Starting /dee2/code/volunteer_pipeline.sh SRR12671002 current disk space = 3050685722624 free memory = 1124753372 SRR12671002 SRAfilesize 456d81a5c1da6865b3ea519ac76b77be SRR12671002.sra SRR12671002.sra file validated SRR12671002 is paired end SRR12671002 is conventional basespace SRR12671002 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671002_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3805 37.0 37.0 37.0 37.0 37.0 2 36.4645 37.0 37.0 37.0 37.0 37.0 3 36.5365 37.0 37.0 37.0 37.0 37.0 4 36.63 37.0 37.0 37.0 37.0 37.0 5 36.6725 37.0 37.0 37.0 37.0 37.0 6 36.646 37.0 37.0 37.0 37.0 37.0 7 36.582 37.0 37.0 37.0 37.0 37.0 8 36.5625 37.0 37.0 37.0 37.0 37.0 9 36.601 37.0 37.0 37.0 37.0 37.0 10-14 36.6474 37.0 37.0 37.0 37.0 37.0 15-19 36.611200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5784 37.0 37.0 37.0 37.0 37.0 25-29 36.5704 37.0 37.0 37.0 37.0 37.0 30-34 36.5559 37.0 37.0 37.0 37.0 37.0 35-39 36.5313 37.0 37.0 37.0 37.0 37.0 40-44 36.5067 37.0 37.0 37.0 37.0 37.0 45-49 36.4557 37.0 37.0 37.0 37.0 37.0 50-54 36.414699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4094 37.0 37.0 37.0 37.0 37.0 60-64 36.3655 37.0 37.0 37.0 37.0 37.0 65-69 36.391799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.418 37.0 37.0 37.0 37.0 37.0 75-79 36.35850000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.319 37.0 37.0 37.0 37.0 37.0 85-89 36.2378 37.0 37.0 37.0 37.0 37.0 90-94 36.26429999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2367 37.0 37.0 37.0 37.0 37.0 100-104 36.232600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1888 37.0 37.0 37.0 37.0 37.0 110-114 36.1785 37.0 37.0 37.0 37.0 37.0 115-119 36.1332 37.0 37.0 37.0 37.0 37.0 120-124 36.09250000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.046200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.846199999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9454 37.0 37.0 37.0 37.0 37.0 140-144 35.8995 37.0 37.0 37.0 37.0 37.0 145-149 35.7539 37.0 37.0 37.0 37.0 37.0 150-151 35.6055 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 2.0 26 6.0 27 9.0 28 17.0 29 25.0 30 19.0 31 36.0 32 44.0 33 71.0 34 112.0 35 287.0 36 2686.0 37 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05 10.625 5.225 43.1 2 17.299999999999997 11.15 40.775 30.775000000000002 3 17.675 15.875 28.525 37.925 4 21.25 22.5 25.900000000000002 30.349999999999998 5 24.65 30.25 24.925 20.175 6 19.375 34.4 24.075 22.15 7 14.875 26.5 42.925000000000004 15.7 8 16.675 24.375 34.1 24.85 9 16.900000000000002 23.325000000000003 35.699999999999996 24.075 10-14 19.695 29.525000000000002 28.735 22.045 15-19 19.665 27.884999999999998 28.189999999999998 24.26 20-24 19.84 28.13 28.294999999999998 23.735 25-29 20.44 28.035 28.205000000000002 23.32 30-34 19.415 27.855 28.26 24.47 35-39 20.405 28.110000000000003 28.065 23.419999999999998 40-44 19.744999999999997 28.720000000000002 28.13 23.405 45-49 20.330000000000002 28.439999999999998 27.58 23.65 50-54 20.155 28.32 27.73 23.794999999999998 55-59 20.1 27.955000000000002 28.655 23.29 60-64 19.62 27.98 28.705000000000002 23.695 65-69 20.044999999999998 28.205000000000002 28.18 23.57 70-74 19.805 28.38 28.060000000000002 23.755000000000003 75-79 19.384999999999998 28.13 29.12 23.365 80-84 20.325 28.51 27.765 23.400000000000002 85-89 20.3 28.044999999999998 28.025 23.630000000000003 90-94 19.994999999999997 28.884999999999998 27.529999999999998 23.59 95-99 19.885 28.165000000000003 28.21 23.74 100-104 20.674999999999997 28.084999999999997 28.015 23.225 105-109 20.59 28.37 27.875 23.165 110-114 20.369999999999997 28.439999999999998 27.77 23.419999999999998 115-119 20.27 28.494999999999997 28.000000000000004 23.235 120-124 20.255000000000003 28.7 27.08 23.965 125-129 20.45 28.685 27.400000000000002 23.465 130-134 20.105 28.384999999999998 27.975 23.535 135-139 20.46 28.215 28.005000000000003 23.32 140-144 20.43 28.46 27.485 23.625 145-149 20.22 28.585 27.33 23.865 150-151 19.8375 29.799999999999997 26.1125 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 2.0 24 3.0 25 3.0 26 6.0 27 8.0 28 11.0 29 18.0 30 21.0 31 29.0 32 39.5 33 35.5 34 45.0 35 72.0 36 100.0 37 114.5 38 137.5 39 168.0 40 188.5 41 206.0 42 231.0 43 258.5 44 274.0 45 262.0 46 244.0 47 238.5 48 226.0 49 217.5 50 184.0 51 125.5 52 98.5 53 99.0 54 74.5 55 57.5 56 54.5 57 42.5 58 28.0 59 17.5 60 13.5 61 9.5 62 7.0 63 6.0 64 4.5 65 2.