Starting /dee2/code/volunteer_pipeline.sh SRR12671003 current disk space = 3050796584960 free memory = 1470706732 SRR12671003 SRAfilesize 1415888be4b92cfc374b62ee305aed47 SRR12671003.sra SRR12671003.sra file validated SRR12671003 is paired end SRR12671003 is conventional basespace SRR12671003 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671003_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.3535 37.0 37.0 37.0 37.0 37.0 3 36.47 37.0 37.0 37.0 37.0 37.0 4 36.5255 37.0 37.0 37.0 37.0 37.0 5 36.6465 37.0 37.0 37.0 37.0 37.0 6 36.55 37.0 37.0 37.0 37.0 37.0 7 36.57 37.0 37.0 37.0 37.0 37.0 8 36.574 37.0 37.0 37.0 37.0 37.0 9 36.5615 37.0 37.0 37.0 37.0 37.0 10-14 36.5731 37.0 37.0 37.0 37.0 37.0 15-19 36.5521 37.0 37.0 37.0 37.0 37.0 20-24 36.4751 37.0 37.0 37.0 37.0 37.0 25-29 36.4842 37.0 37.0 37.0 37.0 37.0 30-34 36.434799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4476 37.0 37.0 37.0 37.0 37.0 40-44 36.42040000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.395500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3564 37.0 37.0 37.0 37.0 37.0 55-59 36.3322 37.0 37.0 37.0 37.0 37.0 60-64 36.2838 37.0 37.0 37.0 37.0 37.0 65-69 36.362300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.30120000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2552 37.0 37.0 37.0 37.0 37.0 80-84 36.201899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2053 37.0 37.0 37.0 37.0 37.0 90-94 36.2155 37.0 37.0 37.0 37.0 37.0 95-99 36.1851 37.0 37.0 37.0 37.0 37.0 100-104 36.179700000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.10340000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1287 37.0 37.0 37.0 37.0 37.0 115-119 36.0373 37.0 37.0 37.0 37.0 37.0 120-124 36.0077 37.0 37.0 37.0 37.0 37.0 125-129 36.0127 37.0 37.0 37.0 37.0 37.0 130-134 35.896499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9309 37.0 37.0 37.0 37.0 37.0 140-144 35.8358 37.0 37.0 37.0 37.0 37.0 145-149 35.721700000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.631 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 2.0 24 4.0 25 4.0 26 2.0 27 14.0 28 15.0 29 24.0 30 40.0 31 37.0 32 63.0 33 75.0 34 100.0 35 260.0 36 2751.0 37 606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.925000000000004 13.0 4.55 33.525 2 20.599999999999998 10.575 37.475 31.35 3 17.125 16.55 29.225 37.1 4 21.15 22.0 25.474999999999998 31.374999999999996 5 24.25 29.075 24.775 21.9 6 19.5 32.625 23.474999999999998 24.4 7 15.45 28.749999999999996 40.1 15.7 8 15.975 26.025 33.675 24.325 9 16.375 23.175 36.325 24.125 10-14 19.985 29.659999999999997 28.58 21.775 15-19 20.385 28.1 27.224999999999998 24.29 20-24 20.485 28.065 28.050000000000004 23.400000000000002 25-29 20.165 28.615000000000002 27.965 23.255 30-34 19.794999999999998 29.12 27.435 23.65 35-39 20.05 28.24 27.97 23.74 40-44 20.150000000000002 28.444999999999997 27.08 24.325 45-49 19.81 28.610000000000003 27.76 23.82 50-54 20.285 28.79 27.32 23.605 55-59 19.835 28.189999999999998 28.560000000000002 23.415 60-64 19.905 28.389999999999997 27.665 24.04 65-69 19.935 28.475 27.755000000000003 23.835 70-74 20.115 28.345 27.744999999999997 23.794999999999998 75-79 20.26 27.37 28.175 24.195 80-84 20.135 28.62 27.485 23.76 85-89 20.585 28.24 27.325 23.849999999999998 90-94 20.02 28.965000000000003 27.185 23.830000000000002 95-99 20.49 28.005000000000003 27.785 23.72 100-104 20.265 28.375 27.42 23.94 105-109 20.285 28.685 27.42 23.61 110-114 19.875 28.32 28.08 23.724999999999998 115-119 20.755000000000003 28.425 27.175 23.645 120-124 20.93 28.694999999999997 26.729999999999997 23.645 125-129 20.794999999999998 28.044999999999998 27.57 23.59 130-134 20.495 28.215 27.155 24.135 135-139 20.46 27.92 27.43 24.19 140-144 21.51 28.28 27.12 23.09 145-149 21.135 28.265 26.979999999999997 23.62 150-151 21.212500000000002 28.3125 26.650000000000002 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 2.0 22 2.0 23 2.0 24 3.5 25 5.5 26 4.5 27 5.0 28 8.0 29 12.5 30 18.5 31 25.0 32 35.5 33 42.5 34 59.0 35 76.0 36 87.5 37 110.0 38 125.0 39 136.5 40 180.5 41 223.0 42 230.5 43 237.5 44 249.0 45 255.0 46 257.0 47 252.0 48 233.5 49 202.0 50 182.0 51 166.5 52 131.5 53 96.0 54 78.0 55 70.5 56 54.5 57 40.0 58 31.0 59 23.5 60 13.5 61 5.5 62 5.5 63 4.5 64 3.5 65 2.