Starting /dee2/code/volunteer_pipeline.sh SRR12671001 current disk space = 3050740047872 free memory = 1415736644 SRR12671001 SRAfilesize 445a86e6b00fd116b2293b21b90ecf88 SRR12671001.sra SRR12671001.sra file validated SRR12671001 is paired end SRR12671001 is conventional basespace SRR12671001 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671001_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36875 37.0 37.0 37.0 37.0 37.0 2 36.472 37.0 37.0 37.0 37.0 37.0 3 36.567 37.0 37.0 37.0 37.0 37.0 4 36.5745 37.0 37.0 37.0 37.0 37.0 5 36.7245 37.0 37.0 37.0 37.0 37.0 6 36.6135 37.0 37.0 37.0 37.0 37.0 7 36.617 37.0 37.0 37.0 37.0 37.0 8 36.63 37.0 37.0 37.0 37.0 37.0 9 36.624 37.0 37.0 37.0 37.0 37.0 10-14 36.64820000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6078 37.0 37.0 37.0 37.0 37.0 20-24 36.572900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5058 37.0 37.0 37.0 37.0 37.0 30-34 36.4488 37.0 37.0 37.0 37.0 37.0 35-39 36.4994 37.0 37.0 37.0 37.0 37.0 40-44 36.4577 37.0 37.0 37.0 37.0 37.0 45-49 36.4283 37.0 37.0 37.0 37.0 37.0 50-54 36.4204 37.0 37.0 37.0 37.0 37.0 55-59 36.3961 37.0 37.0 37.0 37.0 37.0 60-64 36.375800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.346199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3334 37.0 37.0 37.0 37.0 37.0 75-79 36.3131 37.0 37.0 37.0 37.0 37.0 80-84 36.2551 37.0 37.0 37.0 37.0 37.0 85-89 36.2211 37.0 37.0 37.0 37.0 37.0 90-94 36.24980000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.21320000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.198 37.0 37.0 37.0 37.0 37.0 105-109 36.1509 37.0 37.0 37.0 37.0 37.0 110-114 36.143499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1092 37.0 37.0 37.0 37.0 37.0 120-124 36.068200000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.039699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8863 37.0 37.0 37.0 37.0 37.0 135-139 35.880900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8191 37.0 37.0 37.0 37.0 37.0 145-149 35.7043 37.0 37.0 37.0 37.0 37.0 150-151 35.55025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 6.0 25 2.0 26 7.0 27 9.0 28 15.0 29 16.0 30 22.0 31 46.0 32 55.0 33 93.0 34 110.0 35 241.0 36 2723.0 37 652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.40680510382787 11.633725293970478 5.654240680510383 40.30522892169127 2 17.75 11.425 39.4 31.424999999999997 3 17.075000000000003 16.075 27.224999999999998 39.625 4 22.900000000000002 22.025 23.849999999999998 31.225 5 24.675 29.175 24.2 21.95 6 22.1 33.85 22.400000000000002 21.65 7 15.575 25.474999999999998 41.825 17.125 8 15.950000000000001 24.175 33.95 25.924999999999997 9 17.275 23.724999999999998 35.65 23.35 10-14 19.994999999999997 29.604999999999997 27.825 22.575 15-19 20.41 27.450000000000003 28.165000000000003 23.974999999999998 20-24 20.64 28.305000000000003 27.994999999999997 23.06 25-29 20.244999999999997 28.58 27.415 23.76 30-34 19.865 28.465 27.779999999999998 23.89 35-39 20.9 28.050000000000004 27.555000000000003 23.494999999999997 40-44 19.835 28.78 27.215 24.169999999999998 45-49 20.715 28.199999999999996 27.825 23.26 50-54 20.84 28.17 27.694999999999997 23.294999999999998 55-59 