Starting /dee2/code/volunteer_pipeline.sh SRR12671005 current disk space = 3050666377216 free memory = 1463851444 SRR12671005 SRAfilesize f29055c7d5a7d535f54388a2c3796779 SRR12671005.sra SRR12671005.sra file validated SRR12671005 is paired end SRR12671005 is conventional basespace SRR12671005 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671005_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3355 37.0 37.0 37.0 37.0 37.0 2 36.4505 37.0 37.0 37.0 37.0 37.0 3 36.558 37.0 37.0 37.0 37.0 37.0 4 36.5305 37.0 37.0 37.0 37.0 37.0 5 36.512 37.0 37.0 37.0 37.0 37.0 6 36.652 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.659 37.0 37.0 37.0 37.0 37.0 9 36.607 37.0 37.0 37.0 37.0 37.0 10-14 36.63530000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6073 37.0 37.0 37.0 37.0 37.0 20-24 36.542899999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.531499999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4624 37.0 37.0 37.0 37.0 37.0 35-39 36.4764 37.0 37.0 37.0 37.0 37.0 40-44 36.4668 37.0 37.0 37.0 37.0 37.0 45-49 36.397999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3808 37.0 37.0 37.0 37.0 37.0 55-59 36.365300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3208 37.0 37.0 37.0 37.0 37.0 65-69 36.3184 37.0 37.0 37.0 37.0 37.0 70-74 36.3194 37.0 37.0 37.0 37.0 37.0 75-79 36.289 37.0 37.0 37.0 37.0 37.0 80-84 36.2417 37.0 37.0 37.0 37.0 37.0 85-89 36.25279999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.209199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.148 37.0 37.0 37.0 37.0 37.0 100-104 36.130399999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1086 37.0 37.0 37.0 37.0 37.0 110-114 36.0677 37.0 37.0 37.0 37.0 37.0 115-119 36.01625 37.0 37.0 37.0 37.0 37.0 120-124 35.965799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9893 37.0 37.0 37.0 37.0 37.0 130-134 35.8667 37.0 37.0 37.0 37.0 37.0 135-139 35.906400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.785700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6631 37.0 37.0 37.0 37.0 37.0 150-151 35.45925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 3.0 22 0.0 23 3.0 24 1.0 25 7.0 26 7.0 27 9.0 28 15.0 29 17.0 30 26.0 31 37.0 32 73.0 33 82.0 34 109.0 35 265.0 36 2710.0 37 635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.45 11.200000000000001 5.775 37.574999999999996 2 17.9 11.425 39.275 31.4 3 17.849999999999998 14.899999999999999 28.449999999999996 38.800000000000004 4 22.35 22.675 24.3 30.675 5 23.400000000000002 29.675 25.074999999999996 21.85 6 20.150000000000002 33.5 23.05 23.3 7 15.55 26.85 40.975 16.625 8 16.400000000000002 25.374999999999996 34.175 24.05 9 17.05 23.974999999999998 35.05 23.925 10-14 19.314999999999998 30.320000000000004 28.244999999999997 22.12 15-19 19.55 28.16 27.74 24.55 20-24 19.675 28.59 28.4 23.335 25-29 19.42 28.299999999999997 28.444999999999997 23.835 30-34 19.825 28.57 27.93 23.674999999999997 35-39 20.01 28.42 27.99 23.580000000000002 40-44 20.315 28.83 27.894999999999996 22.96 45-49 20.044999999999998 28.335 27.865000000000002 23.755000000000003 50-54 20.349999999999998 28.055000000000003 27.92 23.674999999999997 55-59 20.745 27.884999999999998 27.955000000000002 23.415 60-64 19.79 28.46 28.025 23.724999999999998 65-69 20.62 27.935 27.92 23.525 70-74 20.465 28.265 27.735 23.535 75-79 19.63 28.76 27.705000000000002 23.905 80-84 20.57 28.42 27.525 23.485 85-89 20.349999999999998 28.555000000000003 27.605 23.49 90-94 20.66 28.249999999999996 27.439999999999998 23.65 95-99 20.125 28.499999999999996 28.249999999999996 23.125 100-104 20.32 28.835 28.055000000000003 22.79 105-109 20.64 28.134999999999998 28.225 23.0 110-114 20.995 28.42 27.58 23.005 115-119 20.536026801340068 28.66143307165358 27.456372818640933 23.346167308365416 120-124 20.44 27.994999999999997 27.650000000000002 23.915 125-129 20.45 29.044999999999998 27.02 23.485 130-134 20.52 27.66 28.23 23.59 135-139 20.5 28.64 27.395000000000003 23.465 140-144 20.54 27.839999999999996 28.02 23.599999999999998 145-149 20.622062206220622 28.027802780278027 27.88278827882788 23.467346734673466 150-151 20.45 29.349999999999998 26.9125 23.