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.87789588443718 84.275 2 7.304442627418915 13.4 3 0.7358953393295176 2.025 4 0.08176614881439084 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.0374999999999996 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.85 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCT 10 0.006830828 145.0 1 CTGTTAT 10 0.006830828 145.0 6 >>END_MODULE SRR12671003 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671003_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.212 37.0 37.0 37.0 37.0 37.0 2 36.3455 37.0 37.0 37.0 37.0 37.0 3 36.238 37.0 37.0 37.0 37.0 37.0 4 36.4025 37.0 37.0 37.0 37.0 37.0 5 36.4565 37.0 37.0 37.0 37.0 37.0 6 36.4145 37.0 37.0 37.0 37.0 37.0 7 36.3665 37.0 37.0 37.0 37.0 37.0 8 36.411 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.415499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.37429999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.380399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.322799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2801 37.0 37.0 37.0 37.0 37.0 35-39 36.2581 37.0 37.0 37.0 37.0 37.0 40-44 36.2457 37.0 37.0 37.0 37.0 37.0 45-49 36.241499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2077 37.0 37.0 37.0 37.0 37.0 55-59 36.215700000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.1831 37.0 37.0 37.0 37.0 37.0 65-69 36.217699999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.176100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.1206 37.0 37.0 37.0 37.0 37.0 80-84 36.149100000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0594 37.0 37.0 37.0 37.0 37.0 90-94 36.1001 37.0 37.0 37.0 37.0 37.0 95-99 36.060500000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0269 37.0 37.0 37.0 37.0 37.0 105-109 36.0264 37.0 37.0 37.0 37.0 37.0 110-114 36.009 37.0 37.0 37.0 37.0 37.0 115-119 35.94270000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.863 37.0 37.0 37.0 37.0 37.0 125-129 35.819900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8699 37.0 37.0 37.0 37.0 37.0 135-139 35.768499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.745000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.5527 37.0 37.0 37.0 37.0 37.0 150-151 35.331 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 6.0 16 5.0 17 2.0 18 2.0 19 3.0 20 4.0 21 3.0 22 6.0 23 3.0 24 4.0 25 6.0 26 7.0 27 10.0 28 17.0 29 16.0 30 13.0 31 42.0 32 41.0 33 66.0 34 127.0 35 315.0 36 2727.0 37 572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.75 27.1 7.35 21.8 2 29.349999999999998 26.150000000000002 29.175 15.325 3 21.7 27.725 32.9 17.675 4 23.125 35.85 22.7 18.325 5 26.625 37.45 20.75 15.174999999999999 6 20.875 41.65 20.849999999999998 16.625 7 20.275000000000002 24.075 37.875 17.775 8 20.5 26.900000000000002 28.025 24.575 9 22.15 23.45 29.425 24.975 10-14 22.869999999999997 30.445 26.035000000000004 20.65 15-19 23.615 27.82 27.67 20.895 20-24 23.51 29.049999999999997 27.060000000000002 20.380000000000003 25-29 23.565 28.144999999999996 27.72 20.57 30-34 23.35 27.83 27.955000000000002 20.865000000000002 35-39 23.935000000000002 27.800000000000004 27.62 20.645 40-44 22.895 27.915 28.144999999999996 21.044999999999998 45-49 23.66 28.244999999999997 27.650000000000002 20.445 50-54 22.95 