20.525 27.85 27.755000000000003 23.87 60-64 21.02 27.47 27.47 24.04 65-69 20.669999999999998 27.975 28.025 23.330000000000002 70-74 21.035 28.444999999999997 26.955000000000002 23.565 75-79 20.580000000000002 28.050000000000004 27.944999999999997 23.425 80-84 20.369999999999997 28.349999999999998 27.500000000000004 23.78 85-89 20.74 27.634999999999998 27.96 23.665 90-94 20.715 28.43 27.58 23.275000000000002 95-99 20.79 27.305 27.83 24.075 100-104 20.685000000000002 28.265 27.544999999999998 23.505000000000003 105-109 20.805 27.655 28.27 23.27 110-114 20.5 28.565 27.375 23.56 115-119 20.89 28.285 27.21 23.615 120-124 20.8 28.025 27.334999999999997 23.84 125-129 21.21 28.315 26.840000000000003 23.635 130-134 20.635 28.585 26.775 24.005000000000003 135-139 21.395 27.884999999999998 26.979999999999997 23.74 140-144 21.05 27.805000000000003 26.875 24.27 145-149 20.685000000000002 28.24 26.765 24.310000000000002 150-151 19.950000000000003 27.462500000000002 27.1375 25.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 3.5 24 5.0 25 4.5 26 7.5 27 8.0 28 9.0 29 11.0 30 11.5 31 20.0 32 31.5 33 38.0 34 50.0 35 71.5 36 89.0 37 103.0 38 116.5 39 134.0 40 165.0 41 199.5 42 214.5 43 225.5 44 267.0 45 288.5 46 270.0 47 241.0 48 223.5 49 208.0 50 196.0 51 169.0 52 126.0 53 106.5 54 86.5 55 71.0 56 55.0 57 41.0 58 32.5 59 28.5 60 21.0 61 12.0 62 9.5 63 5.0 64 3.5 65 2.5 66 4.0 67 4.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.6 #Duplication Level Percentage of deduplicated Percentage of total 1 88.57223476297969 78.475 2 10.186230248306998 18.05 3 1.072234762979684 2.85 4 0.14108352144469527 0.5 5 0.02821670428893905 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 5.1375 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAGG 10 0.006830828 145.0 9 GTTTATA 10 0.006830828 145.0 6 TTTATAA 10 0.006830828 145.0 7 GTAGTTT 15 1.1411342E-4 145.0 3 ATATAGG 10 0.006830828 145.0 145 >>END_MODULE SRR12671001 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671001_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2955 37.0 37.0 37.0 37.0 37.0 2 36.3535 37.0 37.0 37.0 37.0 37.0 3 36.305 37.0 37.0 37.0 37.0 37.0 4 36.4385 37.0 37.0 37.0 37.0 37.0 5 36.4875 37.0 37.0 37.0 37.0 37.0 6 36.4445 37.0 37.0 37.0 37.0 37.0 7 36.414 37.0 37.0 37.0 37.0 37.0 8 36.4235 37.0 37.0 37.0 37.0 37.0 9 36.493 37.0 37.0 37.0 37.0 37.0 10-14 36.5106 37.0 37.0 37.0 37.0 37.0 15-19 36.453599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.46849999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.3845 37.0 37.0 37.0 37.0 37.0 30-34 36.3672 37.0 37.0 37.0 37.0 37.0 35-39 36.3867 37.0 37.0 37.0 37.0 37.0 40-44 36.368700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3443 37.0 37.0 37.0 37.0 37.0 50-54 36.2818 37.0 37.0 37.0 37.0 37.0 55-59 36.235800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.265 37.0 37.0 37.0 37.0 37.0 65-69 36.2352 37.0 37.0 37.0 37.0 37.0 70-74 36.2702 37.0 37.0 37.0 37.0 37.0 75-79 36.1413 37.0 37.0 37.0 37.0 37.0 80-84 36.2192 37.0 37.0 37.0 37.0 37.0 85-89 36.1642 37.0 37.0 37.0 37.0 37.0 90-94 36.1789 37.0 37.0 37.0 37.0 37.0 95-99 36.147000000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1401 