Starting /dee2/code/volunteer_pipeline.sh SRR12670996 current disk space = 3051376934912 free memory = 1348068004 SRR12670996 SRAfilesize 62fe9d077702ee36e8e2feb3d32ebeea SRR12670996.sra SRR12670996.sra file validated SRR12670996 is paired end SRR12670996 is conventional basespace SRR12670996 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4 37.0 37.0 37.0 37.0 37.0 2 36.371 37.0 37.0 37.0 37.0 37.0 3 36.542 37.0 37.0 37.0 37.0 37.0 4 36.4705 37.0 37.0 37.0 37.0 37.0 5 36.676 37.0 37.0 37.0 37.0 37.0 6 36.5535 37.0 37.0 37.0 37.0 37.0 7 36.61 37.0 37.0 37.0 37.0 37.0 8 36.5155 37.0 37.0 37.0 37.0 37.0 9 36.686 37.0 37.0 37.0 37.0 37.0 10-14 36.5958 37.0 37.0 37.0 37.0 37.0 15-19 36.5732 37.0 37.0 37.0 37.0 37.0 20-24 36.5121 37.0 37.0 37.0 37.0 37.0 25-29 36.4944 37.0 37.0 37.0 37.0 37.0 30-34 36.474599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4858 37.0 37.0 37.0 37.0 37.0 40-44 36.4488 37.0 37.0 37.0 37.0 37.0 45-49 36.45380000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.4372 37.0 37.0 37.0 37.0 37.0 55-59 36.3755 37.0 37.0 37.0 37.0 37.0 60-64 36.3563 37.0 37.0 37.0 37.0 37.0 65-69 36.35510000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3202 37.0 37.0 37.0 37.0 37.0 75-79 36.258500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.24849999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2008 37.0 37.0 37.0 37.0 37.0 90-94 36.2269 37.0 37.0 37.0 37.0 37.0 95-99 36.2142 37.0 37.0 37.0 37.0 37.0 100-104 36.1178 37.0 37.0 37.0 37.0 37.0 105-109 36.1245 37.0 37.0 37.0 37.0 37.0 110-114 36.1341 37.0 37.0 37.0 37.0 37.0 115-119 36.0351 37.0 37.0 37.0 37.0 37.0 120-124 36.052499999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.969 37.0 37.0 37.0 37.0 37.0 130-134 35.84740000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.887100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.843399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.67035 37.0 37.0 37.0 37.0 37.0 150-151 35.49 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.0 23 2.0 24 1.0 25 5.0 26 4.0 27 3.0 28 11.0 29 30.0 30 35.0 31 39.0 32 55.0 33 73.0 34 99.0 35 305.0 36 2705.0 37 627.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.948974487243625 9.779889944972487 4.652326163081541 37.618809404702354 2 18.0 10.375 40.275 31.35 3 16.725 15.2 29.075 39.0 4 23.05 21.8 25.2 29.95 5 24.55 29.549999999999997 24.474999999999998 21.425 6 18.325 34.55 23.025000000000002 24.099999999999998 7 15.375 27.650000000000002 40.45 16.525000000000002 8 16.3 27.575 33.35 22.775000000000002 9 17.2 23.200000000000003 35.25 24.349999999999998 10-14 19.64 30.520000000000003 28.139999999999997 21.7 15-19 19.595000000000002 27.35 28.605000000000004 24.45 20-24 21.029999999999998 27.775 28.105000000000004 23.09 25-29 19.794999999999998 27.744999999999997 28.605000000000004 23.855 30-34 19.85 28.294999999999998 27.845 24.01 35-39 20.585 28.01 28.000000000000004 23.405 40-44 20.365 27.950000000000003 28.51 23.175 45-49 20.315 29.28 27.644999999999996 22.759999999999998 50-54 20.24 28.43 27.675 23.655 55-59 20.155 28.08 28.165000000000003 23.599999999999998 60-64 20.27 27.744999999999997 28.08 23.905 65-69 20.724999999999998 28.360000000000003 27.72 23.195 70-74 20.095 28.615000000000002 28.185 23.105 75-79 20.45 28.585 27.089999999999996 23.875 80-84 20.26 27.61 28.360000000000003 23.77 85-89 20.645 27.82 27.944999999999997 23.59 90-94 20.330000000000002 28.060000000000002 27.42 24.19 95-99 20.365 28.54 28.515 22.58 100-104 20.419999999999998 28.895 27.43 23.255 105-109 20.605 28.205000000000002 27.575 23.615 110-114 20.885 28.525 27.01 23.580000000000002 115-119 21.04 28.720000000000002 27.310000000000002 22.93 120-124 20.855 28.439999999999998 27.200000000000003 23.505000000000003 125-129 21.04 27.894999999999996 27.529999999999998 23.535 130-134 20.3 