29.09 26.939999999999998 21.02 55-59 23.26 28.575 27.565 20.599999999999998 60-64 23.13 27.715 27.944999999999997 21.21 65-69 23.200000000000003 27.48 28.175 21.145 70-74 23.595 28.185 27.465 20.755000000000003 75-79 22.705000000000002 27.82 28.1 21.375 80-84 23.28 28.689999999999998 26.985 21.044999999999998 85-89 23.72 28.439999999999998 27.279999999999998 20.560000000000002 90-94 23.724999999999998 27.334999999999997 27.72 21.22 95-99 23.385 27.96 27.815 20.84 100-104 23.89 27.935 27.650000000000002 20.525 105-109 23.775 27.750000000000004 27.77 20.705000000000002 110-114 23.415 29.005 26.805 20.775 115-119 22.945 28.895 27.015 21.145 120-124 23.955000000000002 27.975 27.575 20.495 125-129 23.46 28.470000000000002 27.445000000000004 20.625 130-134 23.965 28.235 27.345000000000002 20.455000000000002 135-139 23.895 28.375 27.785 19.945 140-144 24.34 27.439999999999998 27.615000000000002 20.605 145-149 24.33 28.125 27.265 20.28 150-151 25.5 28.0625 26.900000000000002 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 2.0 23 4.5 24 3.5 25 3.5 26 5.5 27 8.0 28 12.0 29 12.5 30 12.5 31 23.0 32 26.0 33 22.5 34 33.5 35 55.0 36 84.0 37 114.0 38 154.0 39 173.0 40 193.5 41 233.5 42 245.5 43 263.5 44 285.0 45 267.5 46 238.5 47 226.5 48 220.5 49 218.0 50 184.5 51 149.0 52 125.0 53 89.5 54 68.5 55 58.0 56 48.0 57 38.0 58 25.5 59 14.5 60 12.5 61 10.0 62 5.5 63 3.5 64 3.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.74890350877193 83.675 2 7.291666666666667 13.3 3 0.6853070175438596 1.875 4 0.1918859649122807 0.7000000000000001 5 0.05482456140350877 0.25 6 0.0 0.0 7 0.0 0.0 8 0.027412280701754384 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.47500000000000003 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.85 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAAA 10 0.006830828 145.0 5 >>END_MODULE Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579821 spots for SRR12671003.sra Written 579821 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra Read 579809 spots for SRR12671003.sra Written 579809 spots for SRR12671003.sra SRR ids: ['SRR12671003.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rfnsc1ca SRR12671003.sra spots: 11596192 blocks: [[1, 579809], [579810, 1159618], [1159619, 1739427], [1739428, 2319236], [2319237, 2899045], [2899046, 3478854], [3478855, 4058663], [4058664, 4638472], [4638473, 5218281], [5218282, 5798090], [5798091, 6377899], [6377900, 6957708], [6957709, 7537517], [7537518, 8117326], [8117327, 8697135], [8697136, 9276944], [9276945, 9856753], [9856754, 10436562], [10436563, 11016371], [11016372, 11596192]] SRR12671003 file size 3919193 SRR12671003 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671003 SRR12671003_1.fastq SRR12671003_2.fastq Input file: SRR12671003_1.fastq Paired file: SRR12671003_2.fastq trimmed: SRR12671003-trimmed-pair1.fastq, SRR12671003-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:31:09 2025 >> started Tue Feb 11 12:31:23 2025 >> done (13.661s) 11596192 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 2628 ( 0.02%) empty read pairs filtered out after trimming by size control 11593504 (99.98%) read pairs available; of these: 663524 ( 5.72%) trimmed read pairs available after processing 10929980 (94.