Starting /dee2/code/volunteer_pipeline.sh SRR12671006 current disk space = 3050619543552 free memory = 1468200496 SRR12671006 SRAfilesize c4b5f89309323b744e1e71a3f03f8dae SRR12671006.sra SRR12671006.sra file validated SRR12671006 is paired end SRR12671006 is conventional basespace SRR12671006 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671006_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.40575 37.0 37.0 37.0 37.0 37.0 2 36.2825 37.0 37.0 37.0 37.0 37.0 3 36.5375 37.0 37.0 37.0 37.0 37.0 4 36.6455 37.0 37.0 37.0 37.0 37.0 5 36.7075 37.0 37.0 37.0 37.0 37.0 6 36.577 37.0 37.0 37.0 37.0 37.0 7 36.486 37.0 37.0 37.0 37.0 37.0 8 36.6395 37.0 37.0 37.0 37.0 37.0 9 36.657 37.0 37.0 37.0 37.0 37.0 10-14 36.6356 37.0 37.0 37.0 37.0 37.0 15-19 36.590799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.513 37.0 37.0 37.0 37.0 37.0 25-29 36.5434 37.0 37.0 37.0 37.0 37.0 30-34 36.471500000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4413 37.0 37.0 37.0 37.0 37.0 40-44 36.424800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3697 37.0 37.0 37.0 37.0 37.0 50-54 36.3525 37.0 37.0 37.0 37.0 37.0 55-59 36.321999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3083 37.0 37.0 37.0 37.0 37.0 65-69 36.2677 37.0 37.0 37.0 37.0 37.0 70-74 36.288 37.0 37.0 37.0 37.0 37.0 75-79 36.2322 37.0 37.0 37.0 37.0 37.0 80-84 36.1913 37.0 37.0 37.0 37.0 37.0 85-89 36.208000000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1765 37.0 37.0 37.0 37.0 37.0 95-99 36.14110000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1152 37.0 37.0 37.0 37.0 37.0 105-109 36.123000000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1262 37.0 37.0 37.0 37.0 37.0 115-119 36.037 37.0 37.0 37.0 37.0 37.0 120-124 35.98100000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9781 37.0 37.0 37.0 37.0 37.0 130-134 35.870099999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.855599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.791500000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.7125 37.0 37.0 37.0 37.0 37.0 150-151 35.532 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 4.0 24 5.0 25 2.0 26 8.0 27 10.0 28 16.0 29 19.0 30 32.0 31 40.0 32 60.0 33 71.0 34 115.0 35 254.0 36 2725.0 37 634.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.88597149287322 10.72768192048012 5.626406601650412 39.75993998499625 2 17.775 11.3 40.025 30.9 3 17.5 16.150000000000002 27.875 38.475 4 22.875 23.375 23.35 30.4 5 23.875 29.75 24.725 21.65 6 20.225 33.35 23.875 22.55 7 14.899999999999999 27.250000000000004 41.725 16.125 8 15.975 26.424999999999997 34.325 23.275000000000002 9 15.725 23.3 37.375 23.599999999999998 10-14 19.295 30.17 28.34 22.195 15-19 19.950000000000003 27.755000000000003 28.43 23.865 20-24 20.49 28.265 28.310000000000002 22.935 25-29 20.06 27.38 28.965000000000003 23.595 30-34 19.67 28.52 28.415000000000003 23.395 35-39 19.775000000000002 28.68 27.794999999999998 23.75 40-44 20.225 28.560000000000002 27.755000000000003 23.46 45-49 19.505 28.57 28.275 23.65 50-54 20.19 28.285 27.93 23.595 55-59 20.02 29.125 27.534999999999997 23.32 60-64 20.52 27.74 28.005000000000003 23.735 65-69 20.119999999999997 28.560000000000002 28.28 23.04 70-74 20.330000000000002 28.365000000000002 27.775 23.53 75-79 19.830000000000002 28.449999999999996 27.779999999999998 23.94 80-84 20.09 28.305000000000003 27.855 23.75 85-89 20.02 28.62 27.295 24.065 90-94 20.015 28.310000000000002 28.055000000000003 23.62 95-99 19.919999999999998 28.449999999999996 27.925 23.705000000000002 100-104 20.27 29.095 27.589999999999996 23.044999999999998 105-109 20.505000000000003 28.13 28.16 23.205000000000002 110-114 20.13 28.525 28.185 23.16 115-119 20.21 28.645 27.725 23.419999999999998 120-124 20.605 28.58 27.365000000000002 23.45 125-129 20.69 28.925 27.29 23.095 130-134 20.94 28.215 27.62 23.225 135-139 20.77 28.115000000000002 27.775 23.34 140-144 21.279999999999998 28.42 27.250000000000004 23.05 145-149 20.285 28.355000000000004 27.450000000000003 23.91 150-151 20.9875 27.950000000000003 27.6 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 2.0 9 2.