27.884999999999998 27.634999999999998 24.18 135-139 21.04 28.235 27.12 23.605 140-144 20.555 28.294999999999998 27.744999999999997 23.405 145-149 20.930232558139537 28.43710927731933 26.776694173543387 23.85596399099775 150-151 20.2625 28.4125 27.987499999999997 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 3.5 26 9.0 27 8.0 28 7.0 29 12.0 30 20.0 31 32.0 32 34.0 33 34.5 34 53.5 35 65.5 36 76.5 37 95.0 38 124.5 39 160.5 40 184.0 41 206.0 42 230.5 43 248.0 44 258.5 45 283.5 46 280.5 47 255.0 48 241.5 49 213.5 50 183.0 51 144.5 52 117.5 53 102.0 54 79.0 55 61.5 56 44.0 57 32.5 58 24.0 59 22.5 60 19.0 61 9.5 62 5.5 63 3.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.40906578220012 81.77499999999999 2 8.65118850193477 15.65 3 0.9121061359867331 2.475 4 0.027639579878385848 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4625000000000004 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.4749999999999996 0.0 0.0 0.0 0.0 130-131 3.7874999999999996 0.0 0.0 0.0 0.0 132-133 4.2 0.0 0.0 0.0 0.0 134-135 4.525 0.0 0.0 0.0 0.0 136-137 4.8 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12670996 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670996_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2025 37.0 37.0 37.0 37.0 37.0 2 36.0685 37.0 37.0 37.0 37.0 37.0 3 36.218 37.0 37.0 37.0 37.0 37.0 4 36.2945 37.0 37.0 37.0 37.0 37.0 5 36.3915 37.0 37.0 37.0 37.0 37.0 6 36.31 37.0 37.0 37.0 37.0 37.0 7 36.342 37.0 37.0 37.0 37.0 37.0 8 36.3685 37.0 37.0 37.0 37.0 37.0 9 36.3875 37.0 37.0 37.0 37.0 37.0 10-14 36.42999999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.3797 37.0 37.0 37.0 37.0 37.0 20-24 36.381600000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.3611 37.0 37.0 37.0 37.0 37.0 30-34 36.3184 37.0 37.0 37.0 37.0 37.0 35-39 36.2604 37.0 37.0 37.0 37.0 37.0 40-44 36.2348 37.0 37.0 37.0 37.0 37.0 45-49 36.2034 37.0 37.0 37.0 37.0 37.0 50-54 36.21169999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.1794 37.0 37.0 37.0 37.0 37.0 60-64 36.195800000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.1652 37.0 37.0 37.0 37.0 37.0 70-74 36.1626 37.0 37.0 37.0 37.0 37.0 75-79 36.1041 37.0 37.0 37.0 37.0 37.0 80-84 36.1055 37.0 37.0 37.0 37.0 37.0 85-89 36.0081 37.0 37.0 37.0 37.0 37.0 90-94 36.07039999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.067899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.98909999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9135 37.0 37.0 37.0 37.0 37.0 110-114 35.95870000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.94415 37.0 37.0 37.0 37.0 37.0 120-124 35.8183 37.0 37.0 37.0 37.0 37.0 125-129 35.7737 37.0 37.0 37.0 37.0 37.0 130-134 35.7501 37.0 37.0 37.0 37.0 37.0 135-139 35.684 37.0 37.0 37.0 37.0 37.0 140-144 35.537150000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.3501 37.0 37.0 37.0 37.0 37.0 150-151 35.033500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 4.0 16 0.0 17 1.0 18 1.0 19 1.0 20 4.0 21 0.0 22 2.0 23 2.0 24 8.0 25 5.0 26 5.0 27 16.0 28 12.0 29 22.0 30 14.0 31 46.0 32 60.0 33 84.0 34 176.0 35 411.0 36 2573.0 37 551.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.05 26.775 7.425 24.75 2 25.85 24.7 34.275 15.174999999999999 3 20.7 26.700000000000003 33.775 18.825 4 23.575 34.65 23.3 18.475 5 23.825 37.724999999999994 21.099999999999998 17.349999999999998 6 20.3 40.050000000000004 22.525000000000002 17.125 7 19.325 22.400000000000002 38.9 19.375 8 19.775000000000002 26.075 29.95 24.2 9 20.674999999999997 24.05 30.275000000000002 25.0 10-14 22.585 29.075 27.284999999999997 21.055 15-19 22.6 28.9 27.525 20.974999999999998 20-24 22.7 27.99 27.91 21.4 25-29 22.895 28.465 27.800000000000004 20.84 30-34 22.85 28.535 27.025 21.59 35-39 21.88 28.505000000000003 28.24 21.375 40-44 22.67 28.57 27.72 21.04 45-49 22.96 