Starting /dee2/code/volunteer_pipeline.sh SRR12671007 current disk space = 3050616688640 free memory = 1509666340 SRR12671007 SRAfilesize a07880e20f768b43808adc259cd51b58 SRR12671007.sra SRR12671007.sra file validated SRR12671007 is paired end SRR12671007 is conventional basespace SRR12671007 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671007_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42725 37.0 37.0 37.0 37.0 37.0 2 36.463 37.0 37.0 37.0 37.0 37.0 3 36.5455 37.0 37.0 37.0 37.0 37.0 4 36.6375 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.6865 37.0 37.0 37.0 37.0 37.0 7 36.574 37.0 37.0 37.0 37.0 37.0 8 36.6215 37.0 37.0 37.0 37.0 37.0 9 36.5765 37.0 37.0 37.0 37.0 37.0 10-14 36.65069999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.630900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5911 37.0 37.0 37.0 37.0 37.0 25-29 36.5829 37.0 37.0 37.0 37.0 37.0 30-34 36.507999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4596 37.0 37.0 37.0 37.0 37.0 40-44 36.48199999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4288 37.0 37.0 37.0 37.0 37.0 50-54 36.429899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.421499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3543 37.0 37.0 37.0 37.0 37.0 65-69 36.3435 37.0 37.0 37.0 37.0 37.0 70-74 36.32190000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3324 37.0 37.0 37.0 37.0 37.0 80-84 36.2541 37.0 37.0 37.0 37.0 37.0 85-89 36.2539 37.0 37.0 37.0 37.0 37.0 90-94 36.2217 37.0 37.0 37.0 37.0 37.0 95-99 36.1896 37.0 37.0 37.0 37.0 37.0 100-104 36.1783 37.0 37.0 37.0 37.0 37.0 105-109 36.1573 37.0 37.0 37.0 37.0 37.0 110-114 36.1702 37.0 37.0 37.0 37.0 37.0 115-119 36.1205 37.0 37.0 37.0 37.0 37.0 120-124 36.0827 37.0 37.0 37.0 37.0 37.0 125-129 36.0414 37.0 37.0 37.0 37.0 37.0 130-134 35.90310000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.924699999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.889700000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.763299999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.536249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 4.0 22 5.0 23 1.0 24 1.0 25 5.0 26 10.0 27 5.0 28 16.0 29 19.0 30 23.0 31 22.0 32 61.0 33 74.0 34 121.0 35 234.0 36 2694.0 37 703.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.3615903975994 11.40285071267817 6.22655663915979 36.00900225056264 2 19.45 11.575000000000001 35.575 33.4 3 18.075 15.9 27.150000000000002 38.875 4 22.375 22.55 23.5 31.574999999999996 5 24.474999999999998 29.2 24.375 21.95 6 21.05 32.550000000000004 23.200000000000003 23.200000000000003 7 15.65 26.625 41.65 16.075 8 16.325 25.074999999999996 33.7 24.9 9 17.95 23.400000000000002 34.925 23.724999999999998 10-14 19.29 29.67 28.199999999999996 22.84 15-19 19.925 27.955000000000002 28.325 23.794999999999998 20-24 19.79 28.275 28.754999999999995 23.18 25-29 20.36 28.110000000000003 27.955000000000002 23.575 30-34 20.035 28.560000000000002 27.42 23.985 35-39 19.66 28.854999999999997 27.665 23.82 40-44 20.375 29.099999999999998 27.265 23.26 45-49 20.24 28.015 27.685 24.060000000000002 50-54 20.205000000000002 28.27 27.834999999999997 23.69 55-59 19.580000000000002 28.82 27.61 23.990000000000002 60-64 20.48 28.63 27.355 23.535 65-69 19.835 28.16 28.08 23.925 70-74 20.625 28.475 27.560000000000002 23.34 75-79 20.095 28.645 27.58 23.68 80-84 20.03 28.435 28.000000000000004 23.535 85-89 20.585 28.32 27.634999999999998 23.46 90-94 20.755000000000003 27.29 27.98 23.974999999999998 95-99 20.369999999999997 28.23 27.79 23.61 100-104 20.630000000000003 29.104999999999997 27.24 23.025000000000002 105-109 20.880000000000003 27.705000000000002 27.845 23.57 110-114 20.945 27.589999999999996 28.285 23.18 115-119 21.19 27.47 27.67 23.669999999999998 120-124 20.515 28.875 26.615 23.995 125-129 21.305 28.285 27.13 23.28 130-134 21.12 28.07 27.11 23.7 135-139 20.745 28.175 27.515 23.565 140-144 20.745 27.994999999999997 27.195000000000004 24.065 145-149 21.257125712571256 27.19271927192719 28.007800780078007 23.54235423542354 150-151 20.075000000000003 28.262500000000003 27.037499999999998 24.