Starting /dee2/code/volunteer_pipeline.sh SRR12671009 current disk space = 3050675499008 free memory = 1344741988 SRR12671009 SRAfilesize 5e4a7fa0efddce63e905dd3a534d0aee SRR12671009.sra SRR12671009.sra file validated SRR12671009 is paired end SRR12671009 is conventional basespace SRR12671009 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671009_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3095 37.0 37.0 37.0 37.0 37.0 2 36.382 37.0 37.0 37.0 37.0 37.0 3 36.4285 37.0 37.0 37.0 37.0 37.0 4 36.522 37.0 37.0 37.0 37.0 37.0 5 36.597 37.0 37.0 37.0 37.0 37.0 6 36.5615 37.0 37.0 37.0 37.0 37.0 7 36.492 37.0 37.0 37.0 37.0 37.0 8 36.6295 37.0 37.0 37.0 37.0 37.0 9 36.573 37.0 37.0 37.0 37.0 37.0 10-14 36.5923 37.0 37.0 37.0 37.0 37.0 15-19 36.5909 37.0 37.0 37.0 37.0 37.0 20-24 36.550799999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4979 37.0 37.0 37.0 37.0 37.0 30-34 36.436899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4433 37.0 37.0 37.0 37.0 37.0 40-44 36.4368 37.0 37.0 37.0 37.0 37.0 45-49 36.4072 37.0 37.0 37.0 37.0 37.0 50-54 36.3754 37.0 37.0 37.0 37.0 37.0 55-59 36.3502 37.0 37.0 37.0 37.0 37.0 60-64 36.3166 37.0 37.0 37.0 37.0 37.0 65-69 36.2773 37.0 37.0 37.0 37.0 37.0 70-74 36.291 37.0 37.0 37.0 37.0 37.0 75-79 36.2755 37.0 37.0 37.0 37.0 37.0 80-84 36.253699999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.23950000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2315 37.0 37.0 37.0 37.0 37.0 95-99 36.1546 37.0 37.0 37.0 37.0 37.0 100-104 36.15 37.0 37.0 37.0 37.0 37.0 105-109 36.093900000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.0582 37.0 37.0 37.0 37.0 37.0 115-119 36.034 37.0 37.0 37.0 37.0 37.0 120-124 35.959799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9833 37.0 37.0 37.0 37.0 37.0 130-134 35.833299999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.8557 37.0 37.0 37.0 37.0 37.0 140-144 35.866 37.0 37.0 37.0 37.0 37.0 145-149 35.7201 37.0 37.0 37.0 37.0 37.0 150-151 35.52175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 2.0 23 1.0 24 4.0 25 5.0 26 4.0 27 9.0 28 16.0 29 31.0 30 25.0 31 41.0 32 52.0 33 77.0 34 110.0 35 287.0 36 2696.0 37 637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.62131065532767 10.680340170085042 6.503251625812906 40.19509754877439 2 17.9 12.725 37.824999999999996 31.55 3 17.525 15.299999999999999 27.775 39.4 4 21.65 21.7 24.925 31.724999999999998 5 24.325 28.4 25.5 21.775 6 20.349999999999998 32.275 23.974999999999998 23.400000000000002 7 14.899999999999999 27.275 42.175000000000004 15.65 8 16.35 26.174999999999997 34.925 22.55 9 16.8 22.35 37.35 23.5 10-14 19.185 30.320000000000004 28.444999999999997 22.05 15-19 19.220000000000002 28.610000000000003 28.02 24.15 20-24 19.650000000000002 27.91 28.345 24.095 25-29 19.439999999999998 28.375 28.43 23.755000000000003 30-34 20.145 28.050000000000004 28.060000000000002 23.745 35-39 20.06 28.815 27.389999999999997 23.735 40-44 19.665 28.525 27.88 23.93 45-49 20.465 28.544999999999998 27.310000000000002 23.68 50-54 19.835 28.610000000000003 27.575 23.98 55-59 20.080000000000002 27.935 28.449999999999996 23.535 60-64 20.424999999999997 28.244999999999997 26.915 24.415 65-69 19.950000000000003 27.815 28.355000000000004 23.880000000000003 70-74 20.11 29.054999999999996 27.71 23.125 75-79 20.44 28.044999999999998 27.975 23.54 80-84 19.935 28.365000000000002 