Starting /dee2/code/volunteer_pipeline.sh SRR12670999 current disk space = 3051091283968 free memory = 1209855216 SRR12670999 SRAfilesize f0a2fb112399e870a7e42779c36d2d3f SRR12670999.sra SRR12670999.sra file validated SRR12670999 is paired end SRR12670999 is conventional basespace SRR12670999 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670999_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42775 37.0 37.0 37.0 37.0 37.0 2 36.3685 37.0 37.0 37.0 37.0 37.0 3 36.591 37.0 37.0 37.0 37.0 37.0 4 36.603 37.0 37.0 37.0 37.0 37.0 5 36.601 37.0 37.0 37.0 37.0 37.0 6 36.653 37.0 37.0 37.0 37.0 37.0 7 36.565 37.0 37.0 37.0 37.0 37.0 8 36.5345 37.0 37.0 37.0 37.0 37.0 9 36.6015 37.0 37.0 37.0 37.0 37.0 10-14 36.60940000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.596399999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5287 37.0 37.0 37.0 37.0 37.0 25-29 36.50600000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.437400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.431400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4209 37.0 37.0 37.0 37.0 37.0 45-49 36.435199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.376599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3563 37.0 37.0 37.0 37.0 37.0 60-64 36.342 37.0 37.0 37.0 37.0 37.0 65-69 36.3203 37.0 37.0 37.0 37.0 37.0 70-74 36.2712 37.0 37.0 37.0 37.0 37.0 75-79 36.2558 37.0 37.0 37.0 37.0 37.0 80-84 36.1963 37.0 37.0 37.0 37.0 37.0 85-89 36.169399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1475 37.0 37.0 37.0 37.0 37.0 95-99 36.0796 37.0 37.0 37.0 37.0 37.0 100-104 36.079100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0419 37.0 37.0 37.0 37.0 37.0 110-114 36.0187 37.0 37.0 37.0 37.0 37.0 115-119 36.015100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9503 37.0 37.0 37.0 37.0 37.0 125-129 35.956900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.81570000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.8617 37.0 37.0 37.0 37.0 37.0 140-144 35.7484 37.0 37.0 37.0 37.0 37.0 145-149 35.689699999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.423 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 7.0 22 3.0 23 1.0 24 3.0 25 2.0 26 2.0 27 11.0 28 20.0 29 28.0 30 36.0 31 33.0 32 48.0 33 75.0 34 124.0 35 292.0 36 2656.0 37 657.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.06251562890722 10.802700675168792 5.726431607901975 33.408352088022006 2 18.224999999999998 11.05 37.8 32.925 3 17.7 15.5 29.775000000000002 37.025000000000006 4 23.875 21.575 24.775 29.775000000000002 5 23.200000000000003 30.2 24.725 21.875 6 19.45 33.324999999999996 24.975 22.25 7 15.2 26.55 41.675000000000004 16.575 8 16.0 24.925 34.75 24.325 9 15.950000000000001 22.775000000000002 37.15 24.125 10-14 19.725 29.035 29.195 22.045 15-19 19.81 27.88 28.715000000000003 23.595 20-24 19.235 28.42 28.27 24.075 25-29 20.23 28.665000000000003 27.74 23.365 30-34 19.285 28.285 28.395 24.035 35-39 20.05 28.305000000000003 28.075 23.57 40-44 20.13 28.29 28.76 22.82 45-49 20.064999999999998 28.13 28.53 23.275000000000002 50-54 20.115 28.225 28.17 23.49 55-59 19.52 28.555000000000003 28.110000000000003 23.815 60-64 19.939999999999998 28.410000000000004 28.360000000000003 23.29 65-69 19.759999999999998 27.694999999999997 28.634999999999998 23.91 70-74 20.03 28.249999999999996 28.115000000000002 23.605 75-79 20.125 27.650000000000002 28.38 23.845 80-84 19.805 28.435 28.18 23.580000000000002 85-89 20.84 27.915 27.72 23.525 90-94 19.919999999999998 27.955000000000002 27.77 24.355 95-99 20.285 28.310000000000002 28.18 23.225 100-104 19.985 28.785 27.6 23.630000000000003 105-109 20.794999999999998 28.815 27.32 23.07 110-114 20.71 28.365000000000002 27.715 23.21 115-119 20.51 28.785 27.305 23.400000000000002 120-124 20.565 28.4 27.339999999999996 23.695 125-129 20.74 29.044999999999998 27.134999999999998 23.080000000000002 130-134 20.665 28.9 26.86 23.575 135-139 20.97 28.13 27.495000000000005 23.405 140-144 20.46 27.85 27.79 23.9 145-149 20.86 28.115000000000002 27.1 23.925 150-151 20.875 27.700000000000003 28.299999999999997 23.