Starting /dee2/code/volunteer_pipeline.sh SRR12671008 current disk space = 3050615324672 free memory = 1471848112 SRR12671008 SRAfilesize ad41ae2603e48ac19a2e349506eb1b1c SRR12671008.sra SRR12671008.sra file validated SRR12671008 is paired end SRR12671008 is conventional basespace SRR12671008 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671008_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41 37.0 37.0 37.0 37.0 37.0 2 36.4495 37.0 37.0 37.0 37.0 37.0 3 36.535 37.0 37.0 37.0 37.0 37.0 4 36.614 37.0 37.0 37.0 37.0 37.0 5 36.641 37.0 37.0 37.0 37.0 37.0 6 36.635 37.0 37.0 37.0 37.0 37.0 7 36.4975 37.0 37.0 37.0 37.0 37.0 8 36.5405 37.0 37.0 37.0 37.0 37.0 9 36.593 37.0 37.0 37.0 37.0 37.0 10-14 36.584799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.564299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.53830000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.500099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.477599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.478300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4816 37.0 37.0 37.0 37.0 37.0 45-49 36.3988 37.0 37.0 37.0 37.0 37.0 50-54 36.3959 37.0 37.0 37.0 37.0 37.0 55-59 36.3819 37.0 37.0 37.0 37.0 37.0 60-64 36.292500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3214 37.0 37.0 37.0 37.0 37.0 70-74 36.3658 37.0 37.0 37.0 37.0 37.0 75-79 36.303399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2702 37.0 37.0 37.0 37.0 37.0 85-89 36.227 37.0 37.0 37.0 37.0 37.0 90-94 36.1984 37.0 37.0 37.0 37.0 37.0 95-99 36.1983 37.0 37.0 37.0 37.0 37.0 100-104 36.1468 37.0 37.0 37.0 37.0 37.0 105-109 36.1579 37.0 37.0 37.0 37.0 37.0 110-114 36.1428 37.0 37.0 37.0 37.0 37.0 115-119 36.0947 37.0 37.0 37.0 37.0 37.0 120-124 36.0163 37.0 37.0 37.0 37.0 37.0 125-129 36.0289 37.0 37.0 37.0 37.0 37.0 130-134 35.8463 37.0 37.0 37.0 37.0 37.0 135-139 35.9594 37.0 37.0 37.0 37.0 37.0 140-144 35.8486 37.0 37.0 37.0 37.0 37.0 145-149 35.73909999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.5575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 3.0 22 2.0 23 0.0 24 0.0 25 4.0 26 6.0 27 7.0 28 18.0 29 22.0 30 27.0 31 50.0 32 47.0 33 77.0 34 122.0 35 264.0 36 2734.0 37 616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.075 11.025 5.5 41.4 2 19.05 11.05 37.9 32.0 3 17.8 15.6 27.900000000000002 38.7 4 23.05 23.275000000000002 23.225 30.45 5 24.349999999999998 28.825 24.8 22.025 6 20.775 33.875 23.1 22.25 7 13.225000000000001 28.025 41.775 16.975 8 17.0 25.974999999999998 33.15 23.875 9 16.025 23.775 36.125 24.075 10-14 19.650000000000002 29.945 28.005000000000003 22.400000000000002 15-19 20.31 27.92 28.315 23.455000000000002 20-24 20.32 28.405 27.29 23.985 25-29 19.900000000000002 28.645 27.79 23.665 30-34 19.64 28.09 27.905 24.365000000000002 35-39 19.93 28.095 28.105000000000004 23.87 40-44 20.36 28.310000000000002 27.765 23.565 45-49 19.835 28.585 27.825 23.755000000000003 50-54 20.015 28.465 27.92 23.599999999999998 55-59 20.1 28.525 27.400000000000002 23.974999999999998 60-64 20.235 28.73 27.584999999999997 23.45 65-69 19.845 28.139999999999997 28.205000000000002 23.810000000000002 70-74 20.080000000000002 28.215 27.395000000000003 24.310000000000002 75-79 20.025000000000002 28.415000000000003 27.485 24.075 80-84 20.54 28.249999999999996 27.189999999999998 24.02 85-89 20.565 28.04 27.83 23.565 90-94 20.044999999999998 28.585 27.365000000000002 24.005000000000003 95-99 20.285 27.834999999999997 28.044999999999998 23.835 100-104 20.36 28.58 27.644999999999996 23.415 105-109 21.04 28.08 27.560000000000002 23.32 110-114 20.560000000000002 28.4 27.389999999999997 23.65 115-119 20.305 28.410000000000004 27.48 23.805 120-124 20.51 27.750000000000004 27.884999999999998 23.855 125-129 