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.9 #Duplication Level Percentage of deduplicated Percentage of total 1 89.84983314794216 80.77499999999999 2 9.149054505005562 16.45 3 0.9176863181312569 2.475 4 0.08342602892102337 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTTGT 10 0.006830828 145.0 2 GCTTGTC 10 0.006830828 145.0 3 >>END_MODULE SRR12671002 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671002_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2065 37.0 37.0 37.0 37.0 37.0 2 36.2885 37.0 37.0 37.0 37.0 37.0 3 36.2405 37.0 37.0 37.0 37.0 37.0 4 36.3475 37.0 37.0 37.0 37.0 37.0 5 36.455 37.0 37.0 37.0 37.0 37.0 6 36.3215 37.0 37.0 37.0 37.0 37.0 7 36.3895 37.0 37.0 37.0 37.0 37.0 8 36.467 37.0 37.0 37.0 37.0 37.0 9 36.336 37.0 37.0 37.0 37.0 37.0 10-14 36.471 37.0 37.0 37.0 37.0 37.0 15-19 36.4247 37.0 37.0 37.0 37.0 37.0 20-24 36.4136 37.0 37.0 37.0 37.0 37.0 25-29 36.3668 37.0 37.0 37.0 37.0 37.0 30-34 36.3725 37.0 37.0 37.0 37.0 37.0 35-39 36.2639 37.0 37.0 37.0 37.0 37.0 40-44 36.2803 37.0 37.0 37.0 37.0 37.0 45-49 36.31600000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.2867 37.0 37.0 37.0 37.0 37.0 55-59 36.251400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.227999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.25279999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.209799999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.1448 37.0 37.0 37.0 37.0 37.0 80-84 36.1111 37.0 37.0 37.0 37.0 37.0 85-89 36.0785 37.0 37.0 37.0 37.0 37.0 90-94 36.1142 37.0 37.0 37.0 37.0 37.0 95-99 36.039699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.113200000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.00599999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.0334 37.0 37.0 37.0 37.0 37.0 115-119 35.972699999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.8424 37.0 37.0 37.0 37.0 37.0 125-129 35.8361 37.0 37.0 37.0 37.0 37.0 130-134 35.70709999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.7465 37.0 37.0 37.0 37.0 37.0 140-144 35.7074 37.0 37.0 37.0 37.0 37.0 145-149 35.507999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.34925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 2.0 15 2.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 5.0 23 6.0 24 2.0 25 2.0 26 11.0 27 7.0 28 14.0 29 24.0 30 27.0 31 36.0 32 52.0 33 78.0 34 133.0 35 365.0 36 2656.0 37 570.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 23.775 9.075 28.225 2 26.150000000000002 25.650000000000002 32.925 15.275 3 20.5 28.849999999999998 32.45 18.2 4 25.174999999999997 33.625 22.5 18.7 5 25.224999999999998 38.425 20.3 16.05 6 20.225 39.425 22.925 17.424999999999997 7 20.7 21.875 39.1 18.325 8 19.475 25.6 30.15 24.775 9 22.225 24.0 30.425 23.35 10-14 22.919999999999998 29.985 27.0 20.095 15-19 22.695 28.155 27.935 21.215 20-24 23.044999999999998 28.939999999999998 27.615000000000002 20.4 25-29 21.915000000000003 28.655 28.96 20.47 30-34 22.52 28.16 28.52 20.8 35-39 22.755 28.025 28.17 21.05 40-44 23.03 28.199999999999996 28.000000000000004 20.77 45-49 23.145 27.644999999999996 28.355000000000004 20.855 50-54 23.18 28.565 28.050000000000004 20.205000000000002 55-59 22.645 28.360000000000003 28.389999999999997 20.605 60-64 23.29 27.705000000000002 28.165000000000003 