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 2.0 9 1.5 10 0.0 11 0.5 12 2.0 13 2.0 14 1.5 15 2.5 16 1.5 17 0.5 18 1.0 19 2.5 20 2.0 21 1.0 22 2.0 23 3.5 24 5.0 25 6.5 26 9.5 27 13.5 28 15.5 29 15.5 30 16.0 31 25.0 32 35.0 33 37.0 34 46.0 35 61.0 36 78.0 37 97.5 38 119.0 39 154.5 40 194.5 41 226.5 42 266.5 43 259.0 44 233.5 45 258.5 46 265.0 47 256.5 48 239.5 49 204.5 50 174.0 51 146.0 52 114.0 53 97.0 54 85.0 55 63.0 56 53.0 57 35.0 58 16.5 59 12.0 60 11.5 61 7.0 62 1.5 63 3.5 64 4.0 65 2.5 66 2.5 67 2.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.0362824448786 80.65 2 8.624058051911804 15.45 3 1.0605637733742674 2.85 4 0.22327658386826682 0.8 5 0.055819145967066705 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATATTGGCTCTATAGGCATGAGGAGGAGCTGTGATTTGAGGGTAG 5 0.125 No Hit GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7125000000000004 0.0 0.0 0.0 0.0 132-133 4.112500000000001 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTAT 10 0.006830828 145.0 3 AAAATAA 10 0.006830828 145.0 5 TTTATTT 10 0.006830828 145.0 5 GCCCTTT 15 1.1411342E-4 145.0 1 >>END_MODULE SRR12670999 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670999_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.028 37.0 37.0 37.0 37.0 37.0 2 36.2125 37.0 37.0 37.0 37.0 37.0 3 36.2765 37.0 37.0 37.0 37.0 37.0 4 36.3025 37.0 37.0 37.0 37.0 37.0 5 36.4525 37.0 37.0 37.0 37.0 37.0 6 36.366 37.0 37.0 37.0 37.0 37.0 7 36.2885 37.0 37.0 37.0 37.0 37.0 8 36.384 37.0 37.0 37.0 37.0 37.0 9 36.3995 37.0 37.0 37.0 37.0 37.0 10-14 36.402499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.375299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.322 37.0 37.0 37.0 37.0 37.0 25-29 36.3013 37.0 37.0 37.0 37.0 37.0 30-34 36.250099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2408 37.0 37.0 37.0 37.0 37.0 40-44 36.2134 37.0 37.0 37.0 37.0 37.0 45-49 36.1987 37.0 37.0 37.0 37.0 37.0 50-54 36.1786 37.0 37.0 37.0 37.0 37.0 55-59 36.1942 37.0 37.0 37.0 37.0 37.0 60-64 36.1456 37.0 37.0 37.0 37.0 37.0 65-69 36.1619 37.0 37.0 37.0 37.0 37.0 70-74 36.166399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.104499999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.1255 37.0 37.0 37.0 37.0 37.0 85-89 36.0339 37.0 37.0 37.0 37.0 37.0 90-94 36.0624 37.0 37.0 37.0 37.0 37.0 95-99 36.0391 37.0 37.0 37.0 37.0 37.0 100-104 36.040000000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9175 37.0 37.0 37.0 37.0 37.0 110-114 35.9143 37.0 37.0 37.0 37.0 37.0 115-119 35.8925 37.0 37.0 37.0 37.0 37.0 120-124 35.8515 37.0 37.0 37.0 37.0 37.0 125-129 35.7844 37.0 37.0 37.0 37.0 37.0 130-134 35.77310000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.73909999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.6755 37.0 37.0 37.0 37.0 37.0 145-149 35.40220000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.207 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 1.0 15 0.0 16 1.0 17 0.0 18 2.0 19 6.0 20 2.0 21 5.0 22 1.0 23 8.0 24 5.0 25 10.0 26 8.0 27 8.0 28 13.0 29 15.0 30 30.0 31 35.0 32 55.0 33 75.0 34 142.0 35 343.0 36 2660.0 37 570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.574999999999996 23.474999999999998 9.475 21.475 2 25.8 26.05 31.05 17.1 3 20.5 26.650000000000002 34.8 18.05 4 24.05 33.074999999999996 23.075000000000003 19.8 5 25.025 37.6 21.75 15.625 6 20.225 39.85 22.475 17.45 7 20.025000000000002 22.95 38.6 18.425 8 20.775 25.275 28.349999999999998 25.6 9 21.099999999999998 23.35 31.175000000000004 24.375 10-14 23.61 29.705 26.334999999999997 20.349999999999998 15-19 22.97 28.775000000000002 27.66 20.595 20-24 23.225 28.96 27.169999999999998 20.645 25-29 22.81 28.810000000000002 27.935 20.445 30-34 22.86 28.21 28.54 20.39 