37.0 37.0 37.0 37.0 37.0 105-109 36.0538 37.0 37.0 37.0 37.0 37.0 110-114 36.0743 37.0 37.0 37.0 37.0 37.0 115-119 36.09395 37.0 37.0 37.0 37.0 37.0 120-124 35.974999999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.903 37.0 37.0 37.0 37.0 37.0 130-134 35.9117 37.0 37.0 37.0 37.0 37.0 135-139 35.9328 37.0 37.0 37.0 37.0 37.0 140-144 35.85385 37.0 37.0 37.0 37.0 37.0 145-149 35.6238 37.0 37.0 37.0 37.0 37.0 150-151 35.3525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 3.0 23 10.0 24 4.0 25 8.0 26 3.0 27 7.0 28 14.0 29 21.0 30 17.0 31 38.0 32 41.0 33 76.0 34 139.0 35 340.0 36 2632.0 37 638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 24.925 9.3 26.3 2 26.55 26.5 30.85 16.1 3 20.349999999999998 27.750000000000004 33.825 18.075 4 24.725 34.975 22.375 17.925 5 26.650000000000002 37.9 20.575 14.875 6 20.599999999999998 40.025 21.5 17.875 7 20.674999999999997 21.9 37.225 20.200000000000003 8 19.6 26.775 28.9 24.725 9 21.9 25.3 29.975 22.825 10-14 22.91 29.459999999999997 26.784999999999997 20.845 15-19 22.645 28.355000000000004 27.794999999999998 21.205 20-24 22.865 28.895 27.605 20.635 25-29 22.085 28.13 28.835 20.95 30-34 23.24 27.395000000000003 27.694999999999997 21.67 35-39 22.305 28.13 28.015 21.55 40-44 22.400000000000002 28.455000000000002 28.165000000000003 20.979999999999997 45-49 23.155 27.955000000000002 28.13 20.76 50-54 22.835 28.585 27.655 20.925 55-59 22.865 28.199999999999996 27.839999999999996 21.095 60-64 22.915 27.35 28.505000000000003 21.23 65-69 23.73 27.439999999999998 27.6 21.23 70-74 22.715 28.215 27.72 21.349999999999998 75-79 22.91 27.985 27.705000000000002 21.4 80-84 23.3 28.115000000000002 27.11 21.475 85-89 23.0 27.93 27.66 21.41 90-94 23.455000000000002 27.965 27.345000000000002 21.235 95-99 23.150000000000002 27.605 28.16 21.085 100-104 23.7 28.185 27.49 20.625 105-109 23.51 27.76 27.994999999999997 20.735 110-114 23.455000000000002 28.465 27.595 20.485 115-119 24.08120406020301 28.61143057152858 26.491324566228315 20.816040802040103 120-124 23.9 27.29 27.950000000000003 20.86 125-129 24.02 27.894999999999996 27.125 20.96 130-134 24.23 28.095 27.36 20.315 135-139 24.26 27.935 26.985 20.82 140-144 24.031201560078003 27.991399569978498 27.36136806840342 20.616030801540077 145-149 25.230000000000004 27.775 26.71 20.285 150-151 24.9 28.1625 26.974999999999998 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 1.5 15 1.5 16 0.5 17 1.0 18 1.0 19 0.0 20 1.0 21 1.5 22 4.0 23 4.5 24 2.5 25 4.5 26 4.5 27 6.5 28 11.0 29 13.5 30 17.5 31 20.5 32 33.5 33 51.5 34 55.5 35 76.0 36 92.5 37 103.5 38 131.5 39 157.0 40 191.0 41 231.5 42 252.0 43 252.5 44 264.0 45 263.0 46 242.0 47 233.5 48 216.0 49 194.0 50 156.5 51 126.0 52 112.5 53 98.0 54 86.5 55 65.0 56 47.0 57 40.5 58 33.5 59 22.5 60 20.5 61 15.0 62 10.5 63 8.5 64 5.0 65 1.5 66 0.