20.84 65-69 22.62 28.54 27.92 20.919999999999998 70-74 23.145 27.560000000000002 28.065 21.23 75-79 22.71 28.084999999999997 27.555000000000003 21.65 80-84 23.505000000000003 28.16 27.500000000000004 20.835 85-89 23.655 27.900000000000002 27.68 20.765 90-94 23.45 27.97 27.83 20.75 95-99 23.135 27.74 28.499999999999996 20.625 100-104 23.09 28.185 27.965 20.76 105-109 22.93 28.17 28.194999999999997 20.705000000000002 110-114 23.474999999999998 28.48 27.284999999999997 20.76 115-119 23.94 28.325 27.215 20.52 120-124 23.225 28.34 27.98 20.455000000000002 125-129 24.715 28.52 26.884999999999998 19.88 130-134 23.97 28.04 27.655 20.335 135-139 24.585 28.025 27.339999999999996 20.05 140-144 24.75 28.34 27.155 19.755 145-149 24.610000000000003 28.599999999999998 27.095000000000002 19.695 150-151 25.587500000000002 28.9125 27.525 17.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.5 19 2.5 20 2.0 21 2.5 22 4.5 23 5.5 24 4.5 25 5.5 26 7.0 27 7.5 28 16.5 29 18.5 30 20.5 31 35.0 32 33.0 33 32.5 34 57.5 35 74.0 36 92.0 37 114.5 38 138.0 39 159.0 40 192.0 41 232.0 42 236.0 43 249.5 44 272.0 45 271.0 46 254.5 47 245.0 48 234.5 49 202.0 50 162.5 51 130.0 52 106.0 53 86.5 54 71.0 55 55.0 56 41.0 57 32.0 58 23.0 59 17.0 60 11.5 61 7.5 62 7.0 63 3.5 64 1.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.55 #Duplication Level Percentage of deduplicated Percentage of total 1 89.72640982691233 80.35 2 9.184812953657175 16.45 3 0.893355667225014 2.4 4 0.13958682300390843 0.5 5 0.02791736460078169 0.125 6 0.0 0.0 7 0.02791736460078169 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.3375 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.5375 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 3.9625000000000004 0.0 0.0 0.0 0.0 136-137 4.324999999999999 0.0 0.0 0.0 0.0 138-139 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTCC 10 0.006830828 145.0 5 GCCTCCC 10 0.006830828 145.0 6 CTCCCAG 10 0.006830828 145.0 8 TCCAGCC 10 0.006830828 145.0 2 GTCCAGC 10 0.006830828 145.0 1 CAGCCTC 10 0.006830828 145.0 4 >>END_MODULE Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra Read 651871 spots for SRR12671002.sra Written 651871 spots for SRR12671002.sra Read 651865 spots for SRR12671002.sra Written 651865 spots for SRR12671002.sra SRR ids: ['SRR12671002.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a8__24j0 SRR12671002.sra spots: 13037306 blocks: [[1, 651865], [651866, 1303730], [1303731, 1955595], [1955596, 2607460], [2607461, 3259325], [3259326, 3911190], [3911191, 4563055], [4563056, 5214920], [5214921, 5866785], [5866786, 6518650], [6518651, 7170515], [7170516, 7822380], [7822381, 8474245], [8474246, 9126110], [9126111, 9777975], [9777976, 10429840], [10429841, 11081705], [11081706, 11733570], [11733571, 12385435], [12385436, 13037306]] SRR12671002 file size 4408946 SRR12671002 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671002 SRR12671002_1.fastq SRR12671002_2.fastq Input file: SRR12671002_1.fastq Paired file: SRR12671002_2.fastq trimmed: SRR12671002-trimmed-pair1.fastq, SRR12671002-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:41:02 2025 >> started Tue Feb 11 12:41:16 2025 >> done (14.447s) 13037306 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 2089 ( 0.02%) empty read pairs filtered out after trimming by size control 13035153 (99.98%) read pairs available; of these: 780643 ( 5.99%) trimmed read pairs available after processing 12254510 (94.