Starting /dee2/code/volunteer_pipeline.sh SRR12670997 current disk space = 3050735222784 free memory = 1504884156 SRR12670997 SRAfilesize f1588a839a66a9e2c2ee1b14be1989e7 SRR12670997.sra SRR12670997.sra file validated SRR12670997 is paired end SRR12670997 is conventional basespace SRR12670997 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42525 37.0 37.0 37.0 37.0 37.0 2 36.392 37.0 37.0 37.0 37.0 37.0 3 36.6045 37.0 37.0 37.0 37.0 37.0 4 36.611 37.0 37.0 37.0 37.0 37.0 5 36.656 37.0 37.0 37.0 37.0 37.0 6 36.608 37.0 37.0 37.0 37.0 37.0 7 36.651 37.0 37.0 37.0 37.0 37.0 8 36.635 37.0 37.0 37.0 37.0 37.0 9 36.5965 37.0 37.0 37.0 37.0 37.0 10-14 36.5965 37.0 37.0 37.0 37.0 37.0 15-19 36.5827 37.0 37.0 37.0 37.0 37.0 20-24 36.55 37.0 37.0 37.0 37.0 37.0 25-29 36.5146 37.0 37.0 37.0 37.0 37.0 30-34 36.421499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.437400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.383599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.361000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3626 37.0 37.0 37.0 37.0 37.0 55-59 36.3014 37.0 37.0 37.0 37.0 37.0 60-64 36.2578 37.0 37.0 37.0 37.0 37.0 65-69 36.2784 37.0 37.0 37.0 37.0 37.0 70-74 36.2698 37.0 37.0 37.0 37.0 37.0 75-79 36.216100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.178200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1893 37.0 37.0 37.0 37.0 37.0 90-94 36.1168 37.0 37.0 37.0 37.0 37.0 95-99 36.1331 37.0 37.0 37.0 37.0 37.0 100-104 36.0826 37.0 37.0 37.0 37.0 37.0 105-109 36.0827 37.0 37.0 37.0 37.0 37.0 110-114 36.0596 37.0 37.0 37.0 37.0 37.0 115-119 36.0057 37.0 37.0 37.0 37.0 37.0 120-124 35.978300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.95870000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.791900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7761 37.0 37.0 37.0 37.0 37.0 140-144 35.7837 37.0 37.0 37.0 37.0 37.0 145-149 35.6294 37.0 37.0 37.0 37.0 37.0 150-151 35.494 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 7.0 23 4.0 24 2.0 25 6.0 26 8.0 27 9.0 28 16.0 29 21.0 30 35.0 31 38.0 32 61.0 33 83.0 34 109.0 35 272.0 36 2699.0 37 628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.63497623217413 10.75806855141356 7.030272704528397 35.57668251188391 2 19.775000000000002 11.35 36.575 32.300000000000004 3 16.5 15.275 28.95 39.275 4 21.725 21.025 25.7 31.55 5 22.975 29.549999999999997 25.874999999999996 21.6 6 22.275 31.424999999999997 22.925 23.375 7 16.025 28.275 40.45 15.25 8 16.975 27.175 32.675 23.175 9 17.7 24.025 35.575 22.7 10-14 19.78 30.330000000000002 28.349999999999998 21.54 15-19 20.305 27.575 28.294999999999998 23.825 20-24 20.244999999999997 28.26 27.810000000000002 23.685000000000002 25-29 19.825 28.49 27.965 23.72 30-34 19.91 28.77 27.97 23.35 35-39 20.18 28.865000000000002 27.065 23.89 40-44 20.105 28.860000000000003 27.73 23.305 45-49 20.5 28.860000000000003 27.205000000000002 23.435 50-54 20.45 28.505000000000003 27.700000000000003 23.345 55-59 19.885 28.58 27.99 23.544999999999998 60-64 19.650000000000002 28.310000000000002 28.335 23.705000000000002 65-69 20.255000000000003 28.189999999999998 27.875 23.68 70-74 20.380000000000003 28.349999999999998 27.045 24.224999999999998 75-79 20.315 28.165000000000003 27.644999999999996 23.875 80-84 20.71 28.365000000000002 27.400000000000002 23.525 85-89 20.26 28.74 27.845 23.155 90-94 20.57 28.194999999999997 27.655 23.580000000000002 95-99 20.3 28.52 27.315 23.865 100-104 20.54 28.65 27.72 23.09 105-109 20.945 28.575 27.555000000000003 22.925 110-114 20.605 28.470000000000002 27.67 23.255 115-119 20.945 28.83 27.12 23.105 120-124 20.849999999999998 28.685 27.49 22.975 125-129 20.979999999999997 28.02 27.224999999999998 23.775 130-134 21.584999999999997 28.16 26.884999999999998 23.369999999999997 135-139 21.75 27.92 27.334999999999997 22.994999999999997 140-144 21.13 27.944999999999997 27.415 23.51 145-149 21.392139213921393 28.322832283228323 26.777677767776776 23.50735073507351 150-151 20.549999999999997 27.8875 26.8375 24.