27.779999999999998 23.919999999999998 85-89 21.044999999999998 28.335 27.705000000000002 22.915 90-94 20.685000000000002 27.55 28.315 23.45 95-99 20.28 28.315 27.46 23.945 100-104 20.21 28.720000000000002 27.529999999999998 23.54 105-109 20.23 28.515 27.725 23.53 110-114 20.26 27.73 28.470000000000002 23.54 115-119 20.485 28.105000000000004 28.02 23.39 120-124 20.77 27.48 28.244999999999997 23.505000000000003 125-129 20.155 28.88 27.384999999999998 23.580000000000002 130-134 20.560000000000002 27.96 27.73 23.75 135-139 20.865000000000002 27.634999999999998 28.13 23.369999999999997 140-144 20.715 27.755000000000003 27.275 24.255 145-149 20.549999999999997 28.315 27.675 23.46 150-151 20.875 27.9125 27.1125 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 1.5 19 2.5 20 1.5 21 0.5 22 1.0 23 4.0 24 5.0 25 4.0 26 5.0 27 9.5 28 16.5 29 18.5 30 20.0 31 23.5 32 27.5 33 39.5 34 53.0 35 64.0 36 74.0 37 98.5 38 133.5 39 162.5 40 197.0 41 213.5 42 232.0 43 235.0 44 248.5 45 278.0 46 261.0 47 233.0 48 219.5 49 213.0 50 177.5 51 150.0 52 137.5 53 111.5 54 76.0 55 51.5 56 50.5 57 42.5 58 31.0 59 25.0 60 16.5 61 7.5 62 5.5 63 4.0 64 1.0 65 2.0 66 2.0 67 0.0 68 0.0 69 0.0 70 2.0 71 2.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.3722267871816 83.39999999999999 2 7.778690769652149 14.2 3 0.7669131744727472 2.1 4 0.08216926869350863 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.1624999999999996 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671009 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671009_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.262 37.0 37.0 37.0 37.0 37.0 2 36.269 37.0 37.0 37.0 37.0 37.0 3 36.2 37.0 37.0 37.0 37.0 37.0 4 36.402 37.0 37.0 37.0 37.0 37.0 5 36.386 37.0 37.0 37.0 37.0 37.0 6 36.3805 37.0 37.0 37.0 37.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.42 37.0 37.0 37.0 37.0 37.0 9 36.446 37.0 37.0 37.0 37.0 37.0 10-14 36.4661 37.0 37.0 37.0 37.0 37.0 15-19 36.428700000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.415499999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.378 37.0 37.0 37.0 37.0 37.0 30-34 36.3765 37.0 37.0 37.0 37.0 37.0 35-39 36.308099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2762 37.0 37.0 37.0 37.0 37.0 45-49 36.3119 37.0 37.0 37.0 37.0 37.0 50-54 36.3081 37.0 37.0 37.0 37.0 37.0 55-59 36.286500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.254000000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.224599999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1693 37.0 37.0 37.0 37.0 37.0 75-79 36.11899999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.1154 37.0 37.0 37.0 37.0 37.0 85-89 36.122 37.0 37.0 37.0 37.0 37.0 90-94 36.1115 37.0 37.0 37.0 37.0 37.0 95-99 36.1315 37.0 37.0 37.0 37.0 37.0 100-104 36.1233 37.0 37.0 37.0 37.0 37.0 105-109 36.0274 37.0 37.0 37.0 37.0 37.0 110-114 36.0011 37.0 37.0 37.0 37.0 37.0 115-119 36.040200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.9328 37.0 37.0 37.0 37.0 37.0 125-129 35.8566 37.0 37.0 37.0 37.0 37.0 130-134 35.8587 37.0 37.0 37.0 37.0 37.0 135-139 35.835 37.0 37.0 37.0 37.0 37.0 140-144 35.817499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.614700000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.449749999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 0.0 16 0.0 17 3.0 18 0.0 19 1.0 20 0.0 21 3.0 22 2.0 23 2.0 24 6.0 25 6.0 26 6.0 27 11.0 28 13.0 29 12.0 30 29.0 31 35.0 32 52.0 33 73.0 34 115.0 35 365.0 36 2689.0 37 571.