Starting /dee2/code/volunteer_pipeline.sh SRR12671004 current disk space = 3050795323392 free memory = 1173206008 SRR12671004 SRAfilesize 5bb8950e0e649dfbe84e2a55f6969f19 SRR12671004.sra SRR12671004.sra file validated SRR12671004 is paired end SRR12671004 is conventional basespace SRR12671004 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671004_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42275 37.0 37.0 37.0 37.0 37.0 2 36.3755 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.596 37.0 37.0 37.0 37.0 37.0 5 36.5935 37.0 37.0 37.0 37.0 37.0 6 36.602 37.0 37.0 37.0 37.0 37.0 7 36.5235 37.0 37.0 37.0 37.0 37.0 8 36.5775 37.0 37.0 37.0 37.0 37.0 9 36.59 37.0 37.0 37.0 37.0 37.0 10-14 36.617599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.60020000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5594 37.0 37.0 37.0 37.0 37.0 25-29 36.5447 37.0 37.0 37.0 37.0 37.0 30-34 36.4982 37.0 37.0 37.0 37.0 37.0 35-39 36.50920000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.512499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4828 37.0 37.0 37.0 37.0 37.0 50-54 36.4166 37.0 37.0 37.0 37.0 37.0 55-59 36.426100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.357000000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3883 37.0 37.0 37.0 37.0 37.0 70-74 36.37429999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3328 37.0 37.0 37.0 37.0 37.0 80-84 36.3029 37.0 37.0 37.0 37.0 37.0 85-89 36.2678 37.0 37.0 37.0 37.0 37.0 90-94 36.2548 37.0 37.0 37.0 37.0 37.0 95-99 36.2245 37.0 37.0 37.0 37.0 37.0 100-104 36.126000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1755 37.0 37.0 37.0 37.0 37.0 110-114 36.189499999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0885 37.0 37.0 37.0 37.0 37.0 120-124 36.0882 37.0 37.0 37.0 37.0 37.0 125-129 36.121 37.0 37.0 37.0 37.0 37.0 130-134 35.882999999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9031 37.0 37.0 37.0 37.0 37.0 140-144 35.8977 37.0 37.0 37.0 37.0 37.0 145-149 35.7877 37.0 37.0 37.0 37.0 37.0 150-151 35.672250000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 7.0 27 2.0 28 14.0 29 23.0 30 35.0 31 36.0 32 62.0 33 74.0 34 121.0 35 266.0 36 2702.0 37 653.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.209052263065765 11.177794448612154 5.126281570392599 47.48687171792948 2 16.950000000000003 11.4 39.35 32.300000000000004 3 16.775000000000002 14.325 27.250000000000004 41.65 4 23.474999999999998 22.125 23.825 30.575000000000003 5 23.674999999999997 29.5 24.775 22.05 6 20.95 34.150000000000006 22.775000000000002 22.125 7 15.174999999999999 26.200000000000003 41.4 17.224999999999998 8 16.375 26.974999999999998 33.324999999999996 23.325000000000003 9 17.0 24.125 35.775 23.1 10-14 19.305 30.15 27.97 22.575 15-19 19.615 28.785 27.66 23.94 20-24 20.05 28.025 28.07 23.855 25-29 19.25 28.665000000000003 28.205000000000002 23.880000000000003 30-34 19.955000000000002 27.700000000000003 28.144999999999996 24.2 35-39 19.91 29.244999999999997 27.37 23.474999999999998 40-44 19.885 28.34 28.444999999999997 23.330000000000002 45-49 19.915 29.095 27.35 23.64 50-54 19.73 28.189999999999998 28.389999999999997 23.69 55-59 19.405 28.405 28.294999999999998 23.895 60-64 20.044999999999998 28.95 27.21 23.794999999999998 65-69 19.939999999999998 28.499999999999996 28.21 23.35 70-74 19.975 28.815 28.060000000000002 23.150000000000002 75-79 20.13 27.62 28.605000000000004 23.645 80-84 20.45 28.744999999999997 27.500000000000004 23.305 85-89 20.255000000000003 28.475 27.715 23.555 90-94 20.03 27.939999999999998 27.83 24.2 95-99 20.265 28.34 27.279999999999998 24.115000000000002 100-104 19.89 29.349999999999998 27.73 23.03 105-109 20.055 28.33 27.834999999999997 23.78 110-114 19.975 27.955000000000002 28.655 23.415 115-119 20.335 28.410000000000004 28.084999999999997 23.169999999999998 120-124 20.47 28.815 