Starting /dee2/code/volunteer_pipeline.sh SRR12670998 current disk space = 3051029630976 free memory = 1467047592 SRR12670998 SRAfilesize d6bf86cc6ea5e41b164c457aa589dee2 SRR12670998.sra SRR12670998.sra file validated SRR12670998 is paired end SRR12670998 is conventional basespace SRR12670998 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.51025 37.0 37.0 37.0 37.0 37.0 2 36.5 37.0 37.0 37.0 37.0 37.0 3 36.447 37.0 37.0 37.0 37.0 37.0 4 36.614 37.0 37.0 37.0 37.0 37.0 5 36.543 37.0 37.0 37.0 37.0 37.0 6 36.6245 37.0 37.0 37.0 37.0 37.0 7 36.4515 37.0 37.0 37.0 37.0 37.0 8 36.621 37.0 37.0 37.0 37.0 37.0 9 36.5805 37.0 37.0 37.0 37.0 37.0 10-14 36.5888 37.0 37.0 37.0 37.0 37.0 15-19 36.5894 37.0 37.0 37.0 37.0 37.0 20-24 36.547000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.488299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4787 37.0 37.0 37.0 37.0 37.0 35-39 36.474 37.0 37.0 37.0 37.0 37.0 40-44 36.445899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4057 37.0 37.0 37.0 37.0 37.0 50-54 36.3995 37.0 37.0 37.0 37.0 37.0 55-59 36.400000000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.339 37.0 37.0 37.0 37.0 37.0 65-69 36.3168 37.0 37.0 37.0 37.0 37.0 70-74 36.314 37.0 37.0 37.0 37.0 37.0 75-79 36.303399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.246500000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.221399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2236 37.0 37.0 37.0 37.0 37.0 95-99 36.2149 37.0 37.0 37.0 37.0 37.0 100-104 36.1747 37.0 37.0 37.0 37.0 37.0 105-109 36.147999999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1479 37.0 37.0 37.0 37.0 37.0 115-119 36.04345000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0668 37.0 37.0 37.0 37.0 37.0 125-129 36.019999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9195 37.0 37.0 37.0 37.0 37.0 135-139 35.90339999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.80499999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7213 37.0 37.0 37.0 37.0 37.0 150-151 35.488749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 0.0 25 4.0 26 4.0 27 8.0 28 12.0 29 14.0 30 29.0 31 53.0 32 55.0 33 74.0 34 114.0 35 289.0 36 2710.0 37 625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.78644661165291 11.652913228307076 4.051012753188297 38.50962740685171 2 17.75 10.85 42.525 28.875 3 17.625 15.85 28.975 37.55 4 22.5 22.275 23.875 31.35 5 22.400000000000002 32.05 25.124999999999996 20.424999999999997 6 18.475 35.125 23.625 22.775000000000002 7 15.375 25.6 41.225 17.8 8 15.55 25.474999999999998 34.625 24.349999999999998 9 16.400000000000002 23.225 37.175000000000004 23.200000000000003 10-14 19.650000000000002 30.0 27.485 22.865 15-19 19.775000000000002 27.779999999999998 28.28 24.165 20-24 19.775000000000002 28.904999999999998 27.655 23.665 25-29 19.56 28.565 27.765 24.11 30-34 19.93 29.375 27.16 23.535 35-39 19.74 28.244999999999997 28.115000000000002 23.9 40-44 19.935 28.689999999999998 27.99 23.385 45-49 20.345 28.605000000000004 27.785 23.265 50-54 19.885 28.74 27.994999999999997 23.380000000000003 55-59 19.900000000000002 28.610000000000003 28.055000000000003 23.435 60-64 20.23 28.455000000000002 27.589999999999996 23.724999999999998 65-69 20.03 28.395 28.23 23.345 70-74 19.98 28.4 27.875 23.745 75-79 19.93 28.360000000000003 27.905 23.805 80-84 19.61 28.38 28.110000000000003 23.9 85-89 20.455000000000002 28.51 27.765 23.27 90-94 20.645 28.084999999999997 27.87 23.400000000000002 95-99 20.01 27.57 28.02 24.4 100-104 19.259999999999998 29.125 27.865000000000002 23.75 105-109 19.905 28.544999999999998 27.955000000000002 23.595 110-114 20.285 28.465 27.915 23.335 115-119 20.46102305115256 28.88144407220361 26.991349567478373 23.666183309165458 120-124 19.555 28.915000000000003 27.68 23.849999999999998 125-129 20.46 28.525 27.18 23.835 130-134 20.715 27.944999999999997 27.589999999999996 23.75 135-139 20.43 28.615000000000002 26.490000000000002 24.465 140-144 20.575 27.644999999999996 27.685 24.095 145-149 20.757075707570756 28.972897289728973 26.707670767076706 23.562356235623565 150-151 20.625 28.799999999999997 26.125 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 1.5 19 2.0 20 1.0 21 0.5 22 0.5 23 1.5 24 3.0 25 3.5 26 5.0 27 5.0 28 5.5 29 15.0 30 23.0 31 27.0 32 37.0 33 47.0 34 50.5 35 67.0 36 83.0 37 91.0 38 115.0 39 151.0 40 196.5 41 236.5 42 254.5 43 255.5 44 271.0 45 282.5 46 266.0 47 257.0 48 244.0 49 212.5 50 172.0 51 134.5 52 109.5 53 91.0 54 71.5 55 51.5 56 42.5 57 32.5 58 21.0 59 18.5 60 13.0 61 6.0 62 6.0 63 6.0 64 3.5 65 1.