35-39 22.93 28.27 27.755000000000003 21.044999999999998 40-44 22.68 28.57 27.905 20.845 45-49 22.965 28.499999999999996 28.115000000000002 20.419999999999998 50-54 22.38 28.305000000000003 27.68 21.634999999999998 55-59 23.195 27.725 27.965 21.115000000000002 60-64 22.93 27.515 28.325 21.23 65-69 22.825 28.165000000000003 28.08 20.93 70-74 23.275000000000002 28.28 27.615000000000002 20.830000000000002 75-79 22.905 28.000000000000004 27.875 21.22 80-84 22.830000000000002 28.04 27.615000000000002 21.515 85-89 23.695 28.02 27.455000000000002 20.830000000000002 90-94 22.865 28.65 27.800000000000004 20.685000000000002 95-99 23.525 27.875 27.55 21.05 100-104 23.935000000000002 28.57 27.21 20.285 105-109 23.97 27.935 27.575 20.52 110-114 23.485 28.935 27.029999999999998 20.549999999999997 115-119 23.56 28.4 27.76 20.28 120-124 24.22 27.894999999999996 27.66 20.225 125-129 23.455000000000002 28.694999999999997 27.615000000000002 20.235 130-134 24.415 29.025000000000002 26.38 20.18 135-139 23.97 27.845 27.279999999999998 20.905 140-144 23.885 28.425 27.089999999999996 20.599999999999998 145-149 24.65 28.82 26.465 20.064999999999998 150-151 24.7 29.1375 26.2125 19.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 2.0 18 2.0 19 2.0 20 1.0 21 1.0 22 2.0 23 2.0 24 1.5 25 3.5 26 4.0 27 4.0 28 9.0 29 16.5 30 20.5 31 22.0 32 31.0 33 47.0 34 56.5 35 78.5 36 95.0 37 103.0 38 133.0 39 157.5 40 200.0 41 242.0 42 241.0 43 250.0 44 283.5 45 284.5 46 269.5 47 250.0 48 223.0 49 201.5 50 157.0 51 117.0 52 98.0 53 84.5 54 78.5 55 60.5 56 40.5 57 29.5 58 20.5 59 17.0 60 10.5 61 6.5 62 6.5 63 6.0 64 4.5 65 3.0 66 1.5 67 1.0 68 1.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.05044843049326 80.325 2 8.492152466367713 15.15 3 1.0650224215246635 2.85 4 0.2522421524663677 0.8999999999999999 5 0.028026905829596414 0.125 6 0.05605381165919283 0.3 7 0.05605381165919283 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.137499999999999 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGCAA 10 0.006830828 145.0 5 >>END_MODULE Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791348 spots for SRR12670999.sra Written 791348 spots for SRR12670999.sra Read 791351 spots for SRR12670999.sra Written 791351 spots for SRR12670999.sra SRR ids: ['SRR12670999.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zcnsh2kj SRR12670999.sra spots: 15826963 blocks: [[1, 791348], [791349, 1582696], [1582697, 2374044], [2374045, 3165392], [3165393, 3956740], [3956741, 4748088], [4748089, 5539436], [5539437, 6330784], [6330785, 7122132], [7122133, 7913480], [7913481, 8704828], [8704829, 9496176], [9496177, 10287524], [10287525, 11078872], [11078873, 11870220], [11870221, 12661568], [12661569, 13452916], [13452917, 14244264], [14244265, 15035612], [15035613, 15826963]] SRR12670999 file size 5356994 SRR12670999 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670999 SRR12670999_1.fastq SRR12670999_2.fastq Input file: SRR12670999_1.fastq Paired file: SRR12670999_2.fastq trimmed: SRR12670999-trimmed-pair1.fastq, SRR12670999-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:09:46 2025 >> started Tue Feb 11 12:10:12 2025 >> done (25.564s) 15826963 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 5575 ( 0.04%) empty read pairs filtered out after trimming by size control 15821281 (99.96%) read pairs available; of these: 1200086 ( 7.59%) trimmed read pairs available after processing 14621195 (92.