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 7 0.00% 21 19 0.00% 22 7 0.00% 23 8 0.00% 24 13 0.00% 25 19 0.00% 26 28 0.00% 27 18 0.00% 28 22 0.00% 29 15 0.00% 30 23 0.00% 31 22 0.00% 32 26 0.00% 33 18 0.00% 34 23 0.00% 35 16 0.00% 36 20 0.00% 37 15 0.00% 38 26 0.00% 39 20 0.00% 40 17 0.00% 41 20 0.00% 42 29 0.00% 43 16 0.00% 44 19 0.00% 45 22 0.00% 46 29 0.00% 47 25 0.00% 48 33 0.00% 49 30 0.00% 50 63 0.00% 51 28 0.00% 52 40 0.00% 53 36 0.00% 54 53 0.00% 55 67 0.00% 56 63 0.00% 57 85 0.00% 58 92 0.00% 59 110 0.00% 60 144 0.00% 61 140 0.00% 62 181 0.00% 63 191 0.00% 64 203 0.00% 65 216 0.00% 66 254 0.00% 67 233 0.00% 68 290 0.00% 69 317 0.00% 70 423 0.00% 71 451 0.00% 72 467 0.00% 73 547 0.00% 74 681 0.01% 75 608 0.01% 76 788 0.01% 77 796 0.01% 78 888 0.01% 79 1022 0.01% 80 1000 0.01% 81 1284 0.01% 82 1398 0.01% 83 1504 0.01% 84 1673 0.01% 85 1843 0.02% 86 1867 0.02% 87 2088 0.02% 88 2131 0.02% 89 2261 0.02% 90 2400 0.02% 91 2673 0.02% 92 2799 0.02% 93 2994 0.03% 94 3265 0.03% 95 3468 0.03% 96 3695 0.03% 97 3958 0.03% 98 3944 0.03% 99 4108 0.04% 100 4306 0.04% 101 4391 0.04% 102 4818 0.04% 103 4986 0.04% 104 5282 0.05% 105 5538 0.05% 106 5772 0.05% 107 6090 0.05% 108 6268 0.05% 109 6233 0.05% 110 6524 0.06% 111 6897 0.06% 112 7068 0.06% 113 7251 0.06% 114 7720 0.07% 115 7911 0.07% 116 8426 0.07% 117 8782 0.08% 118 8845 0.08% 119 9015 0.08% 120 9436 0.08% 121 9766 0.08% 122 10000 0.09% 123 10445 0.09% 124 10795 0.09% 125 11008 0.09% 126 11609 0.10% 127 12069 0.10% 128 12603 0.11% 129 12829 0.11% 130 13075 0.11% 131 13181 0.11% 132 13543 0.12% 133 14234 0.12% 134 14520 0.13% 135 14667 0.13% 136 15432 0.13% 137 15430 0.13% 138 16069 0.14% 139 16951 0.15% 140 16918 0.15% 141 17633 0.15% 142 18049 0.16% 143 17995 0.16% 144 19071 0.16% 145 19307 0.17% 146 19630 0.17% 147 20291 0.18% 148 21218 0.18% 149 20927 0.18% 150 22258 0.19% 151 10929980 94.28% 11593504 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=27 prefix-density=0.73 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=123.94 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.0 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=21 prefix-density=0.80 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=22 fanout-score=19.66 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=6.4 sequence=GCAATGGCAGCCTCAGTTATGGCTTCA SRR12671003 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:32:23 Started mapping on | Feb 11 12:32:24 Finished on | Feb 11 12:33:52 Mapping speed, Million of reads per hour | 474.28 Number of input reads | 11593504 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 10828349 Uniquely mapped reads % | 93.40% Average mapped length | 297.87 Number of splices: Total | 11074024 Number of splices: Annotated (sjdb) | 10872897 Number of splices: GT/AG | 10845010 Number of splices: GC/AG | 196006 Number of splices: AT/AC | 6226 Number of splices: Non-canonical | 26782 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244671 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 29231 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 520484 520484 520484 N_multimapping 244671 244671 244671 N_noFeature 386214 10677988 431842 N_ambiguous 178428 547 73422 UnstrandedReadsAssigned:10263707 PositiveStrandReadsAssigned:149814 NegativeStrandReadsAssigned:10323085 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671003 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671003-trimmed-pair1.fastq SRR12671003-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,593,504 reads, 10,334,591 reads pseudoaligned [quant] estimated average fragment length: 275.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR12671003.ke.tsv 34699 SRR12671003.se.tsv 87100 total ==> SRR12671003.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.26 314 15.1817 Potri.005G024800.1.v4.1 1035 760.26 144 15.9644 Potri.004G059700.1.v4.1 961 686.357 7 0.859609 Potri.007G009000.2.v4.1 1416 1141.26 0 0 Potri.003G141000.2.v4.1 2943 2668.26 439 13.8672 Potri.016G087400.1.v4.1 270 73.3937 379 435.245 Potri.015G069301.1.v4.1 564 301.956 0 0 Potri.010G195200.1.v4.1 1773 1498.26 20 1.12511 Potri.012G127500.1.v4.1 977 702.291 82 9.84124 ==> SRR12671003.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671003 completed mapping pipeline successfully