Starting /dee2/code/volunteer_pipeline.sh SRR12671000 current disk space = 3050613682176 free memory = 1491289100 SRR12671000 SRAfilesize 587cbbf133bfaa9bcb20e054b4f78967 SRR12671000.sra SRR12671000.sra file validated SRR12671000 is paired end SRR12671000 is conventional basespace SRR12671000 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671000_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29225 37.0 37.0 37.0 37.0 37.0 2 36.4325 37.0 37.0 37.0 37.0 37.0 3 36.503 37.0 37.0 37.0 37.0 37.0 4 36.571 37.0 37.0 37.0 37.0 37.0 5 36.6195 37.0 37.0 37.0 37.0 37.0 6 36.6325 37.0 37.0 37.0 37.0 37.0 7 36.5205 37.0 37.0 37.0 37.0 37.0 8 36.585 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.5872 37.0 37.0 37.0 37.0 37.0 15-19 36.59179999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.56419999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.488699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3994 37.0 37.0 37.0 37.0 37.0 35-39 36.447 37.0 37.0 37.0 37.0 37.0 40-44 36.4139 37.0 37.0 37.0 37.0 37.0 45-49 36.376999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.379900000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.400400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3288 37.0 37.0 37.0 37.0 37.0 65-69 36.2977 37.0 37.0 37.0 37.0 37.0 70-74 36.366400000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.259100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2565 37.0 37.0 37.0 37.0 37.0 85-89 36.223 37.0 37.0 37.0 37.0 37.0 90-94 36.1995 37.0 37.0 37.0 37.0 37.0 95-99 36.2281 37.0 37.0 37.0 37.0 37.0 100-104 36.2208 37.0 37.0 37.0 37.0 37.0 105-109 36.126 37.0 37.0 37.0 37.0 37.0 110-114 36.079499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0453 37.0 37.0 37.0 37.0 37.0 120-124 35.9919 37.0 37.0 37.0 37.0 37.0 125-129 36.0139 37.0 37.0 37.0 37.0 37.0 130-134 35.8507 37.0 37.0 37.0 37.0 37.0 135-139 35.818799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8152 37.0 37.0 37.0 37.0 37.0 145-149 35.70399999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.57025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 4.0 25 1.0 26 4.0 27 10.0 28 15.0 29 19.0 30 34.0 31 37.0 32 59.0 33 84.0 34 130.0 35 294.0 36 2704.0 37 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.2353088272068 10.952738184546137 6.351587896974244 41.46036509127281 2 18.7 11.225 36.85 33.225 3 16.8 14.149999999999999 27.575 41.475 4 21.55 22.0 24.575 31.874999999999996 5 22.8 29.275000000000002 26.224999999999998 21.7 6 20.724999999999998 33.050000000000004 22.75 23.474999999999998 7 15.1 26.900000000000002 41.625 16.375 8 16.475 25.7 33.95 23.875 9 17.224999999999998 22.975 35.8 24.0 10-14 18.92 29.38 28.76 22.939999999999998 15-19 18.85 28.185 28.794999999999998 24.169999999999998 20-24 19.35 28.18 28.804999999999996 23.665 25-29 18.98 28.499999999999996 28.485 24.035 30-34 19.91 27.58 27.935 24.575 35-39 19.145 28.775000000000002 27.71 24.37 40-44 19.535 28.525 28.189999999999998 23.75 45-49 19.91 28.615000000000002 27.584999999999997 23.89 50-54 19.665 27.875 28.044999999999998 24.415 55-59 19.950000000000003 28.04 27.73 24.279999999999998 60-64 19.475 28.349999999999998 27.860000000000003 24.315 65-69 19.935 28.105000000000004 28.29 23.669999999999998 70-74 19.835 29.099999999999998 27.095000000000002 23.97 75-79 19.91 28.110000000000003 28.470000000000002 23.51 80-84 19.465 28.349999999999998 28.03 24.154999999999998 85-89 20.57 28.985 26.85 23.595 90-94 20.41 27.49 28.055000000000003 24.044999999999998 95-99 20.26 27.92 27.944999999999997 23.875 100-104 19.965 28.384999999999998 27.765 23.885 105-109 19.939999999999998 28.425 28.005000000000003 23.630000000000003 110-114 20.29 29.085 27.105 23.52 115-119 20.39 27.975 28.185 23.45 120-124 20.415 28.615000000000002 27.845 23.125 125-129 20.044999999999998 28.360000000000003 27.63 23.965 130-134 20.4 28.28 27.97 23.35 135-139 20.825 27.905 27.725 23.544999999999998 140-144 20.24 27.589999999999996 27.905 24.265 145-149 20.5 28.044999999999998 27.794999999999998 23.66 150-151 20.4625 27.925 27.750000000000004 23.