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.5 3 1.0 4 0.5 5 0.5 6 1.5 7 1.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 2.0 15 2.0 16 2.0 17 1.5 18 0.5 19 1.0 20 1.5 21 1.5 22 2.0 23 2.0 24 2.0 25 4.0 26 5.5 27 6.0 28 9.0 29 14.5 30 21.0 31 27.0 32 32.0 33 40.5 34 59.5 35 71.0 36 72.0 37 97.0 38 135.5 39 158.5 40 185.0 41 203.0 42 195.0 43 204.5 44 248.5 45 272.5 46 274.0 47 273.5 48 245.5 49 219.5 50 178.5 51 143.0 52 134.5 53 101.5 54 83.5 55 70.5 56 48.5 57 41.5 58 30.0 59 20.0 60 13.0 61 6.0 62 4.5 63 5.0 64 3.5 65 1.5 66 2.5 67 2.5 68 2.0 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.3270509977827 81.475 2 8.536585365853659 15.4 3 1.080931263858093 2.9250000000000003 4 0.05543237250554324 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.7874999999999996 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.3375 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAATA 10 0.006830828 145.0 4 TACATTG 10 0.006830828 145.0 9 CAATACA 10 0.006830828 145.0 6 CCACAAT 10 0.006830828 145.0 3 ATACATT 10 0.006830828 145.0 8 >>END_MODULE SRR12670997 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670997_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.277 37.0 37.0 37.0 37.0 37.0 2 36.237 37.0 37.0 37.0 37.0 37.0 3 36.3005 37.0 37.0 37.0 37.0 37.0 4 36.272 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.4365 37.0 37.0 37.0 37.0 37.0 7 36.3865 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.266 37.0 37.0 37.0 37.0 37.0 10-14 36.3181 37.0 37.0 37.0 37.0 37.0 15-19 36.2895 37.0 37.0 37.0 37.0 37.0 20-24 36.3115 37.0 37.0 37.0 37.0 37.0 25-29 36.2575 37.0 37.0 37.0 37.0 37.0 30-34 36.1881 37.0 37.0 37.0 37.0 37.0 35-39 36.1754 37.0 37.0 37.0 37.0 37.0 40-44 36.174600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1756 37.0 37.0 37.0 37.0 37.0 50-54 36.1437 37.0 37.0 37.0 37.0 37.0 55-59 36.1216 37.0 37.0 37.0 37.0 37.0 60-64 36.107 37.0 37.0 37.0 37.0 37.0 65-69 36.1568 37.0 37.0 37.0 37.0 37.0 70-74 36.069599999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0196 37.0 37.0 37.0 37.0 37.0 80-84 36.0025 37.0 37.0 37.0 37.0 37.0 85-89 35.971500000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.0424 37.0 37.0 37.0 37.0 37.0 95-99 36.0075 37.0 37.0 37.0 37.0 37.0 100-104 36.021100000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.886900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8263 37.0 37.0 37.0 37.0 37.0 115-119 35.82715 37.0 37.0 37.0 37.0 37.0 120-124 35.769999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7659 37.0 37.0 37.0 37.0 37.0 130-134 35.7393 37.0 37.0 37.0 37.0 37.0 135-139 35.6627 37.0 37.0 37.0 37.0 37.0 140-144 35.647850000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.4287 37.0 37.0 37.0 37.0 37.0 150-151 35.216499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 3.0 15 2.0 16 3.0 17 1.0 18 2.0 19 1.0 20 2.0 21 5.0 22 6.0 23 4.0 24 5.0 25 5.0 26 9.0 27 21.0 28 10.0 29 17.0 30 25.0 31 39.0 32 38.0 33 72.0 34 177.0 35 367.0 36 2592.0 37 585.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.199999999999996 26.025 8.625 23.150000000000002 2 27.925 24.525 30.825000000000003 16.725 3 19.925 27.900000000000002 33.25 18.925 4 23.0 32.425 24.625 19.950000000000003 5 26.275 35.975 21.375 16.375 6 20.3 39.95 20.575 19.175 7 21.2 24.125 37.625 17.05 8 21.175 25.724999999999998 28.199999999999996 24.9 9 21.65 24.625 30.55 23.175 10-14 22.965 29.270000000000003 26.669999999999998 21.095 15-19 23.565 28.64 26.63 21.165 20-24 22.73 28.785 27.565 20.919999999999998 25-29 23.02 28.725 27.41 20.845 30-34 22.17 28.994999999999997 28.01 20.825 35-39 22.905 28.34 27.495000000000005 21.26 40-44 22.884999999999998 28.235 27.67 21.21 45-49 22.795 28.33 