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.5 17 2.5 18 2.0 19 0.5 20 0.5 21 2.0 22 2.0 23 0.5 24 2.0 25 5.5 26 9.0 27 11.0 28 12.5 29 17.0 30 22.5 31 24.0 32 32.5 33 38.0 34 44.5 35 72.0 36 92.5 37 96.0 38 109.0 39 146.5 40 178.5 41 206.5 42 237.5 43 253.0 44 265.0 45 266.0 46 255.0 47 252.5 48 261.0 49 236.0 50 191.0 51 158.5 52 125.5 53 101.5 54 79.5 55 47.5 56 35.5 57 30.0 58 14.5 59 15.5 60 15.5 61 7.0 62 4.5 63 3.5 64 2.0 65 2.0 66 2.5 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.64311344189898 82.1 2 8.473640629312724 15.35 3 0.7176373171404914 1.95 4 0.1656086116478057 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.8875000000000002 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.3499999999999996 0.0 0.0 0.0 0.0 132-133 2.5625 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAAGT 10 0.006830828 145.0 9 >>END_MODULE SRR12671005 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671005_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.312 37.0 37.0 37.0 37.0 37.0 2 36.3065 37.0 37.0 37.0 37.0 37.0 3 36.317 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.464 37.0 37.0 37.0 37.0 37.0 6 36.3725 37.0 37.0 37.0 37.0 37.0 7 36.318 37.0 37.0 37.0 37.0 37.0 8 36.4385 37.0 37.0 37.0 37.0 37.0 9 36.434 37.0 37.0 37.0 37.0 37.0 10-14 36.3891 37.0 37.0 37.0 37.0 37.0 15-19 36.402699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.42379999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.323299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.352599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.275099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.2611 37.0 37.0 37.0 37.0 37.0 45-49 36.2528 37.0 37.0 37.0 37.0 37.0 50-54 36.2447 37.0 37.0 37.0 37.0 37.0 55-59 36.1909 37.0 37.0 37.0 37.0 37.0 60-64 36.1714 37.0 37.0 37.0 37.0 37.0 65-69 36.22539999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.1254 37.0 37.0 37.0 37.0 37.0 75-79 36.1091 37.0 37.0 37.0 37.0 37.0 80-84 36.1005 37.0 37.0 37.0 37.0 37.0 85-89 36.08385 37.0 37.0 37.0 37.0 37.0 90-94 36.1035 37.0 37.0 37.0 37.0 37.0 95-99 36.1109 37.0 37.0 37.0 37.0 37.0 100-104 36.1175 37.0 37.0 37.0 37.0 37.0 105-109 36.0305 37.0 37.0 37.0 37.0 37.0 110-114 35.9311 37.0 37.0 37.0 37.0 37.0 115-119 35.92655 37.0 37.0 37.0 37.0 37.0 120-124 35.8711 37.0 37.0 37.0 37.0 37.0 125-129 35.8207 37.0 37.0 37.0 37.0 37.0 130-134 35.8403 37.0 37.0 37.0 37.0 37.0 135-139 35.795500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.71105 37.0 37.0 37.0 37.0 37.0 145-149 35.5558 37.0 37.0 37.0 37.0 37.0 150-151 35.2445 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 2.0 16 0.0 17 0.0 18 0.0 19 3.0 20 2.0 21 2.0 22 3.0 23 3.0 24 7.0 25 4.0 26 6.0 27 9.0 28 11.0 29 24.0 30 25.0 31 40.0 32 45.0 33 79.0 34 141.0 35 370.0 36 2680.0 37 537.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.975 23.974999999999998 9.475 26.575 2 27.35 25.45 32.05 15.15 3 19.575 28.425 34.2 17.8 4 22.875 33.75 23.724999999999998 19.650000000000002 5 25.624999999999996 36.525 21.975 15.875 6 19.675 39.85 21.775 18.7 7 19.875 22.05 39.35 18.725 8 18.85 26.125 30.049999999999997 24.975 9 20.525 25.424999999999997 30.85 23.200000000000003 10-14 22.795 29.125 27.029999999999998 21.05 15-19 22.825 28.515 27.189999999999998 21.47 20-24 22.37 29.104999999999997 27.875 20.65 25-29 21.895 28.794999999999998 28.794999999999998 20.515 30-34 22.23 27.63 28.82 21.32 35-39 22.96 28.939999999999998 27.495000000000005 20.605 