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.75675675675676 85.8 2 6.45945945945946 11.95 3 0.7027027027027027 1.95 4 0.08108108108108107 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.3 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACGAT 10 0.006830828 145.0 9 TTCTTGG 10 0.006830828 145.0 8 TCTTGGC 10 0.006830828 145.0 9 TTTTTTT 35 0.0035366106 20.714287 105-109 >>END_MODULE SRR12670998 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670998_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.198 37.0 37.0 37.0 37.0 37.0 2 36.216 37.0 37.0 37.0 37.0 37.0 3 36.296 37.0 37.0 37.0 37.0 37.0 4 36.3665 37.0 37.0 37.0 37.0 37.0 5 36.384 37.0 37.0 37.0 37.0 37.0 6 36.4115 37.0 37.0 37.0 37.0 37.0 7 36.3415 37.0 37.0 37.0 37.0 37.0 8 36.381 37.0 37.0 37.0 37.0 37.0 9 36.456 37.0 37.0 37.0 37.0 37.0 10-14 36.433800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3573 37.0 37.0 37.0 37.0 37.0 20-24 36.3488 37.0 37.0 37.0 37.0 37.0 25-29 36.313300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3412 37.0 37.0 37.0 37.0 37.0 35-39 36.281400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.254999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2379 37.0 37.0 37.0 37.0 37.0 50-54 36.1944 37.0 37.0 37.0 37.0 37.0 55-59 36.194900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1837 37.0 37.0 37.0 37.0 37.0 65-69 36.15839999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.1418 37.0 37.0 37.0 37.0 37.0 75-79 36.1017 37.0 37.0 37.0 37.0 37.0 80-84 36.061 37.0 37.0 37.0 37.0 37.0 85-89 36.011649999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.0465 37.0 37.0 37.0 37.0 37.0 95-99 36.0139 37.0 37.0 37.0 37.0 37.0 100-104 35.9959 37.0 37.0 37.0 37.0 37.0 105-109 35.9626 37.0 37.0 37.0 37.0 37.0 110-114 35.9234 37.0 37.0 37.0 37.0 37.0 115-119 35.89875 37.0 37.0 37.0 37.0 37.0 120-124 35.81099999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7383 37.0 37.0 37.0 37.0 37.0 130-134 35.6977 37.0 37.0 37.0 37.0 37.0 135-139 35.6095 37.0 37.0 37.0 37.0 37.0 140-144 35.56595 37.0 37.0 37.0 37.0 37.0 145-149 35.325900000000004 37.0 37.0 37.0 32.2 37.0 150-151 35.04675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 1.0 16 1.0 17 0.0 18 2.0 19 0.0 20 4.0 21 1.0 22 2.0 23 6.0 24 5.0 25 6.0 26 6.0 27 9.0 28 15.0 29 28.0 30 35.0 31 34.0 32 62.0 33 80.0 34 159.0 35 389.0 36 2540.0 37 609.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6 24.25 8.075000000000001 26.075 2 24.3 24.975 36.05 14.674999999999999 3 19.975 27.075 33.95 19.0 4 24.2 34.050000000000004 23.525 18.224999999999998 5 25.025 38.2 21.3 15.475 6 19.725 40.125 22.875 17.275 7 19.400000000000002 21.925 39.574999999999996 19.1 8 19.25 23.625 31.05 26.075 9 21.475 23.925 31.05 23.549999999999997 10-14 23.235 29.205 27.12 20.44 15-19 22.915 28.185 27.865000000000002 21.035 20-24 23.165 28.744999999999997 27.500000000000004 20.59 25-29 22.905 29.195 27.229999999999997 20.669999999999998 30-34 22.55 28.225 28.299999999999997 20.925 35-39 22.46 28.28 28.265 20.995 40-44 22.725 28.439999999999998 28.28 20.555 45-49 23.225 28.060000000000002 28.075 20.64 50-54 22.745 28.215 28.505000000000003 20.535 55-59 23.015 28.13 27.884999999999998 20.97 60-64 23.3 27.150000000000002 28.349999999999998 21.2 65-69 22.905 27.455000000000002 28.665000000000003 20.974999999999998 70-74 22.725 28.055000000000003 27.860000000000003 