26.919999999999998 23.794999999999998 125-129 20.69 28.499999999999996 27.175 23.635 130-134 20.745 28.42 27.36 23.474999999999998 135-139 20.715 28.555000000000003 27.04 23.69 140-144 20.79 28.475 27.565 23.169999999999998 145-149 20.955 28.685 27.52 22.84 150-151 21.5 27.375 26.424999999999997 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 3.0 27 5.5 28 10.0 29 13.0 30 17.5 31 30.0 32 42.5 33 49.0 34 55.0 35 62.0 36 88.0 37 110.0 38 132.0 39 158.0 40 186.0 41 222.0 42 243.0 43 255.5 44 269.0 45 270.5 46 249.5 47 241.5 48 230.0 49 215.5 50 186.0 51 143.5 52 116.5 53 95.5 54 82.0 55 61.0 56 43.0 57 32.0 58 22.5 59 14.5 60 10.5 61 10.0 62 5.5 63 4.0 64 3.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.22011385199241 85.05 2 7.2106261859582546 13.3 3 0.4879371103280022 1.35 4 0.0813228517213337 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15000000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.225 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 4.0625 0.0 0.0 0.0 0.0 138-139 4.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGTGG 10 0.006830828 145.0 3 GTGGAAG 10 0.006830828 145.0 6 CAGTGGA 10 0.006830828 145.0 4 >>END_MODULE SRR12671004 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671004_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.387 37.0 37.0 37.0 37.0 37.0 2 36.338 37.0 37.0 37.0 37.0 37.0 3 36.3045 37.0 37.0 37.0 37.0 37.0 4 36.4675 37.0 37.0 37.0 37.0 37.0 5 36.536 37.0 37.0 37.0 37.0 37.0 6 36.4865 37.0 37.0 37.0 37.0 37.0 7 36.3995 37.0 37.0 37.0 37.0 37.0 8 36.436 37.0 37.0 37.0 37.0 37.0 9 36.3625 37.0 37.0 37.0 37.0 37.0 10-14 36.4701 37.0 37.0 37.0 37.0 37.0 15-19 36.466300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4555 37.0 37.0 37.0 37.0 37.0 25-29 36.37689999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3952 37.0 37.0 37.0 37.0 37.0 35-39 36.3238 37.0 37.0 37.0 37.0 37.0 40-44 36.32959999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3233 37.0 37.0 37.0 37.0 37.0 50-54 36.2603 37.0 37.0 37.0 37.0 37.0 55-59 36.2402 37.0 37.0 37.0 37.0 37.0 60-64 36.271100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.18910000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.2048 37.0 37.0 37.0 37.0 37.0 75-79 36.218 37.0 37.0 37.0 37.0 37.0 80-84 36.1903 37.0 37.0 37.0 37.0 37.0 85-89 36.1268 37.0 37.0 37.0 37.0 37.0 90-94 36.1637 37.0 37.0 37.0 37.0 37.0 95-99 36.1685 37.0 37.0 37.0 37.0 37.0 100-104 36.1534 37.0 37.0 37.0 37.0 37.0 105-109 36.096199999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0542 37.0 37.0 37.0 37.0 37.0 115-119 36.0755 37.0 37.0 37.0 37.0 37.0 120-124 35.9172 37.0 37.0 37.0 37.0 37.0 125-129 35.885299999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.904799999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.8419 37.0 37.0 37.0 37.0 37.0 140-144 35.8175 37.0 37.0 37.0 37.0 37.0 145-149 35.637800000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.4215 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 3.0 22 4.0 23 0.0 24 1.0 25 4.0 26 6.0 27 13.0 28 13.0 29 25.0 30 22.0 31 40.0 32 52.0 33 56.0 34 142.0 35 334.0 36 2651.0 37 625.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.15 23.724999999999998 10.75 32.375 2 25.525 27.125 32.95 14.399999999999999 3 19.375 28.175 33.2 19.25 4 23.549999999999997 33.525 22.75 20.175 5 25.825 37.525 21.275 15.375 6 19.15 40.65 22.55 17.65 7 19.15 21.025 40.625 19.2 8 19.400000000000002 24.775 32.125 23.7 9 20.325 23.775 32.2 23.7 10-14 22.62 29.65 26.76 20.97 15-19 22.275 28.384999999999998 28.275 21.065 20-24 22.615 28.689999999999998 27.3 21.395 25-29 21.66 28.935 28.605000000000004 20.8 30-34 21.795 28.68 28.389999999999997 21.135 35-39 22.205 28.89 27.785 21.12 40-44 22.189999999999998 28.744999999999997 28.325 20.74 45-49 22.355 28.34 28.48 20.825 50-54 22.45 28.375 27.605 21.57 55-59 22.21 28.025 28.675 21.09 60-64 