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 1.0 18 2.5 19 2.0 20 1.0 21 1.0 22 1.5 23 3.5 24 4.5 25 4.0 26 7.5 27 8.0 28 5.5 29 13.0 30 25.0 31 31.5 32 35.0 33 37.5 34 55.0 35 79.0 36 88.5 37 99.0 38 119.0 39 147.0 40 180.5 41 213.5 42 237.5 43 264.5 44 282.0 45 274.5 46 269.0 47 239.0 48 210.0 49 202.5 50 172.0 51 146.0 52 122.0 53 91.5 54 75.0 55 63.5 56 49.5 57 39.0 58 28.0 59 18.0 60 12.0 61 8.0 62 5.5 63 3.5 64 2.5 65 1.5 66 2.0 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.67803547066849 84.0 2 7.557980900409277 13.850000000000001 3 0.7094133697135061 1.95 4 0.054570259208731244 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.3625 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCATG 10 0.006830828 145.0 6 CCATCAA 10 0.006830828 145.0 3 TCATGCT 10 0.006830828 145.0 8 GCAGAAT 10 0.006830828 145.0 2 GAATCAT 10 0.006830828 145.0 5 CAGAATC 10 0.006830828 145.0 3 GGCAGAA 10 0.006830828 145.0 1 CATGCTG 10 0.006830828 145.0 9 >>END_MODULE SRR12671006 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671006_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1795 37.0 37.0 37.0 37.0 37.0 2 36.297 37.0 37.0 37.0 37.0 37.0 3 36.25 37.0 37.0 37.0 37.0 37.0 4 36.2205 37.0 37.0 37.0 37.0 37.0 5 36.3585 37.0 37.0 37.0 37.0 37.0 6 36.393 37.0 37.0 37.0 37.0 37.0 7 36.2565 37.0 37.0 37.0 37.0 37.0 8 36.3565 37.0 37.0 37.0 37.0 37.0 9 36.2525 37.0 37.0 37.0 37.0 37.0 10-14 36.319900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3601 37.0 37.0 37.0 37.0 37.0 20-24 36.341100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.247299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.2461 37.0 37.0 37.0 37.0 37.0 35-39 36.204499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.188100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.230500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1428 37.0 37.0 37.0 37.0 37.0 55-59 36.178399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1665 37.0 37.0 37.0 37.0 37.0 65-69 36.1498 37.0 37.0 37.0 37.0 37.0 70-74 36.0797 37.0 37.0 37.0 37.0 37.0 75-79 35.9922 37.0 37.0 37.0 37.0 37.0 80-84 36.0684 37.0 37.0 37.0 37.0 37.0 85-89 35.9822 37.0 37.0 37.0 37.0 37.0 90-94 36.002700000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.9881 37.0 37.0 37.0 37.0 37.0 100-104 35.9829 37.0 37.0 37.0 37.0 37.0 105-109 35.8512 37.0 37.0 37.0 37.0 37.0 110-114 35.82940000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8378 37.0 37.0 37.0 37.0 37.0 120-124 35.724000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6191 37.0 37.0 37.0 37.0 37.0 130-134 35.721199999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.64379999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.5762 37.0 37.0 37.0 37.0 37.0 145-149 35.4063 37.0 37.0 37.0 37.0 37.0 150-151 35.152 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 4.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 5.0 22 3.0 23 5.0 24 3.0 25 17.0 26 10.0 27 13.0 28 23.0 29 16.0 30 35.0 31 36.0 32 57.0 33 89.0 34 141.0 35 402.0 36 2645.0 37 492.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.8 23.65 9.125 26.424999999999997 2 27.200000000000003 23.599999999999998 33.675 15.525 3 18.3 27.425 35.525 18.75 4 23.075000000000003 34.475 23.25 19.2 5 24.925 37.15 21.9 16.025 6 20.225 39.425 22.425 17.925 7 20.4 22.425 38.574999999999996 18.6 8 18.025 25.8 31.574999999999996 24.6 9 20.875 23.849999999999998 31.55 23.724999999999998 10-14 22.74 29.24 27.439999999999998 20.580000000000002 15-19 22.91 28.804999999999996 27.48 20.805 20-24 22.115000000000002 29.115000000000002 28.115000000000002 20.655 25-29 22.105 28.244999999999997 28.660000000000004 20.990000000000002 30-34 