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 3.0 24 5.5 25 4.0 26 6.5 27 11.0 28 11.5 29 15.5 30 19.0 31 24.0 32 31.5 33 48.5 34 53.5 35 60.5 36 93.5 37 116.0 38 127.0 39 154.0 40 191.5 41 216.5 42 215.5 43 220.0 44 241.0 45 259.0 46 269.5 47 257.0 48 249.0 49 231.0 50 191.0 51 158.0 52 117.5 53 85.0 54 67.5 55 48.5 56 43.5 57 41.0 58 28.5 59 17.5 60 17.5 61 16.0 62 7.5 63 3.0 64 1.5 65 0.5 66 4.5 67 4.5 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.35667396061268 83.5 2 7.986870897155361 14.6 3 0.5470459518599562 1.5 4 0.10940919037199125 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6000000000000001 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.7999999999999998 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCCC 10 0.006830828 145.0 9 >>END_MODULE SRR12671000 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671000_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.095 37.0 37.0 37.0 37.0 37.0 2 36.3275 37.0 37.0 37.0 37.0 37.0 3 36.19 37.0 37.0 37.0 37.0 37.0 4 36.267 37.0 37.0 37.0 37.0 37.0 5 36.362 37.0 37.0 37.0 37.0 37.0 6 36.354 37.0 37.0 37.0 37.0 37.0 7 36.3635 37.0 37.0 37.0 37.0 37.0 8 36.374 37.0 37.0 37.0 37.0 37.0 9 36.3545 37.0 37.0 37.0 37.0 37.0 10-14 36.352199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3959 37.0 37.0 37.0 37.0 37.0 20-24 36.343 37.0 37.0 37.0 37.0 37.0 25-29 36.235200000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.230599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.209399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1935 37.0 37.0 37.0 37.0 37.0 45-49 36.2167 37.0 37.0 37.0 37.0 37.0 50-54 36.1323 37.0 37.0 37.0 37.0 37.0 55-59 36.1357 37.0 37.0 37.0 37.0 37.0 60-64 36.1272 37.0 37.0 37.0 37.0 37.0 65-69 36.1346 37.0 37.0 37.0 37.0 37.0 70-74 36.098699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0378 37.0 37.0 37.0 37.0 37.0 80-84 36.044599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.956599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9961 37.0 37.0 37.0 37.0 37.0 95-99 35.9928 37.0 37.0 37.0 37.0 37.0 100-104 35.9197 37.0 37.0 37.0 37.0 37.0 105-109 35.85039999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.876099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.9096 37.0 37.0 37.0 37.0 37.0 120-124 35.794399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.767 37.0 37.0 37.0 37.0 37.0 130-134 35.732000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.6444 37.0 37.0 37.0 37.0 37.0 140-144 35.6086 37.0 37.0 37.0 37.0 37.0 145-149 35.4461 37.0 37.0 37.0 37.0 37.0 150-151 35.18 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 0.0 19 2.0 20 1.0 21 6.0 22 2.0 23 2.0 24 3.0 25 6.0 26 7.0 27 8.0 28 18.0 29 17.0 30 26.0 31 37.0 32 60.0 33 108.0 34 177.0 35 420.0 36 2618.0 37 472.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 24.9 10.75 26.474999999999998 2 26.325 26.474999999999998 32.2 15.0 3 20.200000000000003 27.775 32.75 19.275000000000002 4 23.275000000000002 33.925 24.4 18.4 5 26.1 36.199999999999996 21.7 16.0 6 18.7 39.800000000000004 23.025000000000002 18.475 7 20.025000000000002 23.200000000000003 39.175 17.599999999999998 8 19.3 26.625 29.9 24.175 9 21.2 25.924999999999997 29.775000000000002 23.1 10-14 22.2 29.604999999999997 26.974999999999998 21.22 15-19 22.805 28.525 27.395000000000003 21.275 20-24 22.58 29.17 27.295 20.955 25-29 22.095000000000002 28.63 28.525 20.75 30-34 22.56 28.52 27.865000000000002 21.055 35-39 22.415 28.115000000000002 28.03 21.44 40-44 22.3 28.835 28.17 20.695 45-49 22.05 28.32 28.310000000000002 21.32 50-54 22.295 28.849999999999998 28.07 