19.830000000000002 27.725 28.155 24.29 130-134 20.815 27.83 27.875 23.48 135-139 21.115000000000002 28.075 26.939999999999998 23.87 140-144 20.985 28.21 27.095000000000002 23.71 145-149 20.817081708170818 27.457745774577457 27.337733773377337 24.387438743874387 150-151 20.1 28.5625 27.525 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 2.0 23 3.0 24 4.0 25 6.0 26 7.5 27 9.0 28 12.5 29 14.0 30 18.0 31 23.0 32 38.0 33 46.5 34 49.0 35 58.5 36 70.5 37 95.5 38 122.5 39 144.0 40 172.0 41 210.5 42 239.0 43 259.0 44 264.5 45 258.5 46 257.5 47 252.0 48 233.5 49 211.5 50 196.5 51 158.5 52 122.0 53 105.5 54 79.0 55 57.0 56 46.0 57 35.5 58 28.0 59 28.5 60 21.0 61 7.0 62 3.5 63 3.5 64 4.5 65 5.0 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.60054719562244 83.7 2 7.441860465116279 13.600000000000001 3 0.9028727770177838 2.475 4 0.027359781121751026 0.1 5 0.027359781121751026 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATAATCTGCTTCCAGCTTTTCCCTTTCATACTGGCAAGCTGCAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671008 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671008_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1865 37.0 37.0 37.0 37.0 37.0 2 36.0655 37.0 37.0 37.0 37.0 37.0 3 36.1775 37.0 37.0 37.0 37.0 37.0 4 36.3065 37.0 37.0 37.0 37.0 37.0 5 36.426 37.0 37.0 37.0 37.0 37.0 6 36.3615 37.0 37.0 37.0 37.0 37.0 7 36.381 37.0 37.0 37.0 37.0 37.0 8 36.4325 37.0 37.0 37.0 37.0 37.0 9 36.396 37.0 37.0 37.0 37.0 37.0 10-14 36.4012 37.0 37.0 37.0 37.0 37.0 15-19 36.347500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3396 37.0 37.0 37.0 37.0 37.0 25-29 36.2752 37.0 37.0 37.0 37.0 37.0 30-34 36.263999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.217099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.242000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.241299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.161199999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.163 37.0 37.0 37.0 37.0 37.0 60-64 36.156400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1896 37.0 37.0 37.0 37.0 37.0 70-74 36.1048 37.0 37.0 37.0 37.0 37.0 75-79 36.0835 37.0 37.0 37.0 37.0 37.0 80-84 36.0814 37.0 37.0 37.0 37.0 37.0 85-89 35.9503 37.0 37.0 37.0 37.0 37.0 90-94 36.0466 37.0 37.0 37.0 37.0 37.0 95-99 36.0574 37.0 37.0 37.0 37.0 37.0 100-104 36.038 37.0 37.0 37.0 37.0 37.0 105-109 35.9692 37.0 37.0 37.0 37.0 37.0 110-114 35.9142 37.0 37.0 37.0 37.0 37.0 115-119 35.896699999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.8262 37.0 37.0 37.0 37.0 37.0 125-129 35.76219999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.7953 37.0 37.0 37.0 37.0 37.0 135-139 35.767999999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.68415 37.0 37.0 37.0 37.0 37.0 145-149 35.4882 37.0 37.0 37.0 37.0 37.0 150-151 35.335750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 2.0 16 3.0 17 1.0 18 0.0 19 0.0 20 2.0 21 3.0 22 0.0 23 1.0 24 4.0 25 10.0 26 10.0 27 10.0 28 10.0 29 12.0 30 30.0 31 35.0 32 51.0 33 101.0 34 143.0 35 432.0 36 2600.0 37 533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.825 23.775 10.674999999999999 24.725 2 27.650000000000002 25.35 30.5 16.5 3 19.975 28.425 33.425 18.175 4 24.2 34.8 22.075 18.925 5 26.825 36.55 20.175 16.45 6 20.625 41.075 20.3 18.0 7 20.349999999999998 22.925 38.2 18.525 8 19.8 26.325 29.099999999999998 24.775 9 22.2 24.55 29.825000000000003 23.425 10-14 23.025000000000002 29.770000000000003 26.61 20.595 15-19 24.05 27.884999999999998 27.21 20.855 20-24 23.16 28.23 27.810000000000002 20.8 25-29 22.955000000000002 28.07 27.415 21.560000000000002 30-34 23.44 27.99 27.575 20.995 35-39 23.225 28.060000000000002 27.700000000000003 21.015 40-44 23.06 28.599999999999998 27.41 20.93 45-49 22.845 28.165000000000003 