27.735 21.14 50-54 23.169999999999998 27.665 28.175 20.990000000000002 55-59 22.689999999999998 27.965 27.67 21.675 60-64 22.935 27.744999999999997 28.03 21.29 65-69 22.88 27.565 28.144999999999996 21.41 70-74 22.775000000000002 27.735 27.68 21.81 75-79 22.755 27.845 27.82 21.58 80-84 22.525000000000002 28.025 27.584999999999997 21.865000000000002 85-89 23.365 27.72 27.375 21.54 90-94 23.599999999999998 28.015 27.195000000000004 21.19 95-99 22.835 28.050000000000004 28.075 21.04 100-104 23.724999999999998 27.825 27.565 20.885 105-109 23.03 28.08 27.794999999999998 21.095 110-114 24.0 28.139999999999997 27.875 19.985 115-119 23.466173308665432 28.286414320716034 27.66638331916596 20.581029051452575 120-124 24.12 28.084999999999997 27.384999999999998 20.41 125-129 23.849999999999998 28.535 26.935 20.68 130-134 23.830000000000002 27.465 27.73 20.974999999999998 135-139 24.115000000000002 28.575 26.8 20.51 140-144 24.54122706135307 28.41142057102855 26.926346317315865 20.121006050302515 145-149 24.825 27.74 26.345000000000002 21.09 150-151 24.5 28.262500000000003 26.6125 20.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 1.0 8 1.5 9 1.5 10 1.0 11 1.5 12 2.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 1.0 24 2.5 25 1.5 26 3.5 27 10.5 28 12.0 29 10.5 30 15.5 31 22.0 32 34.0 33 53.0 34 69.5 35 67.0 36 76.0 37 110.0 38 128.0 39 146.5 40 166.0 41 201.0 42 251.0 43 262.0 44 282.5 45 283.0 46 252.5 47 239.0 48 224.5 49 194.0 50 166.5 51 145.5 52 118.5 53 95.0 54 79.5 55 62.0 56 44.5 57 41.0 58 27.5 59 20.0 60 18.0 61 10.5 62 5.5 63 5.0 64 3.5 65 2.0 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 1.0 89 1.0 90 0.5 91 1.5 92 1.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42464612822648 81.45 2 8.381903968914793 15.1 3 1.054676658340272 2.85 4 0.05550929780738274 0.2 5 0.05550929780738274 0.25 6 0.02775464890369137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6375 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4749999999999996 0.0 0.0 0.0 0.0 128-129 2.8375000000000004 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885733 spots for SRR12670997.sra Written 885733 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra Read 885731 spots for SRR12670997.sra Written 885731 spots for SRR12670997.sra SRR ids: ['SRR12670997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pd10hc66 SRR12670997.sra spots: 17714622 blocks: [[1, 885731], [885732, 1771462], [1771463, 2657193], [2657194, 3542924], [3542925, 4428655], [4428656, 5314386], [5314387, 6200117], [6200118, 7085848], [7085849, 7971579], [7971580, 8857310], [8857311, 9743041], [9743042, 10628772], [10628773, 11514503], [11514504, 12400234], [12400235, 13285965], [13285966, 14171696], [14171697, 15057427], [15057428, 15943158], [15943159, 16828889], [16828890, 17714622]] SRR12670997 file size 5998503 SRR12670997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670997 SRR12670997_1.fastq SRR12670997_2.fastq Input file: SRR12670997_1.fastq Paired file: SRR12670997_2.fastq trimmed: SRR12670997-trimmed-pair1.fastq, SRR12670997-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:37:50 2025 >> started Tue Feb 11 12:38:09 2025 >> done (19.503s) 17714622 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 18598 ( 0.10%) empty read pairs filtered out after trimming by size control 17695929 (99.89%) read pairs available; of these: 1281768 ( 7.24%) trimmed read pairs available after processing 16414161 (92.