20.785 55-59 22.2 28.405 27.994999999999997 21.4 60-64 22.400000000000002 28.165000000000003 28.255000000000003 21.18 65-69 22.195 27.705000000000002 28.565 21.535 70-74 23.395 28.055000000000003 27.525 21.025 75-79 22.765 28.26 27.82 21.154999999999998 80-84 22.86 28.694999999999997 27.105 21.34 85-89 22.975 28.07 27.889999999999997 21.065 90-94 23.305 28.04 27.705000000000002 20.95 95-99 23.544999999999998 28.115000000000002 27.279999999999998 21.060000000000002 100-104 23.41 28.055000000000003 27.48 21.055 105-109 23.189999999999998 28.275 27.665 20.87 110-114 23.330000000000002 28.505000000000003 27.650000000000002 20.515 115-119 24.060000000000002 27.725 27.73 20.485 120-124 23.65 28.384999999999998 27.685 20.28 125-129 23.599999999999998 28.144999999999996 27.134999999999998 21.12 130-134 23.695 28.435 27.744999999999997 20.125 135-139 23.835 27.805000000000003 27.73 20.630000000000003 140-144 23.755000000000003 27.71 27.794999999999998 20.74 145-149 23.990000000000002 28.9 26.91 20.200000000000003 150-151 24.962500000000002 28.599999999999998 26.924999999999997 19.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 2.5 17 1.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.5 24 7.5 25 11.0 26 9.5 27 7.5 28 8.5 29 11.5 30 22.5 31 29.0 32 36.5 33 46.5 34 54.0 35 77.5 36 95.5 37 114.0 38 137.5 39 176.0 40 218.0 41 230.5 42 235.5 43 263.5 44 289.0 45 265.0 46 243.0 47 235.5 48 218.5 49 193.0 50 159.0 51 120.5 52 101.5 53 87.5 54 64.5 55 51.0 56 38.0 57 32.0 58 24.5 59 14.0 60 13.5 61 10.0 62 6.5 63 8.5 64 6.5 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.38545953360769 83.275 2 7.873799725651577 14.35 3 0.5212620027434842 1.425 4 0.1646090534979424 0.6 5 0.0 0.0 6 0.0 0.0 7 0.054869684499314134 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 7 0.17500000000000002 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6000000000000001 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334920 spots for SRR12671000.sra Written 1334920 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra Read 1334916 spots for SRR12671000.sra Written 1334916 spots for SRR12671000.sra SRR ids: ['SRR12671000.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mlmenat6 SRR12671000.sra spots: 26698324 blocks: [[1, 1334916], [1334917, 2669832], [2669833, 4004748], [4004749, 5339664], [5339665, 6674580], [6674581, 8009496], [8009497, 9344412], [9344413, 10679328], [10679329, 12014244], [12014245, 13349160], [13349161, 14684076], [14684077, 16018992], [16018993, 17353908], [17353909, 18688824], [18688825, 20023740], [20023741, 21358656], [21358657, 22693572], [22693573, 24028488], [24028489, 25363404], [25363405, 26698324]] SRR12671000 file size 9051558 SRR12671000 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671000 SRR12671000_1.fastq SRR12671000_2.fastq Input file: SRR12671000_1.fastq Paired file: SRR12671000_2.fastq trimmed: SRR12671000-trimmed-pair1.fastq, SRR12671000-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:53:36 2025 >> started Tue Feb 11 12:54:07 2025 >> done (30.788s) 26698324 read pairs processed; of these: 126 ( 0.00%) short read pairs filtered out after trimming by size control 4224 ( 0.02%) empty read pairs filtered out after trimming by size control 26693974 (99.98%) read pairs available; of these: 1119355 ( 4.19%) trimmed read pairs available after processing 25574619 (95.