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.275 #Duplication Level Percentage of deduplicated Percentage of total 1 88.7567261399037 78.35 2 10.05380911922968 17.75 3 0.9629000283205892 2.55 4 0.08496176720475786 0.3 5 0.05664117813650524 0.25 6 0.02832058906825262 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05664117813650524 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 14 0.35000000000000003 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 5.1375 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTTC 10 0.006830828 145.0 145 CATCATG 10 0.006830828 145.0 2 GCTATTA 10 0.006830828 145.0 8 CCATCAT 10 0.006830828 145.0 1 ATGCTAT 10 0.006830828 145.0 6 TCATGCT 10 0.006830828 145.0 4 TGCTATT 10 0.006830828 145.0 7 GAACAAA 10 0.006830828 145.0 4 CATGCTA 10 0.006830828 145.0 5 ACCAGTA 10 0.006830828 145.0 7 CTATTAA 10 0.006830828 145.0 9 >>END_MODULE Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726184 spots for SRR12671001.sra Written 726184 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra Read 726174 spots for SRR12671001.sra Written 726174 spots for SRR12671001.sra SRR ids: ['SRR12671001.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_77i660fb SRR12671001.sra spots: 14523490 blocks: [[1, 726174], [726175, 1452348], [1452349, 2178522], [2178523, 2904696], [2904697, 3630870], [3630871, 4357044], [4357045, 5083218], [5083219, 5809392], [5809393, 6535566], [6535567, 7261740], [7261741, 7987914], [7987915, 8714088], [8714089, 9440262], [9440263, 10166436], [10166437, 10892610], [10892611, 11618784], [11618785, 12344958], [12344959, 13071132], [13071133, 13797306], [13797307, 14523490]] SRR12671001 file size 4914016 SRR12671001 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671001 SRR12671001_1.fastq SRR12671001_2.fastq Input file: SRR12671001_1.fastq Paired file: SRR12671001_2.fastq trimmed: SRR12671001-trimmed-pair1.fastq, SRR12671001-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:35:08 2025 >> started Tue Feb 11 12:35:24 2025 >> done (15.591s) 14523490 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 2776 ( 0.02%) empty read pairs filtered out after trimming by size control 14520601 (99.98%) read pairs available; of these: 1371148 ( 9.44%) trimmed read pairs available after processing 13149453 (90.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 9 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 10 0.00% 25 6 0.00% 26 8 0.00% 27 8 0.00% 28 10 0.00% 29 9 0.00% 30 8 0.00% 31 6 0.00% 32 11 0.00% 33 10 0.00% 34 12 0.00% 35 14 0.00% 36 12 0.00% 37 20 0.00% 38 15 0.00% 39 11 0.00% 40 14 0.00% 41 15 0.00% 42 13 0.00% 43 11 0.00% 44 15 0.00% 45 12 0.00% 46 23 0.00% 47 13 0.00% 48 26 0.00% 49 23 0.00% 50 31 0.00% 51 37 0.00% 52 49 0.00% 53 50 0.00% 54 48 0.00% 55 57 0.00% 56 55 0.00% 57 68 0.00% 58 98 0.00% 59 123 0.00% 60 143 0.00% 61 159 0.00% 62 157 0.00% 63 211 0.00% 64 225 0.00% 65 245 0.00% 66 252 0.00% 67 317 0.00% 68 381 0.00% 69 416 0.00% 70 490 0.00% 71 534 0.00% 72 665 0.00% 73 713 0.00% 74 863 0.01% 75 1002 0.01% 76 1064 0.01% 77 1116 0.01% 78 1260 0.01% 79 1408 0.01% 80 1721 0.01% 81 1850 0.01% 82 2163 0.01% 83 2166 0.01% 84 2607 0.02% 85 2870 0.02% 86 3187 0.02% 87 3419 0.02% 88 3777 0.03% 89 3895 0.03% 90 4292 0.03% 91 4627 0.03% 92 4796 0.03% 93 5565 0.04% 94 5899 0.04% 95 6661 0.05% 96 6816 0.05% 97 7296 0.05% 98 7695 0.05% 99 8116 0.06% 100 8655 0.06% 101 8916 0.06% 102 9490 0.07% 103 10087 0.07% 104 10650 0.07% 105 11123 0.08% 106 11825 0.08% 107 12480 