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 6 0.00% 21 2 0.00% 22 7 0.00% 23 13 0.00% 24 5 0.00% 25 12 0.00% 26 7 0.00% 27 12 0.00% 28 17 0.00% 29 13 0.00% 30 11 0.00% 31 3 0.00% 32 9 0.00% 33 17 0.00% 34 13 0.00% 35 15 0.00% 36 13 0.00% 37 18 0.00% 38 14 0.00% 39 12 0.00% 40 18 0.00% 41 17 0.00% 42 22 0.00% 43 15 0.00% 44 15 0.00% 45 24 0.00% 46 23 0.00% 47 34 0.00% 48 29 0.00% 49 29 0.00% 50 29 0.00% 51 45 0.00% 52 60 0.00% 53 55 0.00% 54 55 0.00% 55 47 0.00% 56 75 0.00% 57 75 0.00% 58 88 0.00% 59 96 0.00% 60 130 0.00% 61 129 0.00% 62 135 0.00% 63 168 0.00% 64 173 0.00% 65 205 0.00% 66 253 0.00% 67 261 0.00% 68 285 0.00% 69 306 0.00% 70 365 0.00% 71 445 0.00% 72 487 0.00% 73 520 0.00% 74 568 0.00% 75 685 0.01% 76 711 0.01% 77 813 0.01% 78 914 0.01% 79 1008 0.01% 80 1121 0.01% 81 1211 0.01% 82 1411 0.01% 83 1522 0.01% 84 1598 0.01% 85 1835 0.01% 86 1966 0.02% 87 2187 0.02% 88 2222 0.02% 89 2461 0.02% 90 2697 0.02% 91 2879 0.02% 92 2982 0.02% 93 3240 0.02% 94 3601 0.03% 95 3852 0.03% 96 3878 0.03% 97 4306 0.03% 98 4646 0.04% 99 4862 0.04% 100 4890 0.04% 101 5121 0.04% 102 5591 0.04% 103 5786 0.04% 104 6178 0.05% 105 6337 0.05% 106 6664 0.05% 107 7013 0.05% 108 7170 0.06% 109 7511 0.06% 110 7734 0.06% 111 8102 0.06% 112 8272 0.06% 113 8652 0.07% 114 8840 0.07% 115 9601 0.07% 116 9789 0.08% 117 10419 0.08% 118 10717 0.08% 119 11031 0.08% 120 11427 0.09% 121 11694 0.09% 122 12113 0.09% 123 12469 0.10% 124 13124 0.10% 125 13147 0.10% 126 14031 0.11% 127 14503 0.11% 128 14670 0.11% 129 15255 0.12% 130 15475 0.12% 131 15940 0.12% 132 16384 0.13% 133 16922 0.13% 134 17045 0.13% 135 17775 0.14% 136 17988 0.14% 137 18802 0.14% 138 19385 0.15% 139 20129 0.15% 140 20399 0.16% 141 20781 0.16% 142 21290 0.16% 143 21822 0.17% 144 22705 0.17% 145 23032 0.18% 146 23096 0.18% 147 24089 0.18% 148 24541 0.19% 149 25070 0.19% 150 25999 0.20% 151 12254510 94.01% 13035153 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=31 prefix-density=0.47 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=15.03 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.6 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=44.12 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=13.7 sequence=AAAGAAAAGAAAA SRR12671002 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:42:11 Started mapping on | Feb 11 12:42:11 Finished on | Feb 11 12:43:36 Mapping speed, Million of reads per hour | 552.08 Number of input reads | 13035153 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12199394 Uniquely mapped reads % | 93.59% Average mapped length | 297.74 Number of splices: Total | 12236941 Number of splices: Annotated (sjdb) | 11972126 Number of splices: GT/AG | 11993504 Number of splices: GC/AG | 200726 Number of splices: AT/AC | 6889 Number of splices: Non-canonical | 35822 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287306 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 54102 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 548453 548453 548453 N_multimapping 287306 287306 287306 N_noFeature 549760 12038856 603184 N_ambiguous 183643 703 76182 UnstrandedReadsAssigned:11465991 PositiveStrandReadsAssigned:159835 NegativeStrandReadsAssigned:11520028 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671002 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671002-trimmed-pair1.fastq SRR12671002-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,035,153 reads, 11,518,517 reads pseudoaligned [quant] estimated average fragment length: 280.022 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR12671002.ke.tsv 34699 SRR12671002.se.tsv 87100 total ==> SRR12671002.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.98 408 19.1073 Potri.005G024800.1.v4.1 1035 755.978 179 19.2832 Potri.004G059700.1.v4.1 961 682.235 3 0.358114 Potri.007G009000.2.v4.1 1416 1136.98 0 0 Potri.003G141000.2.v4.1 2943 2663.98 996.846 30.4741 Potri.016G087400.1.v4.1 270 75.0064 460 499.452 Potri.015G069301.1.v4.1 564 302.029 0 0 Potri.010G195200.1.v4.1 1773 1493.98 22 1.19926 Potri.012G127500.1.v4.1 977 698.113 71 8.2826 ==> SRR12671002.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 78 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671002 completed mapping pipeline successfully