22.55 28.175 28.77 20.505000000000003 35-39 22.705000000000002 28.005000000000003 27.725 21.565 40-44 22.405 28.505000000000003 28.384999999999998 20.705000000000002 45-49 22.73 27.839999999999996 28.615000000000002 20.815 50-54 22.45 27.975 28.37 21.205 55-59 22.919999999999998 27.77 27.689999999999998 21.62 60-64 21.925 27.465 29.005 21.605 65-69 22.74 27.755000000000003 28.494999999999997 21.01 70-74 22.58 28.84 27.805000000000003 20.775 75-79 22.58 27.55 28.449999999999996 21.42 80-84 22.505 28.255000000000003 27.985 21.255 85-89 22.605 28.4 27.975 21.02 90-94 23.055 28.315 27.97 20.66 95-99 22.84 28.01 28.194999999999997 20.955 100-104 23.605 28.015 27.82 20.560000000000002 105-109 22.93 28.849999999999998 27.52 20.7 110-114 23.135 28.249999999999996 28.205000000000002 20.41 115-119 23.43 28.904999999999998 27.055 20.61 120-124 23.84 28.715000000000003 26.950000000000003 20.495 125-129 22.759999999999998 28.505000000000003 27.715 21.02 130-134 23.66 27.905 27.655 20.78 135-139 23.53 28.060000000000002 27.775 20.635 140-144 24.16 27.445000000000004 28.02 20.375 145-149 24.15 28.134999999999998 27.785 19.93 150-151 25.0 28.075 26.887499999999996 20.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 1.0 13 3.0 14 2.5 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 1.0 21 2.0 22 1.5 23 2.5 24 6.5 25 7.0 26 9.0 27 10.5 28 12.5 29 17.0 30 19.0 31 22.0 32 31.5 33 45.0 34 56.0 35 70.0 36 96.5 37 131.5 38 148.0 39 164.0 40 189.5 41 230.0 42 275.5 43 284.0 44 276.5 45 260.0 46 240.5 47 225.5 48 198.0 49 184.0 50 164.0 51 135.5 52 111.0 53 77.0 54 63.5 55 54.5 56 38.0 57 31.5 58 26.5 59 20.5 60 14.5 61 8.0 62 4.5 63 2.5 64 2.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.58212229229503 83.5 2 7.540444200712915 13.750000000000002 3 0.7403345215245407 2.025 4 0.054839594187003016 0.2 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.027419797093501508 0.17500000000000002 8 0.0 0.0 9 0.027419797093501508 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.4875 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAAAG 10 0.006830828 145.0 3 GATTGCT 10 0.006830828 145.0 9 GCTCATT 10 0.006830828 145.0 1 >>END_MODULE Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431171 spots for SRR12671006.sra Written 431171 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra Read 431158 spots for SRR12671006.sra Written 431158 spots for SRR12671006.sra SRR ids: ['SRR12671006.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bkgb1qb SRR12671006.sra spots: 8623173 blocks: [[1, 431158], [431159, 862316], [862317, 1293474], [1293475, 1724632], [1724633, 2155790], [2155791, 2586948], [2586949, 3018106], [3018107, 3449264], [3449265, 3880422], [3880423, 4311580], [4311581, 4742738], [4742739, 5173896], [5173897, 5605054], [5605055, 6036212], [6036213, 6467370], [6467371, 6898528], [6898529, 7329686], [7329687, 7760844], [7760845, 8192002], [8192003, 8623173]] SRR12671006 file size 2911520 SRR12671006 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671006 SRR12671006_1.fastq SRR12671006_2.fastq Input file: SRR12671006_1.fastq Paired file: SRR12671006_2.fastq trimmed: SRR12671006-trimmed-pair1.fastq, SRR12671006-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:50:46 2025 >> started Tue Feb 11 12:50:55 2025 >> done (9.530s) 8623173 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 1472 ( 0.02%) empty read pairs filtered out after trimming by size control 8621650 (99.98%) read pairs available; of these: 421160 ( 4.88%) trimmed read pairs available after processing 8200490 (95.