21.36 75-79 22.545 28.155 27.450000000000003 21.85 80-84 23.064999999999998 27.315 28.4 21.22 85-89 23.44117205860293 28.446422321116057 26.836341817090855 21.27606380319016 90-94 23.56 27.905 28.01 20.525 95-99 23.185 28.389999999999997 27.735 20.69 100-104 23.595 28.46 27.495000000000005 20.45 105-109 23.57 28.505000000000003 27.305 20.62 110-114 23.465 28.24 27.905 20.39 115-119 23.691184559227963 28.88144407220361 27.04635231761588 20.38101905095255 120-124 24.025 28.625 27.175 20.175 125-129 23.82 27.950000000000003 27.275 20.955 130-134 25.235000000000003 27.92 27.245 19.6 135-139 24.63 27.889999999999997 27.639999999999997 19.84 140-144 24.06120306015301 27.611380569028455 27.76638831941597 20.56102805140257 145-149 25.445 27.07 27.61 19.875 150-151 25.650000000000002 27.8625 27.075 19.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.0 6 1.0 7 1.0 8 0.5 9 1.0 10 1.0 11 1.5 12 1.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.5 23 2.5 24 4.0 25 4.0 26 4.5 27 4.5 28 5.5 29 10.0 30 15.0 31 19.5 32 25.5 33 30.5 34 38.0 35 68.0 36 100.5 37 114.5 38 148.5 39 188.5 40 216.5 41 225.0 42 239.0 43 256.5 44 284.0 45 295.5 46 272.0 47 257.5 48 234.0 49 197.0 50 156.0 51 128.0 52 102.0 53 73.5 54 59.5 55 48.5 56 41.0 57 33.5 58 21.5 59 18.0 60 10.0 61 5.5 62 6.5 63 5.0 64 1.5 65 1.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 92.62872628726288 85.45 2 6.558265582655827 12.1 3 0.6775067750677507 1.875 4 0.08130081300813008 0.3 5 0.02710027100271003 0.125 6 0.02710027100271003 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.3375000000000004 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.362500000000001 0.0 0.0 0.0 0.0 134-135 5.637499999999999 0.0 0.0 0.0 0.0 136-137 5.925 0.0 0.0 0.0 0.0 138-139 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTAAG 10 0.006830828 145.0 1 TGACCAG 10 0.006830828 145.0 145 CCAGTAT 10 0.006830828 145.0 8 CAGTATA 10 0.006830828 145.0 9 GCCAGTA 10 0.006830828 145.0 7 ACATTAC 10 0.006830828 145.0 5 CATTACT 10 0.006830828 145.0 6 TTAAGCC 10 0.006830828 145.0 3 TTTAAGC 10 0.006830828 145.0 2 >>END_MODULE Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953634 spots for SRR12670998.sra Written 953634 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra Read 953632 spots for SRR12670998.sra Written 953632 spots for SRR12670998.sra SRR ids: ['SRR12670998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_za__b6b9 SRR12670998.sra spots: 19072642 blocks: [[1, 953632], [953633, 1907264], [1907265, 2860896], [2860897, 3814528], [3814529, 4768160], [4768161, 5721792], [5721793, 6675424], [6675425, 7629056], [7629057, 8582688], [8582689, 9536320], [9536321, 10489952], [10489953, 11443584], [11443585, 12397216], [12397217, 13350848], [13350849, 14304480], [14304481, 15258112], [15258113, 16211744], [16211745, 17165376], [17165377, 18119008], [18119009, 19072642]] SRR12670998 file size 6460017 SRR12670998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670998 SRR12670998_1.fastq SRR12670998_2.fastq Input file: SRR12670998_1.fastq Paired file: SRR12670998_2.fastq trimmed: SRR12670998-trimmed-pair1.fastq, SRR12670998-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:15:19 2025 >> started Tue Feb 11 12:15:41 2025 >> done (21.345s) 19072642 read pairs processed; of these: 159 ( 0.00%) short read pairs filtered out after trimming by size control 2115 ( 0.01%) empty read pairs filtered out after trimming by size control 19070368 (99.99%) read pairs available; of these: 1713066 ( 8.98%) trimmed read pairs available after processing 17357302 (91.