28.105000000000004 20.885 50-54 22.759999999999998 28.305000000000003 27.41 21.525 55-59 23.064999999999998 27.925 27.875 21.135 60-64 22.785 27.765 27.845 21.605 65-69 23.294999999999998 27.794999999999998 27.615000000000002 21.295 70-74 23.57 28.57 26.665 21.195 75-79 23.294999999999998 28.705000000000002 26.625 21.375 80-84 23.169999999999998 27.855 27.685 21.29 85-89 23.549999999999997 28.43 27.38 20.64 90-94 23.235 28.275 26.889999999999997 21.6 95-99 23.115 28.42 27.775 20.69 100-104 23.615 27.96 27.67 20.755000000000003 105-109 23.75 28.26 27.36 20.630000000000003 110-114 23.51 28.560000000000002 27.215 20.715 115-119 23.547354735473547 28.5028502850285 27.447744774477446 20.502050205020502 120-124 24.21 28.299999999999997 26.790000000000003 20.7 125-129 24.015 27.944999999999997 27.339999999999996 20.7 130-134 24.005000000000003 27.589999999999996 27.650000000000002 20.755000000000003 135-139 24.065 27.939999999999998 27.165 20.830000000000002 140-144 23.991199559978 27.896394819740987 27.821391069553474 20.29101455072754 145-149 24.6 28.575 26.479999999999997 20.345 150-151 24.875 29.275000000000002 25.85 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 1.5 23 2.0 24 2.5 25 3.0 26 6.5 27 7.5 28 7.0 29 11.0 30 17.0 31 18.5 32 24.0 33 38.5 34 56.5 35 65.5 36 67.0 37 95.5 38 132.5 39 173.0 40 209.0 41 227.5 42 242.5 43 254.5 44 263.0 45 264.5 46 266.5 47 254.5 48 226.5 49 203.0 50 174.5 51 140.0 52 114.0 53 99.5 54 81.0 55 58.0 56 46.0 57 34.0 58 23.5 59 20.5 60 16.5 61 11.5 62 8.0 63 4.0 64 3.0 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.5 77 1.0 78 1.0 79 1.0 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6072408118486 83.5 2 7.350521119034559 13.4 3 0.877674163466813 2.4 4 0.10970927043335163 0.4 5 0.027427317608337907 0.125 6 0.0 0.0 7 0.027427317608337907 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.475 0.0 0.0 0.0 0.0 132-133 2.6 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.35 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAA 10 0.006830828 145.0 7 >>END_MODULE Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568693 spots for SRR12671008.sra Written 568693 spots for SRR12671008.sra Read 568696 spots for SRR12671008.sra Written 568696 spots for SRR12671008.sra SRR ids: ['SRR12671008.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_te4f5kwt SRR12671008.sra spots: 11373863 blocks: [[1, 568693], [568694, 1137386], [1137387, 1706079], [1706080, 2274772], [2274773, 2843465], [2843466, 3412158], [3412159, 3980851], [3980852, 4549544], [4549545, 5118237], [5118238, 5686930], [5686931, 6255623], [6255624, 6824316], [6824317, 7393009], [7393010, 7961702], [7961703, 8530395], [8530396, 9099088], [9099089, 9667781], [9667782, 10236474], [10236475, 10805167], [10805168, 11373863]] SRR12671008 file size 3843635 SRR12671008 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671008 SRR12671008_1.fastq SRR12671008_2.fastq Input file: SRR12671008_1.fastq Paired file: SRR12671008_2.fastq trimmed: SRR12671008-trimmed-pair1.fastq, SRR12671008-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:10:11 2025 >> started Tue Feb 11 13:10:24 2025 >> done (12.826s) 11373863 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 1347 ( 0.01%) empty read pairs filtered out after trimming by size control 11372482 (99.99%) read pairs available; of these: 507768 ( 4.46%) trimmed read pairs available after processing 10864714 (95.