 139.0 52 124.0 53 89.5 54 63.0 55 45.5 56 36.0 57 30.5 58 22.0 59 20.0 60 13.5 61 3.0 62 4.0 63 3.5 64 2.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.31093836757357 81.325 2 8.578567462520821 15.45 3 0.8883953359244865 2.4 4 0.1943364797334814 0.7000000000000001 5 0.027762354247640203 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.2000000000000002 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.7 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.5875000000000004 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.1624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584891 spots for SRR12670995.sra Written 584891 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra Read 584890 spots for SRR12670995.sra Written 584890 spots for SRR12670995.sra SRR ids: ['SRR12670995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_612o962k SRR12670995.sra spots: 11697801 blocks: [[1, 584890], [584891, 1169780], [1169781, 1754670], [1754671, 2339560], [2339561, 2924450], [2924451, 3509340], [3509341, 4094230], [4094231, 4679120], [4679121, 5264010], [5264011, 5848900], [5848901, 6433790], [6433791, 7018680], [7018681, 7603570], [7603571, 8188460], [8188461, 8773350], [8773351, 9358240], [9358241, 9943130], [9943131, 10528020], [10528021, 11112910], [11112911, 11697801]] SRR12670995 file size 3953724 SRR12670995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670995 SRR12670995_1.fastq SRR12670995_2.fastq Input file: SRR12670995_1.fastq Paired file: SRR12670995_2.fastq trimmed: SRR12670995-trimmed-pair1.fastq, SRR12670995-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:09:49 2025 >> started Tue Feb 11 12:10:02 2025 >> done (13.420s) 11697801 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 3146 ( 0.03%) empty read pairs filtered out after trimming by size control 11694610 (99.97%) read pairs available; of these: 604101 ( 5.17%) trimmed read pairs available after processing 11090509 (94.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 5 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 7 0.00% 29 3 0.00% 30 6 0.00% 31 8 0.00% 32 9 0.00% 33 6 0.00% 34 6 0.00% 35 6 0.00% 36 9 0.00% 37 10 0.00% 38 8 0.00% 39 5 0.00% 40 13 0.00% 41 11 0.00% 42 16 0.00% 43 6 0.00% 44 16 0.00% 45 6 0.00% 46 17 0.00% 47 15 0.00% 48 21 0.00% 49 24 0.00% 50 31 0.00% 51 21 0.00% 52 33 0.00% 53 34 0.00% 54 32 0.00% 55 49 0.00% 56 42 0.00% 57 54 0.00% 58 66 0.00% 59 44 0.00% 60 62 0.00% 61 78 0.00% 62 96 0.00% 63 114 0.00% 64 138 0.00% 65 150 0.00% 66 146 0.00% 67 187 0.00% 68 158 0.00% 69 216 0.00% 70 248 0.00% 71 312 0.00% 72 321 0.00% 73 321 0.00% 74 376 0.00% 75 434 0.00% 76 521 0.00% 77 542 0.00% 78 614 0.01% 79 637 0.01% 80 695 0.01% 81 764 0.01% 82 866 0.01% 83 969 0.01% 84 1073 0.01% 85 1229 0.01% 86 1370 0.01% 87 1435 0.01% 88 1567 0.01% 89 1624 0.01% 90 1850 0.02% 91 2076 0.02% 92 2138 0.02% 93 2411 0.02% 94 2472 0.02% 95 2749 0.02% 96 2849 0.02% 97 3082 0.03% 98 3166 0.03% 99 3329 0.03% 100 3655 0.03% 101 3661 0.03% 102 4060 0.03% 103 4242 0.04% 104 4346 0.04% 105 4731 0.04% 106 5010 0.04% 107 5354 0.05% 108 5302 0.05% 109 5662 0.05% 110 5859 0.05% 111 5989 0.05% 112 6345 0.05% 113 6425 0.05% 114 6933 0.06% 115 7209 0.06% 116 7535 0.06% 117 7818 0.07% 118 8287 0.07% 119 8251 0.07% 120 8836 0.08% 121 9122 0.08% 122 9235 0.08% 123 9552 0.08% 124 9971 0.09% 125 10263 0.09% 126 10775 0.09% 127 11305 0.10% 128 11479 0.10% 129 11738 0.10% 130 12347 0.11% 131 12396 0.11% 132 12831 0.11% 133 13180 0.11% 134 13750 0.12% 135 13999 0.12% 136 14275 0.12% 137 14774 0.13% 138 15246 0.13% 139 15953 0.14% 140 16364 0.14% 141 16711 0.14% 142 17378 0.15% 143 17143 0.15% 144 17754 0.15% 145 18186 0.16% 146 18440 0.16% 147 19219 0.16% 148 19814 0.17% 149 20041 0.17% 150 21300 0.18% 151 11090509 94.83% 11694610 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=129.85 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=14.5 sequence=CTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATTCC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=27 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=62.51 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.7 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12670995 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:10:46 Started mapping on | Feb 11 12:10:46 Finished on | Feb 11 12:12:11 Mapping speed, Million of reads per hour | 495.30 Number of input reads | 11694610 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11075353 Uniquely mapped reads % | 94.70% Average mapped length | 298.44 Number of splices: Total | 11059180 Number of splices: Annotated (sjdb) | 10840118 Number of splices: GT/AG | 10847295 Number of splices: GC/AG | 176634 Number of splices: AT/AC | 6831 Number of splices: Non-canonical | 28420 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304649 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 20904 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 314608 314608 314608 N_multimapping 304649 304649 304649 N_noFeature 377433 10935522 423468 N_ambiguous 165585 505 71527 UnstrandedReadsAssigned:10532335 PositiveStrandReadsAssigned:139326 NegativeStrandReadsAssigned:10580358 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670995 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670995-trimmed-pair1.fastq SRR12670995-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,694,610 reads, 10,577,678 reads pseudoaligned [quant] estimated average fragment length: 287.11 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR12670995.ke.tsv 34699 SRR12670995.se.tsv 87100 total ==> SRR12670995.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.89 391 20.0801 Potri.005G024800.1.v4.1 1035 748.89 139 16.5084 Potri.004G059700.1.v4.1 961 675.127 23 3.03006 Potri.007G009000.2.v4.1 1416 1129.89 0 0 Potri.003G141000.2.v4.1 2943 2656.89 575 19.2488 Potri.016G087400.1.v4.1 270 71.6425 534 662.948 Potri.015G069301.1.v4.1 564 295.713 0 0 Potri.010G195200.1.v4.1 1773 1486.89 15 0.897266 Potri.012G127500.1.v4.1 977 691.023 352 45.3063 ==> SRR12670995.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 382 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 123 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR12670995 completed mapping pipeline successfully