22.365 28.005000000000003 28.299999999999997 21.33 65-69 22.814999999999998 27.83 28.065 21.29 70-74 22.96 27.485 28.38 21.175 75-79 22.82 28.549999999999997 27.595 21.035 80-84 22.91 28.42 27.589999999999996 21.08 85-89 23.365 28.1 27.845 20.69 90-94 22.46 28.27 27.939999999999998 21.33 95-99 22.875 28.13 28.110000000000003 20.885 100-104 23.62 27.68 28.27 20.43 105-109 23.169999999999998 27.815 28.455000000000002 20.560000000000002 110-114 23.36 28.244999999999997 27.92 20.474999999999998 115-119 23.86 28.415000000000003 27.555000000000003 20.169999999999998 120-124 23.919999999999998 28.46 27.474999999999998 20.145 125-129 23.315 28.294999999999998 27.63 20.76 130-134 23.75 28.375 27.560000000000002 20.315 135-139 23.805 27.74 28.050000000000004 20.405 140-144 24.325 28.64 27.200000000000003 19.835 145-149 24.610000000000003 27.800000000000004 26.965 20.625 150-151 24.1125 28.3375 27.6625 19.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.5 24 4.0 25 4.0 26 5.5 27 4.5 28 11.5 29 15.0 30 16.5 31 28.0 32 32.0 33 45.0 34 65.0 35 76.0 36 96.0 37 114.5 38 137.5 39 181.5 40 219.0 41 243.5 42 261.0 43 275.5 44 268.0 45 247.0 46 259.5 47 259.5 48 225.0 49 187.5 50 141.5 51 117.0 52 107.0 53 86.0 54 73.5 55 56.5 56 37.0 57 26.5 58 18.5 59 13.5 60 9.0 61 5.5 62 4.0 63 3.0 64 1.0 65 0.5 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5264012997563 85.425 2 6.796642296236122 12.55 3 0.5686433793663688 1.575 4 0.08123476848090982 0.3 5 0.0 0.0 6 0.027078256160303276 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15000000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 1.9124999999999999 0.0 0.0 0.0 0.0 120-121 2.15 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.3125 0.0 0.0 0.0 0.0 134-135 3.6 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra Read 637988 spots for SRR12671004.sra Written 637988 spots for SRR12671004.sra Read 637978 spots for SRR12671004.sra Written 637978 spots for SRR12671004.sra SRR ids: ['SRR12671004.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nuh0kavm SRR12671004.sra spots: 12759570 blocks: [[1, 637978], [637979, 1275956], [1275957, 1913934], [1913935, 2551912], [2551913, 3189890], [3189891, 3827868], [3827869, 4465846], [4465847, 5103824], [5103825, 5741802], [5741803, 6379780], [6379781, 7017758], [7017759, 7655736], [7655737, 8293714], [8293715, 8931692], [8931693, 9569670], [9569671, 10207648], [10207649, 10845626], [10845627, 11483604], [11483605, 12121582], [12121583, 12759570]] SRR12671004 file size 4314559 SRR12671004 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671004 SRR12671004_1.fastq SRR12671004_2.fastq Input file: SRR12671004_1.fastq Paired file: SRR12671004_2.fastq trimmed: SRR12671004-trimmed-pair1.fastq, SRR12671004-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:32:06 2025 >> started Tue Feb 11 12:32:27 2025 >> done (20.830s) 12759570 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 1595 ( 0.01%) empty read pairs filtered out after trimming by size control 12757936 (99.99%) read pairs available; of these: 865831 ( 6.79%) trimmed read pairs available after processing 11892105 (93.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 6 0.00% 25 11 0.00% 26 4 0.00% 27 6 0.00% 28 3 0.00% 29 8 0.00% 30 11 0.00% 31 9 0.00% 32 7 0.00% 33 8 0.00% 34 5 0.00% 35 8 0.00% 36 10 0.00% 37 14 0.00% 38 16 0.00% 39 14 0.00% 40 12 0.00% 41 14 0.00% 42 16 0.00% 43 21 0.00% 44 18 0.00% 45 21 0.00% 46 17 0.00% 47 28 0.00% 48 27 0.00% 49 42 0.00% 50 33 0.00% 51 39 0.00% 52 56 0.00% 53 61 0.00% 54 39 0.00% 55 49 0.00% 56 72 0.00% 57 69 0.00% 58 98 0.00% 59 102 0.00% 60 116 0.00% 61 127 0.00% 62 160 0.00% 63 182 0.00% 64 172 0.00% 65 213 0.00% 66 224 0.00% 67 276 0.00% 68 263 0.00% 69 332 0.00% 70 391 0.00% 71 448 0.00% 72 498 0.00% 73 584 0.00% 74 572 0.00% 75 702 0.01% 76 739 0.01% 77 857 0.01% 78 935 0.01% 79 1153 0.01% 