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 6 0.00% 28 9 0.00% 29 12 0.00% 30 4 0.00% 31 7 0.00% 32 12 0.00% 33 4 0.00% 34 9 0.00% 35 7 0.00% 36 7 0.00% 37 7 0.00% 38 13 0.00% 39 14 0.00% 40 19 0.00% 41 14 0.00% 42 20 0.00% 43 10 0.00% 44 15 0.00% 45 18 0.00% 46 18 0.00% 47 23 0.00% 48 17 0.00% 49 27 0.00% 50 24 0.00% 51 37 0.00% 52 27 0.00% 53 31 0.00% 54 37 0.00% 55 26 0.00% 56 32 0.00% 57 39 0.00% 58 47 0.00% 59 63 0.00% 60 78 0.00% 61 87 0.00% 62 92 0.00% 63 100 0.00% 64 113 0.00% 65 124 0.00% 66 133 0.00% 67 118 0.00% 68 153 0.00% 69 230 0.00% 70 230 0.00% 71 255 0.00% 72 270 0.00% 73 298 0.00% 74 364 0.00% 75 398 0.00% 76 434 0.00% 77 492 0.00% 78 566 0.00% 79 587 0.01% 80 714 0.01% 81 731 0.01% 82 863 0.01% 83 842 0.01% 84 984 0.01% 85 1183 0.01% 86 1246 0.01% 87 1262 0.01% 88 1416 0.01% 89 1586 0.01% 90 1616 0.01% 91 1791 0.02% 92 1899 0.02% 93 2113 0.02% 94 2192 0.02% 95 2346 0.02% 96 2657 0.02% 97 2647 0.02% 98 2741 0.02% 99 2889 0.03% 100 3186 0.03% 101 3257 0.03% 102 3405 0.03% 103 3769 0.03% 104 3950 0.03% 105 4219 0.04% 106 4275 0.04% 107 4583 0.04% 108 4758 0.04% 109 5014 0.04% 110 4957 0.04% 111 5119 0.05% 112 5338 0.05% 113 5600 0.05% 114 5871 0.05% 115 6068 0.05% 116 6390 0.06% 117 6582 0.06% 118 6897 0.06% 119 7044 0.06% 120 7483 0.07% 121 7536 0.07% 122 7694 0.07% 123 8348 0.07% 124 8320 0.07% 125 8717 0.08% 126 8921 0.08% 127 9181 0.08% 128 9539 0.08% 129 9624 0.08% 130 10038 0.09% 131 10459 0.09% 132 10604 0.09% 133 10934 0.10% 134 11339 0.10% 135 11589 0.10% 136 11839 0.10% 137 12143 0.11% 138 12525 0.11% 139 13161 0.12% 140 13461 0.12% 141 13838 0.12% 142 14227 0.13% 143 14226 0.13% 144 15019 0.13% 145 15117 0.13% 146 15536 0.14% 147 15908 0.14% 148 16456 0.14% 149 16603 0.15% 150 17582 0.15% 151 10864714 95.54% 11372482 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=17.12 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.8 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=21 prefix-density=0.60 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=41.57 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.4 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671008 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:11:09 Started mapping on | Feb 11 13:11:09 Finished on | Feb 11 13:12:39 Mapping speed, Million of reads per hour | 454.90 Number of input reads | 11372482 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 10590174 Uniquely mapped reads % | 93.12% Average mapped length | 298.57 Number of splices: Total | 10645868 Number of splices: Annotated (sjdb) | 10448079 Number of splices: GT/AG | 10436860 Number of splices: GC/AG | 172058 Number of splices: AT/AC | 6211 Number of splices: Non-canonical | 30739 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293814 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 103644 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 488494 488494 488494 N_multimapping 293814 293814 293814 N_noFeature 365583 10422618 415870 N_ambiguous 198922 841 81127 UnstrandedReadsAssigned:10025669 PositiveStrandReadsAssigned:166715 NegativeStrandReadsAssigned:10093177 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671008 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671008-trimmed-pair1.fastq SRR12671008-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,372,482 reads, 10,123,223 reads pseudoaligned [quant] estimated average fragment length: 288.95 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR12671008.ke.tsv 34699 SRR12671008.se.tsv 87100 total ==> SRR12671008.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.05 490 23.9467 Potri.005G024800.1.v4.1 1035 747.05 86 9.73323 Potri.004G059700.1.v4.1 961 673.237 0 0 Potri.007G009000.2.v4.1 1416 1128.05 0 0 Potri.003G141000.2.v4.1 2943 2655.05 527.489 16.7977 Potri.016G087400.1.v4.1 270 68.6089 532 655.6 Potri.015G069301.1.v4.1 564 291.168 0 0 Potri.010G195200.1.v4.1 1773 1485.05 130 7.40134 Potri.012G127500.1.v4.1 977 689.158 60 7.36106 ==> SRR12671008.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671008 completed mapping pipeline successfully