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 10 0.00% 21 7 0.00% 22 7 0.00% 23 7 0.00% 24 11 0.00% 25 17 0.00% 26 9 0.00% 27 16 0.00% 28 21 0.00% 29 20 0.00% 30 13 0.00% 31 20 0.00% 32 23 0.00% 33 14 0.00% 34 24 0.00% 35 17 0.00% 36 15 0.00% 37 19 0.00% 38 20 0.00% 39 29 0.00% 40 20 0.00% 41 29 0.00% 42 20 0.00% 43 21 0.00% 44 33 0.00% 45 20 0.00% 46 16 0.00% 47 30 0.00% 48 37 0.00% 49 42 0.00% 50 41 0.00% 51 50 0.00% 52 46 0.00% 53 68 0.00% 54 59 0.00% 55 73 0.00% 56 63 0.00% 57 80 0.00% 58 98 0.00% 59 113 0.00% 60 118 0.00% 61 150 0.00% 62 151 0.00% 63 181 0.00% 64 197 0.00% 65 223 0.00% 66 280 0.00% 67 278 0.00% 68 315 0.00% 69 320 0.00% 70 432 0.00% 71 468 0.00% 72 562 0.00% 73 592 0.00% 74 665 0.00% 75 751 0.00% 76 810 0.00% 77 853 0.00% 78 1053 0.00% 79 1120 0.00% 80 1303 0.00% 81 1397 0.01% 82 1556 0.01% 83 1783 0.01% 84 1869 0.01% 85 2195 0.01% 86 2410 0.01% 87 2682 0.01% 88 2795 0.01% 89 3080 0.01% 90 3273 0.01% 91 3461 0.01% 92 3669 0.01% 93 4159 0.02% 94 4412 0.02% 95 4650 0.02% 96 5120 0.02% 97 5463 0.02% 98 5776 0.02% 99 6221 0.02% 100 6572 0.02% 101 6915 0.03% 102 7283 0.03% 103 7829 0.03% 104 8124 0.03% 105 8492 0.03% 106 9189 0.03% 107 9504 0.04% 108 10018 0.04% 109 10288 0.04% 110 10676 0.04% 111 11027 0.04% 112 11709 0.04% 113 11813 0.04% 114 12525 0.05% 115 13087 0.05% 116 13594 0.05% 117 14312 0.05% 118 15073 0.06% 119 15658 0.06% 120 15927 0.06% 121 16582 0.06% 122 17315 0.06% 123 17934 0.07% 124 18640 0.07% 125 19254 0.07% 126 20139 0.08% 127 20351 0.08% 128 21226 0.08% 129 22040 0.08% 130 22545 0.08% 131 23034 0.09% 132 23797 0.09% 133 24128 0.09% 134 24872 0.09% 135 25775 0.10% 136 26711 0.10% 137 27434 0.10% 138 28468 0.11% 139 29758 0.11% 140 30230 0.11% 141 31179 0.12% 142 32181 0.12% 143 32633 0.12% 144 33810 0.13% 145 34441 0.13% 146 35190 0.13% 147 36147 0.14% 148 37563 0.14% 149 37854 0.14% 150 40431 0.15% 151 25574619 95.81% 26693974 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.20 sequence-density-rank=16 fanout-score=14.55 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=6.9 sequence=TTCTTTCCAATGCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.18 sequence-density-rank=22 fanout-score=18.44 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=4.8 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12671000 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:54:48 Started mapping on | Feb 11 12:54:49 Finished on | Feb 11 12:57:33 Mapping speed, Million of reads per hour | 585.97 Number of input reads | 26693974 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25177935 Uniquely mapped reads % | 94.32% Average mapped length | 298.81 Number of splices: Total | 25116302 Number of splices: Annotated (sjdb) | 24611644 Number of splices: GT/AG | 24619292 Number of splices: GC/AG | 412895 Number of splices: AT/AC | 14260 Number of splices: Non-canonical | 69855 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 612922 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 190542 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 903117 903117 903117 N_multimapping 612922 612922 612922 N_noFeature 1090325 24832726 1191545 N_ambiguous 404654 1622 159845 UnstrandedReadsAssigned:23682956 PositiveStrandReadsAssigned:343587 NegativeStrandReadsAssigned:23826545 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671000 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671000-trimmed-pair1.fastq SRR12671000-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,693,974 reads, 23,772,339 reads pseudoaligned [quant] estimated average fragment length: 293.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR12671000.ke.tsv 34699 SRR12671000.se.tsv 87100 total ==> SRR12671000.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.82 906 19.4961 Potri.005G024800.1.v4.1 1035 742.822 536 26.7976 Potri.004G059700.1.v4.1 961 669.051 0 0 Potri.007G009000.2.v4.1 1416 1123.82 0 0 Potri.003G141000.2.v4.1 2943 2650.82 1732.21 24.2682 Potri.016G087400.1.v4.1 270 69.2763 1254 672.248 Potri.015G069301.1.v4.1 564 290.253 0 0 Potri.010G195200.1.v4.1 1773 1480.82 97 2.43268 Potri.012G127500.1.v4.1 977 684.93 144 7.80787 ==> SRR12671000.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 129 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671000 completed mapping pipeline successfully