28.22 27.650000000000002 21.17 50-54 22.695 28.439999999999998 27.639999999999997 21.224999999999998 55-59 22.775000000000002 28.28 27.705000000000002 21.240000000000002 60-64 22.725 27.67 27.884999999999998 21.72 65-69 22.400000000000002 27.61 28.49 21.5 70-74 22.16 28.660000000000004 27.565 21.615000000000002 75-79 22.400000000000002 28.065 27.595 21.94 80-84 22.74 27.700000000000003 28.060000000000002 21.5 85-89 22.38 27.87 28.315 21.435000000000002 90-94 22.63 27.865000000000002 27.92 21.584999999999997 95-99 23.025000000000002 28.305000000000003 27.54 21.13 100-104 23.455000000000002 27.915 27.334999999999997 21.295 105-109 22.91 28.32 27.575 21.195 110-114 23.095 28.18 28.18 20.544999999999998 115-119 23.628544281642245 28.58428764314647 27.244086612991946 20.543081462219334 120-124 23.43 27.425 27.72 21.425 125-129 23.785 27.51 27.68 21.025 130-134 23.69 28.449999999999996 27.505000000000003 20.355 135-139 24.145 27.435 28.02 20.4 140-144 24.508676301445217 27.45411811771766 27.919187878181727 20.1180177026554 145-149 24.44 27.425 27.245 20.89 150-151 24.712500000000002 28.0625 26.8375 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 2.0 22 3.5 23 3.5 24 2.5 25 2.5 26 4.0 27 4.5 28 6.5 29 12.5 30 12.5 31 18.5 32 27.0 33 37.0 34 59.0 35 77.5 36 88.0 37 111.0 38 144.5 39 172.5 40 216.5 41 227.0 42 227.5 43 268.0 44 283.5 45 263.0 46 260.0 47 263.0 48 234.5 49 192.0 50 159.5 51 139.0 52 116.5 53 80.5 54 55.5 55 47.0 56 43.5 57 39.0 58 23.5 59 17.5 60 16.5 61 10.5 62 6.0 63 5.5 64 3.0 65 0.5 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.66040342636087 82.025 2 8.400110527770103 15.2 3 0.8013263332412269 2.175 4 0.08289582757667864 0.3 5 0.027631942525559547 0.125 6 0.0 0.0 7 0.027631942525559547 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.4749999999999996 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.175 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611605 spots for SRR12670996.sra Written 611605 spots for SRR12670996.sra Read 611617 spots for SRR12670996.sra Written 611617 spots for SRR12670996.sra SRR ids: ['SRR12670996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_te7z7tfe SRR12670996.sra spots: 12232112 blocks: [[1, 611605], [611606, 1223210], [1223211, 1834815], [1834816, 2446420], [2446421, 3058025], [3058026, 3669630], [3669631, 4281235], [4281236, 4892840], [4892841, 5504445], [5504446, 6116050], [6116051, 6727655], [6727656, 7339260], [7339261, 7950865], [7950866, 8562470], [8562471, 9174075], [9174076, 9785680], [9785681, 10397285], [10397286, 11008890], [11008891, 11620495], [11620496, 12232112]] SRR12670996 file size 4135306 SRR12670996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670996 SRR12670996_1.fastq SRR12670996_2.fastq Input file: SRR12670996_1.fastq Paired file: SRR12670996_2.fastq trimmed: SRR12670996-trimmed-pair1.fastq, SRR12670996-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:52:52 2025 >> started Tue Feb 11 11:53:13 2025 >> done (20.686s) 12232112 read pairs processed; of these: 87 ( 0.00%) short read pairs filtered out after trimming by size control 1258 ( 0.01%) empty read pairs filtered out after trimming by size control 12230767 (99.99%) read pairs available; of these: 914054 ( 7.47%) trimmed read pairs available after processing 11316713 (92.