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 16 0.00% 20 17 0.00% 21 6 0.00% 22 22 0.00% 23 23 0.00% 24 14 0.00% 25 26 0.00% 26 28 0.00% 27 31 0.00% 28 40 0.00% 29 30 0.00% 30 39 0.00% 31 36 0.00% 32 31 0.00% 33 33 0.00% 34 44 0.00% 35 33 0.00% 36 37 0.00% 37 43 0.00% 38 53 0.00% 39 40 0.00% 40 43 0.00% 41 62 0.00% 42 36 0.00% 43 54 0.00% 44 54 0.00% 45 56 0.00% 46 52 0.00% 47 92 0.00% 48 93 0.00% 49 105 0.00% 50 101 0.00% 51 139 0.00% 52 161 0.00% 53 156 0.00% 54 169 0.00% 55 190 0.00% 56 189 0.00% 57 237 0.00% 58 282 0.00% 59 336 0.00% 60 352 0.00% 61 438 0.00% 62 504 0.00% 63 585 0.00% 64 626 0.00% 65 642 0.00% 66 764 0.00% 67 908 0.00% 68 942 0.00% 69 1128 0.01% 70 1290 0.01% 71 1484 0.01% 72 1639 0.01% 73 1854 0.01% 74 2177 0.01% 75 2355 0.01% 76 2573 0.01% 77 2757 0.01% 78 2985 0.02% 79 3287 0.02% 80 3697 0.02% 81 4046 0.02% 82 4550 0.02% 83 4949 0.03% 84 5272 0.03% 85 5967 0.03% 86 6410 0.03% 87 6905 0.04% 88 7071 0.04% 89 7719 0.04% 90 7939 0.04% 91 8503 0.04% 92 9185 0.05% 93 9919 0.05% 94 10377 0.05% 95 11133 0.06% 96 11677 0.06% 97 12019 0.06% 98 12635 0.07% 99 12908 0.07% 100 13472 0.07% 101 14093 0.07% 102 14682 0.08% 103 15230 0.08% 104 15796 0.08% 105 16760 0.09% 106 17296 0.09% 107 18066 0.09% 108 18502 0.10% 109 19330 0.10% 110 19206 0.10% 111 19744 0.10% 112 20773 0.11% 113 21305 0.11% 114 21734 0.11% 115 23045 0.12% 116 23145 0.12% 117 24582 0.13% 118 24887 0.13% 119 25466 0.13% 120 26093 0.14% 121 26377 0.14% 122 26954 0.14% 123 28010 0.15% 124 28629 0.15% 125 29382 0.15% 126 30840 0.16% 127 31117 0.16% 128 31560 0.17% 129 32642 0.17% 130 32968 0.17% 131 33368 0.17% 132 33906 0.18% 133 35233 0.18% 134 35218 0.18% 135 36397 0.19% 136 37185 0.19% 137 37522 0.20% 138 38542 0.20% 139 39626 0.21% 140 40129 0.21% 141 41058 0.22% 142 41783 0.22% 143 41914 0.22% 144 43214 0.23% 145 43554 0.23% 146 43828 0.23% 147 44273 0.23% 148 45832 0.24% 149 45718 0.24% 150 47644 0.25% 151 17357302 91.02% 19070368 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.17 sequence-density-rank=17 fanout-score=10.05 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=5.6 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGAGGAGAGGGCCATTGTTGCTGCTGCCATTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=22 prefix-density=0.47 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=43.58 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.5 sequence=AAAGAAAAGAAAA SRR12670998 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:16:22 Started mapping on | Feb 11 12:16:22 Finished on | Feb 11 12:18:18 Mapping speed, Million of reads per hour | 591.84 Number of input reads | 19070368 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17891850 Uniquely mapped reads % | 93.82% Average mapped length | 295.85 Number of splices: Total | 17375416 Number of splices: Annotated (sjdb) | 17029705 Number of splices: GT/AG | 17040496 Number of splices: GC/AG | 277526 Number of splices: AT/AC | 11777 Number of splices: Non-canonical | 45617 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507314 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 37245 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671204 671204 671204 N_multimapping 507314 507314 507314 N_noFeature 615471 17705863 692399 N_ambiguous 213371 751 104012 UnstrandedReadsAssigned:17063008 PositiveStrandReadsAssigned:185236 NegativeStrandReadsAssigned:17095439 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670998 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670998-trimmed-pair1.fastq SRR12670998-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,070,368 reads, 17,163,814 reads pseudoaligned [quant] estimated average fragment length: 267.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR12670998.ke.tsv 34699 SRR12670998.se.tsv 87100 total ==> SRR12670998.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.9 413 14.6601 Potri.005G024800.1.v4.1 1035 768.901 209 16.9034 Potri.004G059700.1.v4.1 961 695.109 26 2.32604 Potri.007G009000.2.v4.1 1416 1149.9 0 0 Potri.003G141000.2.v4.1 2943 2676.9 532 12.3588 Potri.016G087400.1.v4.1 270 83.1435 817 611.07 Potri.015G069301.1.v4.1 564 314.125 0 0 Potri.010G195200.1.v4.1 1773 1506.9 11 0.453947 Potri.012G127500.1.v4.1 977 711.029 1022 89.3842 ==> SRR12670998.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670998 completed mapping pipeline successfully