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 15 0.00% 21 15 0.00% 22 17 0.00% 23 19 0.00% 24 23 0.00% 25 24 0.00% 26 22 0.00% 27 21 0.00% 28 32 0.00% 29 19 0.00% 30 30 0.00% 31 44 0.00% 32 26 0.00% 33 31 0.00% 34 34 0.00% 35 26 0.00% 36 22 0.00% 37 38 0.00% 38 27 0.00% 39 31 0.00% 40 20 0.00% 41 25 0.00% 42 31 0.00% 43 40 0.00% 44 24 0.00% 45 42 0.00% 46 17 0.00% 47 48 0.00% 48 32 0.00% 49 31 0.00% 50 70 0.00% 51 64 0.00% 52 57 0.00% 53 83 0.00% 54 58 0.00% 55 61 0.00% 56 70 0.00% 57 90 0.00% 58 105 0.00% 59 118 0.00% 60 149 0.00% 61 174 0.00% 62 202 0.00% 63 215 0.00% 64 246 0.00% 65 264 0.00% 66 294 0.00% 67 360 0.00% 68 361 0.00% 69 438 0.00% 70 504 0.00% 71 575 0.00% 72 661 0.00% 73 732 0.00% 74 787 0.00% 75 915 0.01% 76 1028 0.01% 77 1180 0.01% 78 1193 0.01% 79 1358 0.01% 80 1501 0.01% 81 1811 0.01% 82 2024 0.01% 83 2238 0.01% 84 2519 0.01% 85 2843 0.02% 86 3021 0.02% 87 3332 0.02% 88 3530 0.02% 89 3728 0.02% 90 4048 0.02% 91 4521 0.03% 92 4631 0.03% 93 5272 0.03% 94 5605 0.03% 95 6124 0.03% 96 6573 0.04% 97 7016 0.04% 98 7315 0.04% 99 7582 0.04% 100 8108 0.05% 101 8300 0.05% 102 8960 0.05% 103 9517 0.05% 104 10222 0.06% 105 10621 0.06% 106 10959 0.06% 107 11634 0.07% 108 11885 0.07% 109 12385 0.07% 110 12902 0.07% 111 13381 0.08% 112 13888 0.08% 113 14397 0.08% 114 15227 0.09% 115 15812 0.09% 116 16654 0.09% 117 17522 0.10% 118 18037 0.10% 119 18577 0.10% 120 18765 0.11% 121 19332 0.11% 122 20511 0.12% 123 20994 0.12% 124 21781 0.12% 125 22036 0.12% 126 23511 0.13% 127 23617 0.13% 128 24706 0.14% 129 25253 0.14% 130 26009 0.15% 131 26001 0.15% 132 26917 0.15% 133 28203 0.16% 134 29040 0.16% 135 29091 0.16% 136 30404 0.17% 137 30596 0.17% 138 31847 0.18% 139 33062 0.19% 140 33459 0.19% 141 34608 0.20% 142 35385 0.20% 143 35996 0.20% 144 36742 0.21% 145 37801 0.21% 146 38416 0.22% 147 38019 0.21% 148 40144 0.23% 149 39989 0.23% 150 42054 0.24% 151 16414161 92.76% 17695929 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.82 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=87.86 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.3 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.95 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=35.02 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12670997 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:38:53 Started mapping on | Feb 11 12:38:53 Finished on | Feb 11 12:40:57 Mapping speed, Million of reads per hour | 513.75 Number of input reads | 17695929 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16509785 Uniquely mapped reads % | 93.30% Average mapped length | 297.37 Number of splices: Total | 16608578 Number of splices: Annotated (sjdb) | 16301098 Number of splices: GT/AG | 16263491 Number of splices: GC/AG | 293380 Number of splices: AT/AC | 10250 Number of splices: Non-canonical | 41457 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414549 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 39335 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 771595 771595 771595 N_multimapping 414549 414549 414549 N_noFeature 516349 16277098 589460 N_ambiguous 260982 773 101021 UnstrandedReadsAssigned:15732454 PositiveStrandReadsAssigned:231914 NegativeStrandReadsAssigned:15819304 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670997 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670997-trimmed-pair1.fastq SRR12670997-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,695,929 reads, 15,873,969 reads pseudoaligned [quant] estimated average fragment length: 267.066 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12670997.ke.tsv 34699 SRR12670997.se.tsv 87100 total ==> SRR12670997.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.93 337 10.3775 Potri.005G024800.1.v4.1 1035 768.934 137 9.61194 Potri.004G059700.1.v4.1 961 695.044 20 1.55238 Potri.007G009000.2.v4.1 1416 1149.93 0 0 Potri.003G141000.2.v4.1 2943 2676.93 490.661 9.88834 Potri.016G087400.1.v4.1 270 77.0177 659 461.609 Potri.015G069301.1.v4.1 564 310.568 0 0 Potri.010G195200.1.v4.1 1773 1506.93 19 0.680203 Potri.012G127500.1.v4.1 977 710.986 343 26.0263 ==> SRR12670997.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 706 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12670997 completed mapping pipeline successfully