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 23.400000000000002 10.5 26.025 2 27.800000000000004 25.900000000000002 30.725 15.575 3 21.3 27.975 32.45 18.275 4 24.625 34.225 23.35 17.8 5 27.875 36.199999999999996 20.45 15.475 6 20.599999999999998 40.75 21.425 17.224999999999998 7 20.75 21.55 38.824999999999996 18.875 8 19.775000000000002 26.150000000000002 29.849999999999998 24.224999999999998 9 22.1 24.525 29.799999999999997 23.575 10-14 23.23 29.99 25.86 20.919999999999998 15-19 23.125 28.255000000000003 27.37 21.25 20-24 22.88 28.835 27.884999999999998 20.4 25-29 23.02 28.485 27.85 20.645 30-34 23.25 28.78 27.52 20.45 35-39 22.725 28.375 27.805000000000003 21.095 40-44 22.939999999999998 28.125 28.46 20.474999999999998 45-49 22.79 28.325 28.035 20.849999999999998 50-54 22.405 28.405 28.470000000000002 20.72 55-59 23.135 28.015 28.165000000000003 20.685000000000002 60-64 22.75 28.04 27.985 21.224999999999998 65-69 23.195 27.860000000000003 27.79 21.154999999999998 70-74 23.195 28.345 27.565 20.895 75-79 23.415 28.09 27.474999999999998 21.02 80-84 23.935000000000002 28.084999999999997 27.089999999999996 20.89 85-89 23.695 28.24 27.405 20.66 90-94 23.49 27.735 27.35 21.425 95-99 23.685000000000002 28.005000000000003 27.650000000000002 20.66 100-104 23.810000000000002 27.37 27.855 20.965 105-109 23.465 28.000000000000004 28.095 20.44 110-114 23.74 27.82 27.605 20.835 115-119 23.474999999999998 28.32 27.665 20.54 120-124 23.91 28.634999999999998 27.255000000000003 20.200000000000003 125-129 23.615 27.950000000000003 27.515 20.919999999999998 130-134 23.585 27.834999999999997 26.905 21.675 135-139 23.52 27.639999999999997 28.294999999999998 20.544999999999998 140-144 23.905 28.095 27.195000000000004 20.805 145-149 23.919999999999998 28.74 27.245 20.095 150-151 23.4375 28.812500000000004 27.487499999999997 20.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.5 6 1.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.5 16 2.5 17 1.5 18 0.0 19 0.5 20 1.0 21 2.5 22 2.0 23 0.5 24 2.5 25 5.0 26 5.0 27 6.0 28 8.5 29 10.5 30 14.0 31 23.0 32 41.5 33 48.5 34 55.5 35 66.5 36 68.0 37 93.0 38 130.5 39 154.0 40 196.5 41 240.5 42 264.5 43 277.0 44 281.0 45 269.0 46 251.0 47 239.0 48 218.0 49 199.0 50 168.5 51 144.5 52 122.5 53 85.5 54 62.5 55 52.5 56 37.0 57 28.5 58 29.0 59 25.0 60 17.5 61 10.0 62 8.5 63 5.5 64 1.5 65 0.5 66 1.5 67 2.5 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.37458926615552 83.42500000000001 2 7.968236582694415 14.549999999999999 3 0.49288061336254113 1.35 4 0.13691128148959475 0.5 5 0.0 0.0 6 0.0 0.0 7 0.027382256297918947 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.2125000000000004 0.0 0.0 0.0 0.0 138-139 2.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAACT 10 0.006830828 145.0 7 ATCGAAC 10 0.006830828 145.0 6 >>END_MODULE Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550037 spots for SRR12671009.sra Written 550037 spots for SRR12671009.sra Read 550041 spots for SRR12671009.sra Written 550041 spots for SRR12671009.sra SRR ids: ['SRR12671009.