40-44 22.125 28.515 28.310000000000002 21.05 45-49 22.625 28.095 28.09 21.19 50-54 22.825 27.944999999999997 28.4 20.830000000000002 55-59 22.525000000000002 27.76 28.035 21.68 60-64 22.99 28.000000000000004 27.74 21.27 65-69 22.915 28.21 27.644999999999996 21.23 70-74 23.44 27.42 28.095 21.044999999999998 75-79 22.52 28.384999999999998 27.744999999999997 21.349999999999998 80-84 23.035 27.6 28.365000000000002 21.0 85-89 23.12615630781539 28.281414070703537 27.51137556877844 21.081054052702637 90-94 23.275000000000002 27.584999999999997 27.87 21.27 95-99 22.91 28.22 28.175 20.695 100-104 23.150000000000002 28.965000000000003 27.894999999999996 19.99 105-109 22.68 28.610000000000003 27.845 20.865000000000002 110-114 23.445 28.205000000000002 27.655 20.695 115-119 23.186159307965397 28.72643632181609 27.67138356917846 20.41602080104005 120-124 23.665 28.24 27.750000000000004 20.345 125-129 23.845 28.02 27.750000000000004 20.385 130-134 23.455000000000002 28.13 27.650000000000002 20.765 135-139 23.48 28.375 27.765 20.380000000000003 140-144 24.07120356017801 27.91139556977849 27.751387569378466 20.266013300665033 145-149 24.93 27.515 27.51 20.044999999999998 150-151 24.349999999999998 27.737499999999997 27.275 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 3.5 24 4.5 25 7.5 26 9.0 27 8.0 28 10.0 29 17.0 30 28.5 31 30.0 32 30.5 33 37.0 34 46.5 35 70.0 36 99.5 37 110.0 38 126.0 39 162.5 40 199.0 41 229.5 42 267.0 43 273.0 44 252.0 45 254.5 46 250.0 47 247.0 48 226.0 49 201.5 50 175.0 51 144.5 52 122.5 53 99.0 54 78.5 55 49.5 56 30.0 57 23.5 58 17.5 59 11.5 60 9.0 61 5.5 62 4.5 63 4.0 64 2.5 65 2.0 66 3.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.72079536039767 82.125 2 8.312620822977077 15.049999999999999 3 0.7732670533001933 2.1 4 0.16570008285004142 0.6 5 0.027616680475006903 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.0999999999999996 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACGC 10 0.006830828 145.0 7 >>END_MODULE Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614131 spots for SRR12671005.sra Written 614131 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra Read 614116 spots for SRR12671005.sra Written 614116 spots for SRR12671005.sra SRR ids: ['SRR12671005.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_he08e11v SRR12671005.sra spots: 12282335 blocks: [[1, 614116], [614117, 1228232], [1228233, 1842348], [1842349, 2456464], [2456465, 3070580], [3070581, 3684696], [3684697, 4298812], [4298813, 4912928], [4912929, 5527044], [5527045, 6141160], [6141161, 6755276], [6755277, 7369392], [7369393, 7983508], [7983509, 8597624], [8597625, 9211740], [9211741, 9825856], [9825857, 10439972], [10439973, 11054088], [11054089, 11668204], [11668205, 12282335]] SRR12671005 file size 4152374 SRR12671005 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671005 SRR12671005_1.fastq SRR12671005_2.fastq Input file: SRR12671005_1.fastq Paired file: SRR12671005_2.fastq trimmed: SRR12671005-trimmed-pair1.fastq, SRR12671005-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:55:21 2025 >> started Tue Feb 11 12:55:42 2025 >> done (20.781s) 12282335 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 2128 ( 0.02%) empty read pairs filtered out after trimming by size control 12280152 (99.98%) read pairs available; of these: 654052 ( 5.33%) trimmed read pairs available after processing 11626100 (94.