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 8 0.00% 21 11 0.00% 22 8 0.00% 23 9 0.00% 24 12 0.00% 25 15 0.00% 26 19 0.00% 27 12 0.00% 28 16 0.00% 29 16 0.00% 30 14 0.00% 31 12 0.00% 32 16 0.00% 33 10 0.00% 34 10 0.00% 35 10 0.00% 36 19 0.00% 37 22 0.00% 38 21 0.00% 39 20 0.00% 40 15 0.00% 41 16 0.00% 42 24 0.00% 43 24 0.00% 44 19 0.00% 45 18 0.00% 46 25 0.00% 47 23 0.00% 48 35 0.00% 49 27 0.00% 50 38 0.00% 51 34 0.00% 52 40 0.00% 53 53 0.00% 54 44 0.00% 55 50 0.00% 56 67 0.00% 57 78 0.00% 58 68 0.00% 59 86 0.00% 60 123 0.00% 61 128 0.00% 62 143 0.00% 63 156 0.00% 64 154 0.00% 65 218 0.00% 66 203 0.00% 67 206 0.00% 68 245 0.00% 69 254 0.00% 70 310 0.00% 71 347 0.00% 72 410 0.00% 73 513 0.00% 74 557 0.00% 75 613 0.00% 76 735 0.00% 77 786 0.00% 78 805 0.01% 79 954 0.01% 80 1038 0.01% 81 1228 0.01% 82 1438 0.01% 83 1600 0.01% 84 1790 0.01% 85 1985 0.01% 86 2175 0.01% 87 2303 0.01% 88 2585 0.02% 89 2820 0.02% 90 3059 0.02% 91 3306 0.02% 92 3680 0.02% 93 4079 0.03% 94 4464 0.03% 95 4803 0.03% 96 5148 0.03% 97 5616 0.04% 98 5755 0.04% 99 6373 0.04% 100 6864 0.04% 101 7176 0.05% 102 7753 0.05% 103 8158 0.05% 104 8715 0.06% 105 9137 0.06% 106 9716 0.06% 107 10163 0.06% 108 10759 0.07% 109 11240 0.07% 110 11555 0.07% 111 12345 0.08% 112 12761 0.08% 113 13102 0.08% 114 13843 0.09% 115 14636 0.09% 116 15540 0.10% 117 16176 0.10% 118 16720 0.11% 119 17066 0.11% 120 17935 0.11% 121 18585 0.12% 122 19377 0.12% 123 20038 0.13% 124 21092 0.13% 125 21435 0.14% 126 22494 0.14% 127 23068 0.15% 128 23634 0.15% 129 24449 0.15% 130 25025 0.16% 131 25565 0.16% 132 26517 0.17% 133 26951 0.17% 134 27612 0.17% 135 28330 0.18% 136 29048 0.18% 137 29930 0.19% 138 30920 0.20% 139 31843 0.20% 140 32780 0.21% 141 33144 0.21% 142 34300 0.22% 143 34636 0.22% 144 35532 0.22% 145 36141 0.23% 146 36883 0.23% 147 37751 0.24% 148 38226 0.24% 149 38452 0.24% 150 40793 0.26% 151 14621195 92.41% 15821281 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=26 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=69.03 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=30 prefix-density=0.74 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=24 fanout-score=18.86 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=6.0 sequence=GCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12670999 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:10:53 Started mapping on | Feb 11 12:10:54 Finished on | Feb 11 12:12:53 Mapping speed, Million of reads per hour | 478.63 Number of input reads | 15821281 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14718768 Uniquely mapped reads % | 93.03% Average mapped length | 297.18 Number of splices: Total | 14717462 Number of splices: Annotated (sjdb) | 14411201 Number of splices: GT/AG | 14419714 Number of splices: GC/AG | 248036 Number of splices: AT/AC | 8320 Number of splices: Non-canonical | 41392 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346855 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 50403 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.34% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 755658 755658 755658 N_multimapping 346855 346855 346855 N_noFeature 623539 14526711 690324 N_ambiguous 221194 922 95337 UnstrandedReadsAssigned:13874035 PositiveStrandReadsAssigned:191135 NegativeStrandReadsAssigned:13933107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670999 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670999-trimmed-pair1.fastq SRR12670999-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,821,281 reads, 13,936,304 reads pseudoaligned [quant] estimated average fragment length: 270.975 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR12670999.ke.tsv 34699 SRR12670999.se.tsv 87100 total ==> SRR12670999.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.02 485 18.2373 Potri.005G024800.1.v4.1 1035 765.025 260 22.3391 Potri.004G059700.1.v4.1 961 691.273 10 0.950862 Potri.007G009000.2.v4.1 1416 1146.02 0 0 Potri.003G141000.2.v4.1 2943 2673.02 775.481 19.0693 Potri.016G087400.1.v4.1 270 79.1098 357 296.623 Potri.015G069301.1.v4.1 564 310.664 0 0 Potri.010G195200.1.v4.1 1773 1503.02 96 4.19829 Potri.012G127500.1.v4.1 977 707.148 140 13.0132 ==> SRR12670999.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 185 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12670999 completed mapping pipeline successfully