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 9 0.00% 21 5 0.00% 22 8 0.00% 23 16 0.00% 24 9 0.00% 25 6 0.00% 26 14 0.00% 27 10 0.00% 28 14 0.00% 29 12 0.00% 30 18 0.00% 31 13 0.00% 32 14 0.00% 33 16 0.00% 34 14 0.00% 35 10 0.00% 36 12 0.00% 37 18 0.00% 38 12 0.00% 39 16 0.00% 40 15 0.00% 41 17 0.00% 42 18 0.00% 43 21 0.00% 44 14 0.00% 45 21 0.00% 46 25 0.00% 47 21 0.00% 48 28 0.00% 49 41 0.00% 50 35 0.00% 51 39 0.00% 52 44 0.00% 53 44 0.00% 54 61 0.00% 55 64 0.00% 56 89 0.00% 57 66 0.00% 58 77 0.00% 59 96 0.00% 60 91 0.00% 61 143 0.00% 62 144 0.00% 63 163 0.00% 64 183 0.00% 65 215 0.00% 66 203 0.00% 67 231 0.00% 68 293 0.00% 69 348 0.00% 70 388 0.00% 71 438 0.00% 72 538 0.00% 73 545 0.00% 74 629 0.01% 75 683 0.01% 76 820 0.01% 77 823 0.01% 78 942 0.01% 79 1066 0.01% 80 1212 0.01% 81 1349 0.01% 82 1446 0.01% 83 1646 0.01% 84 1865 0.02% 85 1946 0.02% 86 2082 0.02% 87 2395 0.02% 88 2456 0.02% 89 2658 0.02% 90 2929 0.02% 91 3017 0.02% 92 3485 0.03% 93 3705 0.03% 94 3990 0.03% 95 4266 0.03% 96 4698 0.04% 97 4758 0.04% 98 5013 0.04% 99 5299 0.04% 100 5579 0.05% 101 5944 0.05% 102 6447 0.05% 103 6646 0.05% 104 6972 0.06% 105 7253 0.06% 106 7739 0.06% 107 8092 0.07% 108 8412 0.07% 109 8744 0.07% 110 9076 0.07% 111 9462 0.08% 112 9885 0.08% 113 10080 0.08% 114 10771 0.09% 115 11045 0.09% 116 11811 0.10% 117 12370 0.10% 118 12850 0.11% 119 12973 0.11% 120 13459 0.11% 121 13920 0.11% 122 14247 0.12% 123 14813 0.12% 124 15263 0.12% 125 15580 0.13% 126 16708 0.14% 127 16926 0.14% 128 17583 0.14% 129 17752 0.15% 130 18541 0.15% 131 19224 0.16% 132 19508 0.16% 133 20308 0.17% 134 20136 0.16% 135 21237 0.17% 136 22009 0.18% 137 22321 0.18% 138 22788 0.19% 139 23958 0.20% 140 23844 0.19% 141 24779 0.20% 142 25280 0.21% 143 25843 0.21% 144 26170 0.21% 145 26734 0.22% 146 27101 0.22% 147 27856 0.23% 148 28903 0.24% 149 29023 0.24% 150 29891 0.24% 151 11316713 92.53% 12230767 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=37 prefix-density=0.41 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=60.70 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.2 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=35 prefix-density=0.55 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=10 fanout-score=27.48 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=10.8 sequence=AAAGAAAAGAAAA SRR12670996 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:53:56 Started mapping on | Feb 11 11:53:56 Finished on | Feb 11 11:55:19 Mapping speed, Million of reads per hour | 530.49 Number of input reads | 12230767 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11559852 Uniquely mapped reads % | 94.51% Average mapped length | 297.12 Number of splices: Total | 11566495 Number of splices: Annotated (sjdb) | 11323341 Number of splices: GT/AG | 11333967 Number of splices: GC/AG | 192931 Number of splices: AT/AC | 7341 Number of splices: Non-canonical | 32256 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269471 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 36866 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 401444 401444 401444 N_multimapping 269471 269471 269471 N_noFeature 443660 11413888 493558 N_ambiguous 168798 619 72440 UnstrandedReadsAssigned:10947394 PositiveStrandReadsAssigned:145345 NegativeStrandReadsAssigned:10993854 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670996 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670996-trimmed-pair1.fastq SRR12670996-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,230,767 reads, 10,961,599 reads pseudoaligned [quant] estimated average fragment length: 272.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR12670996.ke.tsv 34699 SRR12670996.se.tsv 87100 total ==> SRR12670996.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.57 281 13.9186 Potri.005G024800.1.v4.1 1035 763.571 167 18.921 Potri.004G059700.1.v4.1 961 689.9 9 1.12858 Potri.007G009000.2.v4.1 1416 1144.57 0 0 Potri.003G141000.2.v4.1 2943 2671.57 595.462 19.2825 Potri.016G087400.1.v4.1 270 78.7926 439 482.009 Potri.015G069301.1.v4.1 564 309.723 0 0 Potri.010G195200.1.v4.1 1773 1501.57 29 1.67082 Potri.012G127500.1.v4.1 977 705.75 113 13.8517 ==> SRR12670996.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 302 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR12670996 completed mapping pipeline successfully