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 8 0.00% 26 6 0.00% 27 13 0.00% 28 7 0.00% 29 2 0.00% 30 11 0.00% 31 8 0.00% 32 7 0.00% 33 7 0.00% 34 11 0.00% 35 10 0.00% 36 9 0.00% 37 13 0.00% 38 6 0.00% 39 12 0.00% 40 11 0.00% 41 12 0.00% 42 7 0.00% 43 9 0.00% 44 8 0.00% 45 7 0.00% 46 10 0.00% 47 12 0.00% 48 16 0.00% 49 15 0.00% 50 19 0.00% 51 17 0.00% 52 25 0.00% 53 31 0.00% 54 21 0.00% 55 30 0.00% 56 27 0.00% 57 42 0.00% 58 46 0.00% 59 39 0.00% 60 55 0.00% 61 46 0.00% 62 73 0.00% 63 64 0.00% 64 68 0.00% 65 72 0.00% 66 100 0.00% 67 125 0.00% 68 126 0.00% 69 132 0.00% 70 164 0.00% 71 211 0.00% 72 223 0.00% 73 247 0.00% 74 288 0.00% 75 328 0.00% 76 339 0.00% 77 374 0.00% 78 361 0.00% 79 462 0.01% 80 501 0.01% 81 567 0.01% 82 628 0.01% 83 662 0.01% 84 794 0.01% 85 919 0.01% 86 949 0.01% 87 1059 0.01% 88 1147 0.01% 89 1235 0.01% 90 1295 0.02% 91 1465 0.02% 92 1544 0.02% 93 1616 0.02% 94 1799 0.02% 95 1960 0.02% 96 2058 0.02% 97 2268 0.03% 98 2157 0.03% 99 2428 0.03% 100 2639 0.03% 101 2774 0.03% 102 2910 0.03% 103 3088 0.04% 104 3194 0.04% 105 3385 0.04% 106 3476 0.04% 107 3660 0.04% 108 3810 0.04% 109 4009 0.05% 110 4177 0.05% 111 4305 0.05% 112 4587 0.05% 113 4699 0.05% 114 4871 0.06% 115 5002 0.06% 116 5217 0.06% 117 5565 0.06% 118 5684 0.07% 119 5998 0.07% 120 6208 0.07% 121 6399 0.07% 122 6526 0.08% 123 6883 0.08% 124 7142 0.08% 125 7231 0.08% 126 7508 0.09% 127 7715 0.09% 128 7964 0.09% 129 8291 0.10% 130 8727 0.10% 131 8663 0.10% 132 8817 0.10% 133 9043 0.10% 134 9451 0.11% 135 9744 0.11% 136 10116 0.12% 137 10167 0.12% 138 10441 0.12% 139 10908 0.13% 140 11048 0.13% 141 11440 0.13% 142 11610 0.13% 143 11902 0.14% 144 12274 0.14% 145 12703 0.15% 146 12750 0.15% 147 13302 0.15% 148 13628 0.16% 149 13879 0.16% 150 14156 0.16% 151 8200490 95.12% 8621650 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=18 prefix-density=0.36 prefix-fanout=2.3 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=33.18 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.4 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=29 prefix-density=0.67 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=38.42 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=12.4 sequence=AAAGAAAAGAAAA SRR12671006 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:51:45 Started mapping on | Feb 11 12:51:45 Finished on | Feb 11 12:52:55 Mapping speed, Million of reads per hour | 443.40 Number of input reads | 8621650 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 7975256 Uniquely mapped reads % | 92.50% Average mapped length | 298.23 Number of splices: Total | 7875880 Number of splices: Annotated (sjdb) | 7705579 Number of splices: GT/AG | 7718627 Number of splices: GC/AG | 127776 Number of splices: AT/AC | 4940 Number of splices: Non-canonical | 24537 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214996 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 76152 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 431398 431398 431398 N_multimapping 214996 214996 214996 N_noFeature 360780 7861204 396068 N_ambiguous 134793 556 55691 UnstrandedReadsAssigned:7479683 PositiveStrandReadsAssigned:113496 NegativeStrandReadsAssigned:7523497 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671006 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671006-trimmed-pair1.fastq SRR12671006-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,621,650 reads, 7,549,295 reads pseudoaligned [quant] estimated average fragment length: 295.805 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR12671006.ke.tsv 34699 SRR12671006.se.tsv 87100 total ==> SRR12671006.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.19 261 18.2256 Potri.005G024800.1.v4.1 1035 740.195 172 27.9614 Potri.004G059700.1.v4.1 961 666.551 1 0.180528 Potri.007G009000.2.v4.1 1416 1121.19 0 0 Potri.003G141000.2.v4.1 2943 2648.19 626 28.4447 Potri.016G087400.1.v4.1 270 72.3809 415 689.923 Potri.015G069301.1.v4.1 564 291.445 0 0 Potri.010G195200.1.v4.1 1773 1478.19 38 3.09335 Potri.012G127500.1.v4.1 977 682.416 56 9.87451 ==> SRR12671006.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 146 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671006 completed mapping pipeline successfully