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 5 0.00% 21 11 0.00% 22 10 0.00% 23 6 0.00% 24 6 0.00% 25 9 0.00% 26 8 0.00% 27 14 0.00% 28 10 0.00% 29 11 0.00% 30 8 0.00% 31 18 0.00% 32 21 0.00% 33 13 0.00% 34 17 0.00% 35 15 0.00% 36 18 0.00% 37 20 0.00% 38 15 0.00% 39 19 0.00% 40 16 0.00% 41 22 0.00% 42 16 0.00% 43 26 0.00% 44 14 0.00% 45 18 0.00% 46 14 0.00% 47 26 0.00% 48 25 0.00% 49 34 0.00% 50 44 0.00% 51 42 0.00% 52 55 0.00% 53 58 0.00% 54 54 0.00% 55 43 0.00% 56 67 0.00% 57 71 0.00% 58 81 0.00% 59 87 0.00% 60 90 0.00% 61 152 0.00% 62 147 0.00% 63 137 0.00% 64 183 0.00% 65 176 0.00% 66 180 0.00% 67 248 0.00% 68 238 0.00% 69 284 0.00% 70 318 0.00% 71 349 0.00% 72 431 0.00% 73 452 0.00% 74 542 0.00% 75 568 0.00% 76 616 0.01% 77 740 0.01% 78 793 0.01% 79 905 0.01% 80 975 0.01% 81 1052 0.01% 82 1179 0.01% 83 1437 0.01% 84 1497 0.01% 85 1541 0.01% 86 1755 0.01% 87 1899 0.02% 88 1994 0.02% 89 2117 0.02% 90 2416 0.02% 91 2554 0.02% 92 2621 0.02% 93 2934 0.02% 94 3117 0.03% 95 3327 0.03% 96 3600 0.03% 97 3734 0.03% 98 3781 0.03% 99 4042 0.03% 100 4388 0.04% 101 4501 0.04% 102 4784 0.04% 103 4994 0.04% 104 5281 0.04% 105 5397 0.04% 106 5768 0.05% 107 5863 0.05% 108 6158 0.05% 109 6385 0.05% 110 6701 0.05% 111 6910 0.06% 112 7132 0.06% 113 7158 0.06% 114 7725 0.06% 115 8007 0.07% 116 8330 0.07% 117 8573 0.07% 118 9144 0.07% 119 9194 0.07% 120 9727 0.08% 121 10101 0.08% 122 10295 0.08% 123 10722 0.09% 124 10676 0.09% 125 11001 0.09% 126 11624 0.09% 127 12034 0.10% 128 12380 0.10% 129 12569 0.10% 130 13181 0.11% 131 13212 0.11% 132 13816 0.11% 133 13973 0.11% 134 14162 0.12% 135 14790 0.12% 136 15134 0.12% 137 15595 0.13% 138 15907 0.13% 139 16603 0.14% 140 16995 0.14% 141 17190 0.14% 142 17607 0.14% 143 17845 0.15% 144 18524 0.15% 145 18926 0.15% 146 19368 0.16% 147 19466 0.16% 148 20554 0.17% 149 20513 0.17% 150 20975 0.17% 151 11626100 94.67% 12280152 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.59 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=10.13 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.0 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=32 prefix-density=0.72 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=34.54 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12671005 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:56:31 Started mapping on | Feb 11 12:56:31 Finished on | Feb 11 12:58:14 Mapping speed, Million of reads per hour | 429.21 Number of input reads | 12280152 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11627689 Uniquely mapped reads % | 94.69% Average mapped length | 298.12 Number of splices: Total | 11707951 Number of splices: Annotated (sjdb) | 11481212 Number of splices: GT/AG | 11470457 Number of splices: GC/AG | 200256 Number of splices: AT/AC | 6739 Number of splices: Non-canonical | 30499 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279689 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 34205 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 372774 372774 372774 N_multimapping 279689 279689 279689 N_noFeature 470590 11477201 522552 N_ambiguous 172055 637 73274 UnstrandedReadsAssigned:10985044 PositiveStrandReadsAssigned:149851 NegativeStrandReadsAssigned:11031863 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671005 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671005-trimmed-pair1.fastq SRR12671005-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,280,152 reads, 11,016,641 reads pseudoaligned [quant] estimated average fragment length: 286.487 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12671005.ke.tsv 34699 SRR12671005.se.tsv 87100 total ==> SRR12671005.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.51 356 17.562 Potri.005G024800.1.v4.1 1035 749.513 128 14.5959 Potri.004G059700.1.v4.1 961 675.779 1 0.126473 Potri.007G009000.2.v4.1 1416 1130.51 0 0 Potri.003G141000.2.v4.1 2943 2657.51 680 21.8693 Potri.016G087400.1.v4.1 270 72.712 592 695.851 Potri.015G069301.1.v4.1 564 296.081 0 0 Potri.010G195200.1.v4.1 1773 1487.51 24 1.37896 Potri.012G127500.1.v4.1 977 691.658 27 3.33636 ==> SRR12671005.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671005 completed mapping pipeline successfully