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 0.5 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 5.0 25 5.0 26 4.0 27 8.0 28 13.0 29 14.0 30 19.0 31 24.5 32 25.5 33 37.5 34 54.0 35 62.5 36 78.5 37 98.5 38 119.5 39 144.5 40 160.0 41 203.5 42 245.5 43 256.0 44 252.0 45 259.0 46 271.5 47 247.0 48 242.5 49 232.5 50 183.0 51 149.0 52 125.0 53 112.0 54 93.0 55 58.0 56 40.0 57 34.0 58 26.5 59 23.5 60 20.5 61 9.5 62 3.5 63 3.5 64 3.0 65 2.5 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.325 #Duplication Level Percentage of deduplicated Percentage of total 1 90.53418212012178 81.77499999999999 2 8.414060337669527 15.2 3 0.8856905618599501 2.4 4 0.1383891502906172 0.5 5 0.02767783005812344 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCGA 10 0.006830828 145.0 7 CCATTCG 10 0.006830828 145.0 6 >>END_MODULE SRR12671007 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671007_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.187 37.0 37.0 37.0 37.0 37.0 2 36.0755 37.0 37.0 37.0 37.0 37.0 3 36.07 37.0 37.0 37.0 37.0 37.0 4 36.2405 37.0 37.0 37.0 37.0 37.0 5 36.1725 37.0 37.0 37.0 37.0 37.0 6 36.373 37.0 37.0 37.0 37.0 37.0 7 36.2825 37.0 37.0 37.0 37.0 37.0 8 36.3705 37.0 37.0 37.0 37.0 37.0 9 36.22 37.0 37.0 37.0 37.0 37.0 10-14 36.335 37.0 37.0 37.0 37.0 37.0 15-19 36.363099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3164 37.0 37.0 37.0 37.0 37.0 25-29 36.237300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2545 37.0 37.0 37.0 37.0 37.0 35-39 36.2246 37.0 37.0 37.0 37.0 37.0 40-44 36.198899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.222899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1417 37.0 37.0 37.0 37.0 37.0 55-59 36.062599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1345 37.0 37.0 37.0 37.0 37.0 65-69 36.0964 37.0 37.0 37.0 37.0 37.0 70-74 36.109899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0542 37.0 37.0 37.0 37.0 37.0 80-84 36.071600000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9944 37.0 37.0 37.0 37.0 37.0 90-94 36.0034 37.0 37.0 37.0 37.0 37.0 95-99 36.0055 37.0 37.0 37.0 37.0 37.0 100-104 36.0235 37.0 37.0 37.0 37.0 37.0 105-109 35.9358 37.0 37.0 37.0 37.0 37.0 110-114 35.89829999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.86704999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.795399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.7349 37.0 37.0 37.0 37.0 37.0 130-134 35.736799999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.7011 37.0 37.0 37.0 37.0 37.0 140-144 35.63775 37.0 37.0 37.0 37.0 37.0 145-149 35.3856 37.0 37.0 37.0 37.0 37.0 150-151 35.095749999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 3.0 21 2.0 22 1.0 23 5.0 24 6.0 25 8.0 26 11.0 27 16.0 28 16.0 29 22.0 30 26.0 31 39.0 32 52.0 33 78.0 34 172.0 35 449.0 36 2631.0 37 458.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 24.975 9.175 24.05 2 27.55 25.174999999999997 31.275 16.0 3 20.424999999999997 27.55 32.9 19.125 4 24.8 32.824999999999996 23.925 18.45 5 25.8 36.575 20.599999999999998 17.025000000000002 6 21.3 39.300000000000004 22.8 16.6 7 21.925 22.075 37.075 18.925 8 20.575 26.3 28.549999999999997 24.575 9 21.975 25.3 30.275000000000002 22.45 10-14 23.005 28.96 26.290000000000003 21.745 15-19 23.165 28.854999999999997 27.200000000000003 20.78 20-24 23.335 28.565 27.6 20.5 25-29 23.544999999999998 28.27 27.0 21.185000000000002 30-34 22.869999999999997 28.384999999999998 27.935 20.810000000000002 35-39 22.965 28.09 27.794999999999998 21.15 40-44 22.645 28.095 