0.09% 108 12680 0.09% 109 13413 0.09% 110 13714 0.09% 111 14440 0.10% 112 14949 0.10% 113 15181 0.10% 114 16230 0.11% 115 16962 0.12% 116 17820 0.12% 117 18353 0.13% 118 19434 0.13% 119 19745 0.14% 120 21098 0.15% 121 21310 0.15% 122 22032 0.15% 123 22860 0.16% 124 23598 0.16% 125 24320 0.17% 126 25202 0.17% 127 25715 0.18% 128 27071 0.19% 129 27331 0.19% 130 28330 0.20% 131 28342 0.20% 132 29378 0.20% 133 30117 0.21% 134 30946 0.21% 135 31368 0.22% 136 32491 0.22% 137 32972 0.23% 138 33909 0.23% 139 35893 0.25% 140 35951 0.25% 141 37001 0.25% 142 37514 0.26% 143 38151 0.26% 144 39444 0.27% 145 39712 0.27% 146 40712 0.28% 147 41153 0.28% 148 42593 0.29% 149 42157 0.29% 150 44311 0.31% 151 13149453 90.56% 14520601 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.76 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=360.14 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=29 prefix-density=0.85 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=15.41 fanout-score-rank=1 prefix-density=1.45 prefix-fanout=1.2 sequence=CAGCTACACTGATGCAACCCACCAAGGTGGGTGTGCCTTCTAGGACCAGCCTTCAACT SRR12671001 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:36:09 Started mapping on | Feb 11 12:36:09 Finished on | Feb 11 12:37:52 Mapping speed, Million of reads per hour | 507.52 Number of input reads | 14520601 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13455745 Uniquely mapped reads % | 92.67% Average mapped length | 296.38 Number of splices: Total | 13448238 Number of splices: Annotated (sjdb) | 13191317 Number of splices: GT/AG | 13174282 Number of splices: GC/AG | 230875 Number of splices: AT/AC | 7559 Number of splices: Non-canonical | 35522 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 349145 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 198056 % of reads mapped to too many loci | 1.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 715711 715711 715711 N_multimapping 349145 349145 349145 N_noFeature 606064 13228742 669808 N_ambiguous 246305 868 82579 UnstrandedReadsAssigned:12603376 PositiveStrandReadsAssigned:226135 NegativeStrandReadsAssigned:12703358 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671001 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671001-trimmed-pair1.fastq SRR12671001-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,520,601 reads, 12,805,854 reads pseudoaligned [quant] estimated average fragment length: 257.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR12671001.ke.tsv 34699 SRR12671001.se.tsv 87100 total ==> SRR12671001.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.97 452.583 15.8533 Potri.005G024800.1.v4.1 1035 778.971 287 22.7395 Potri.004G059700.1.v4.1 961 705.068 5 0.437683 Potri.007G009000.2.v4.1 1416 1159.97 0 0 Potri.003G141000.2.v4.1 2943 2686.97 792.596 18.2058 Potri.016G087400.1.v4.1 270 81.9079 610.748 460.21 Potri.015G069301.1.v4.1 564 320.247 0 0 Potri.010G195200.1.v4.1 1773 1516.97 61 2.48183 Potri.012G127500.1.v4.1 977 720.997 73 6.24899 ==> SRR12671001.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 177 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671001 completed mapping pipeline successfully