80 1178 0.01% 81 1340 0.01% 82 1484 0.01% 83 1726 0.01% 84 1929 0.02% 85 2032 0.02% 86 2274 0.02% 87 2418 0.02% 88 2608 0.02% 89 2654 0.02% 90 2958 0.02% 91 3276 0.03% 92 3511 0.03% 93 3697 0.03% 94 4102 0.03% 95 4443 0.03% 96 4707 0.04% 97 5120 0.04% 98 5329 0.04% 99 5289 0.04% 100 5839 0.05% 101 6071 0.05% 102 6164 0.05% 103 6564 0.05% 104 6845 0.05% 105 7320 0.06% 106 7688 0.06% 107 8126 0.06% 108 8373 0.07% 109 8690 0.07% 110 8992 0.07% 111 9462 0.07% 112 9599 0.08% 113 9929 0.08% 114 10235 0.08% 115 10928 0.09% 116 11167 0.09% 117 11606 0.09% 118 12218 0.10% 119 12627 0.10% 120 13174 0.10% 121 13487 0.11% 122 13918 0.11% 123 14301 0.11% 124 14736 0.12% 125 14959 0.12% 126 15659 0.12% 127 16001 0.13% 128 16433 0.13% 129 16815 0.13% 130 17473 0.14% 131 17700 0.14% 132 18128 0.14% 133 18919 0.15% 134 18832 0.15% 135 19101 0.15% 136 20004 0.16% 137 20684 0.16% 138 21159 0.17% 139 21991 0.17% 140 22287 0.17% 141 22722 0.18% 142 23627 0.19% 143 23353 0.18% 144 24048 0.19% 145 24569 0.19% 146 25103 0.20% 147 25675 0.20% 148 26407 0.21% 149 26339 0.21% 150 27780 0.22% 151 11892105 93.21% 12757936 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=271.10 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=19.5 sequence=CATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=0.57 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=28.24 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.7 sequence=CAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATTGGTCGACTATGGAAAAGATAGCGTTACCGTCAATATCCCATCAACTGGCGATGTATCATCTAGAAGCCAGCCTCCTACCTATGCCCCACGAACTGGCAGTGGATGTAGCATTTACCAACGAGATTGTCCTAAGAAAAAACCTTGTAATCCTTACAAGCGTAGCTGCCATCGCCCTTGAAAATGAAAGAGTAGTTTGATTTGGGTCCATTATCTAGTGGTAAAAGCTGTGAGCTCAAAGCACCAGGGCTATCTATTACTTTCATTTCCATTACCAATGTAATTATATGGTCGTTGGAAATTAAATAAA SRR12671004 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:33:14 Started mapping on | Feb 11 12:33:15 Finished on | Feb 11 12:34:48 Mapping speed, Million of reads per hour | 493.86 Number of input reads | 12757936 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12030180 Uniquely mapped reads % | 94.30% Average mapped length | 297.52 Number of splices: Total | 11864937 Number of splices: Annotated (sjdb) | 11614889 Number of splices: GT/AG | 11629593 Number of splices: GC/AG | 192723 Number of splices: AT/AC | 6990 Number of splices: Non-canonical | 35631 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.03% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331430 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 45532 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 396326 396326 396326 N_multimapping 331430 331430 331430 N_noFeature 467344 11882549 518272 N_ambiguous 180861 657 83853 UnstrandedReadsAssigned:11381975 PositiveStrandReadsAssigned:146974 NegativeStrandReadsAssigned:11428055 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671004 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671004-trimmed-pair1.fastq SRR12671004-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,757,936 reads, 11,418,175 reads pseudoaligned [quant] estimated average fragment length: 281.58 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR12671004.ke.tsv 34699 SRR12671004.se.tsv 87100 total ==> SRR12671004.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.42 454 22.7143 Potri.005G024800.1.v4.1 1035 754.42 213 24.5423 Potri.004G059700.1.v4.1 961 680.682 5 0.63852 Potri.007G009000.2.v4.1 1416 1135.42 0 0 Potri.003G141000.2.v4.1 2943 2662.42 582 19.0018 Potri.016G087400.1.v4.1 270 77.1462 604 680.567 Potri.015G069301.1.v4.1 564 302.805 0 0 Potri.010G195200.1.v4.1 1773 1492.42 81 4.71783 Potri.012G127500.1.v4.1 977 696.535 173 21.5899 ==> SRR12671004.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 616 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671004 completed mapping pipeline successfully