28.134999999999998 21.125 45-49 22.895 27.88 28.265 20.96 50-54 22.99 27.96 27.43 21.62 55-59 22.785 28.895 27.389999999999997 20.93 60-64 23.294999999999998 27.49 28.07 21.145 65-69 23.25 28.549999999999997 27.6 20.599999999999998 70-74 23.895 27.560000000000002 27.57 20.974999999999998 75-79 23.849999999999998 28.415000000000003 26.905 20.830000000000002 80-84 23.395 28.095 27.655 20.855 85-89 23.585 28.225 27.555000000000003 20.635 90-94 23.865 28.005000000000003 27.21 20.919999999999998 95-99 23.16 28.485 26.939999999999998 21.415 100-104 23.47 27.985 27.384999999999998 21.16 105-109 23.96 28.134999999999998 27.52 20.385 110-114 23.57 28.235 27.275 20.919999999999998 115-119 24.196209810490522 28.05140257012851 27.57637881894095 20.17600880044002 120-124 23.35 27.92 28.03 20.7 125-129 24.195 27.88 27.534999999999997 20.39 130-134 24.775 28.005000000000003 26.889999999999997 20.330000000000002 135-139 24.035 28.000000000000004 27.73 20.235 140-144 25.386269313465675 27.33136656832842 27.1863593179659 20.09600480024001 145-149 24.595 28.235 27.07 20.1 150-151 24.3 28.175 27.737499999999997 19.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 2.0 17 1.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 2.0 24 3.0 25 4.5 26 5.0 27 6.5 28 9.0 29 10.5 30 19.0 31 27.0 32 29.5 33 32.5 34 43.0 35 71.0 36 90.5 37 100.5 38 122.0 39 143.0 40 179.5 41 224.0 42 255.5 43 268.0 44 269.0 45 277.5 46 267.5 47 250.5 48 238.5 49 213.0 50 159.5 51 128.0 52 119.0 53 93.5 54 78.0 55 63.0 56 46.5 57 36.0 58 26.5 59 18.0 60 14.5 61 12.5 62 9.0 63 7.0 64 4.5 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.56079955580233 81.55 2 8.134369794558578 14.649999999999999 3 1.082731815657968 2.9250000000000003 4 0.1665741254858412 0.6 5 0.027762354247640203 0.125 6 0.027762354247640203 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0125 0.0 134-135 3.4000000000000004 0.0 0.0 0.025 0.0 136-137 3.5875 0.0 0.0 0.025 0.0 138-139 3.875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra Read 621852 spots for SRR12671007.sra Written 621852 spots for SRR12671007.sra Read 621835 spots for SRR12671007.sra Written 621835 spots for SRR12671007.sra SRR ids: ['SRR12671007.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_utopwroa SRR12671007.sra spots: 12436717 blocks: [[1, 621835], [621836, 1243670], [1243671, 1865505], [1865506, 2487340], [2487341, 3109175], [3109176, 3731010], [3731011, 4352845], [4352846, 4974680], [4974681, 5596515], [5596516, 6218350], [6218351, 6840185], [6840186, 7462020], [7462021, 8083855], [8083856, 8705690], [8705691, 9327525], [9327526, 9949360], [9949361, 10571195], [10571196, 11193030], [11193031, 11814865], [11814866, 12436717]] SRR12671007 file size 4204840 SRR12671007 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671007 SRR12671007_1.fastq SRR12671007_2.fastq Input file: SRR12671007_1.fastq Paired file: SRR12671007_2.fastq trimmed: SRR12671007-trimmed-pair1.fastq, SRR12671007-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:01:29 2025 >> started Tue Feb 11 13:01:49 2025 >> done (20.404s) 12436717 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 2303 ( 0.02%) empty read pairs filtered out after trimming by size control 12434356 (99.98%) read pairs available; of these: 599735 ( 4.82%) trimmed read pairs available after processing 11834621 (95.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 7 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 7 0.00% 25 7 0.00% 26 2 0.00% 27 6 0.00% 28 5 0.00% 29 4 0.00% 30 7 0.00% 31 8 0.00% 32 13 0.00% 33 6 0.00% 34 7 0.00% 35 11 0.00% 36 6 0.00% 37 9 0.00% 38 14 0.00% 39 12 0.00% 40 9 0.00% 41 9 0.00% 42 4 0.00% 43 13 0.00% 44 16 0.00% 45 16 0.00% 46 18 0.00% 47 13 0.00% 48 17 0.00% 49 20 0.00% 50 26 0.00% 51 22 0.00% 52 30 0.00% 53 36 0.00% 54 33 0.00% 55 31 0.00% 56 51 0.00% 57 60 0.00% 58 61 0.00% 59 63 0.00% 60 71 0.00% 61 82 0.00% 62 108 0.00% 63 97 0.00% 64 124 0.00% 65 139 0.00% 66 141 0.00% 67 155 0.00% 68 187 0.00% 69 201 0.00% 70 250 0.00% 71 240 0.00% 72 319 0.00% 73 329 0.00% 74 452 0.00% 75 464 0.00% 76 504 0.00% 77 540 0.00% 78 626 0.01% 79 677 0.01% 80 730 0.01% 81 816 0.01% 82 962 0.01% 83 1076 0.01% 84 1167 0.01% 85 1259 0.01% 86 1417 0.01% 87 1435 0.01% 88 1640 0.01% 89 1772 0.01% 90 1782 0.01% 91 2028 0.02% 92 2094 0.02% 93 2285 0.02% 94 2495 0.02% 95 2809 0.02% 96 2864 0.02% 97 3082 0.02% 98 3294 0.03% 99 3312 0.03% 100 3594 0.03% 101 3777 0.03% 102 3953 0.03% 103 4092 0.03% 104 4343 0.03% 105 4541 0.04% 106 4908 0.04% 107 5088 0.04% 108 5405 0.04% 109 5579 0.04% 110 5846 0.05% 111 5919 0.05% 112 6289 0.05% 113 6435 0.05% 114 6671 0.05% 115 6924 0.06% 116 7375 0.06% 117 7683 0.06% 118 8103 0.07% 119 8016 0.06% 120 8531 0.07% 121 8866 0.07% 122 9145 0.07% 123 9518 0.08% 124 9726 0.08% 125 9991 0.08% 126 10389 0.08% 127 10924 0.09% 128 11223 0.09% 129 11736 0.09% 130 11948 0.10% 131 12324 0.10% 132 12928 0.10% 133 13161 0.11% 134 13350 0.11% 135 13972 0.11% 136 14234 0.11% 137 14444 0.12% 138 15089 0.12% 139 15863 0.13% 140 16285 0.13% 141 16525 0.13% 142 16838 0.14% 143 17046 0.14% 144 18081 0.15% 145 18371 0.15% 146 18721 0.15% 147 19334 0.16% 148 20236 0.16% 149 20079 0.16% 150 21597 0.17% 151 11834621 95.18% 12434356 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=28 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=55.42 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.2 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=0.75 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=23.66 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.4 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGA SRR12671007 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:02:31 Started mapping on | Feb 11 13:02:32 Finished on | Feb 11 13:03:54 Mapping speed, Million of reads per hour | 545.90 Number of input reads | 12434356 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11701479 Uniquely mapped reads % | 94.11% Average mapped length | 298.42 Number of splices: Total | 12078423 Number of splices: Annotated (sjdb) | 11856364 Number of splices: GT/AG | 11833223 Number of splices: GC/AG | 204593 Number of splices: AT/AC | 7140 Number of splices: Non-canonical | 33467 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280209 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 74087 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 452668 452668 452668 N_multimapping 280209 280209 280209 N_noFeature 394186 11515592 451998 N_ambiguous 201484 911 72886 UnstrandedReadsAssigned:11105809 PositiveStrandReadsAssigned:184976 NegativeStrandReadsAssigned:11176595 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671007 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671007-trimmed-pair1.fastq SRR12671007-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,434,356 reads, 11,170,621 reads pseudoaligned [quant] estimated average fragment length: 280.427 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR12671007.ke.tsv 34699 SRR12671007.se.tsv 87100 total ==> SRR12671007.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.57 394 16.9218 Potri.005G024800.1.v4.1 1035 755.573 274 27.0781 Potri.004G059700.1.v4.1 961 681.708 3 0.328599 Potri.007G009000.2.v4.1 1416 1136.57 0 0 Potri.003G141000.2.v4.1 2943 2663.57 666 18.6704 Potri.016G087400.1.v4.1 270 69.8295 428 457.666 Potri.015G069301.1.v4.1 564 297.471 0 0 Potri.010G195200.1.v4.1 1773 1493.57 21 1.04987 Potri.012G127500.1.v4.1 977 697.629 116 12.4159 ==> SRR12671007.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 137 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12671007 completed mapping pipeline successfully