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nu40uge4 SRR12671009.sra spots: 11000744 blocks: [[1, 550037], [550038, 1100074], [1100075, 1650111], [1650112, 2200148], [2200149, 2750185], [2750186, 3300222], [3300223, 3850259], [3850260, 4400296], [4400297, 4950333], [4950334, 5500370], [5500371, 6050407], [6050408, 6600444], [6600445, 7150481], [7150482, 7700518], [7700519, 8250555], [8250556, 8800592], [8800593, 9350629], [9350630, 9900666], [9900667, 10450703], [10450704, 11000744]] SRR12671009 file size 3716833 SRR12671009 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671009 SRR12671009_1.fastq SRR12671009_2.fastq Input file: SRR12671009_1.fastq Paired file: SRR12671009_2.fastq trimmed: SRR12671009-trimmed-pair1.fastq, SRR12671009-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:54:04 2025 >> started Tue Feb 11 12:54:22 2025 >> done (17.746s) 11000744 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 887 ( 0.01%) empty read pairs filtered out after trimming by size control 10999819 (99.99%) read pairs available; of these: 435554 ( 3.96%) trimmed read pairs available after processing 10564265 (96.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 5 0.00% 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 5 0.00% 25 4 0.00% 26 7 0.00% 27 5 0.00% 28 8 0.00% 29 4 0.00% 30 4 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 6 0.00% 35 5 0.00% 36 7 0.00% 37 5 0.00% 38 6 0.00% 39 4 0.00% 40 7 0.00% 41 6 0.00% 42 5 0.00% 43 8 0.00% 44 5 0.00% 45 9 0.00% 46 20 0.00% 47 12 0.00% 48 11 0.00% 49 18 0.00% 50 22 0.00% 51 20 0.00% 52 32 0.00% 53 16 0.00% 54 27 0.00% 55 34 0.00% 56 27 0.00% 57 23 0.00% 58 41 0.00% 59 41 0.00% 60 60 0.00% 61 68 0.00% 62 64 0.00% 63 72 0.00% 64 87 0.00% 65 97 0.00% 66 102 0.00% 67 118 0.00% 68 141 0.00% 69 166 0.00% 70 183 0.00% 71 185 0.00% 72 240 0.00% 73 233 0.00% 74 275 0.00% 75 291 0.00% 76 376 0.00% 77 372 0.00% 78 435 0.00% 79 495 0.00% 80 491 0.00% 81 559 0.01% 82 628 0.01% 83 731 0.01% 84 806 0.01% 85 917 0.01% 86 981 0.01% 87 1056 0.01% 88 1105 0.01% 89 1217 0.01% 90 1334 0.01% 91 1373 0.01% 92 1498 0.01% 93 1649 0.01% 94 1776 0.02% 95 1994 0.02% 96 2044 0.02% 97 2286 0.02% 98 2311 0.02% 99 2401 0.02% 100 2660 0.02% 101 2695 0.02% 102 2777 0.03% 103 2977 0.03% 104 3170 0.03% 105 3336 0.03% 106 3409 0.03% 107 3775 0.03% 108 4027 0.04% 109 4048 0.04% 110 4124 0.04% 111 4317 0.04% 112 4522 0.04% 113 4694 0.04% 114 4887 0.04% 115 5145 0.05% 116 5328 0.05% 117 5456 0.05% 118 5890 0.05% 119 6063 0.06% 120 6222 0.06% 121 6476 0.06% 122 6556 0.06% 123 6785 0.06% 124 7148 0.06% 125 7354 0.07% 126 7833 0.07% 127 7925 0.07% 128 8077 0.07% 129 8383 0.08% 130 8812 0.08% 131 9064 0.08% 132 9117 0.08% 133 9372 0.09% 134 9721 0.09% 135 10157 0.09% 136 10524 0.10% 137 10428 0.09% 138 11041 0.10% 139 11202 0.10% 140 11666 0.11% 141 11909 0.11% 142 12627 0.11% 143 12748 0.12% 144 13220 0.12% 145 13330 0.12% 146 13625 0.12% 147 14150 0.13% 148 14750 0.13% 149 14859 0.14% 150 15481 0.14% 151 10564265 96.04% 10999819 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=27 prefix-density=0.46 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.22 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.1 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=22 prefix-density=0.47 prefix-fanout=2.3 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=29.16 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=7.3 sequence=AAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGC SRR12671009 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:55:19 Started mapping on | Feb 11 12:55:20 Finished on | Feb 11 12:56:50 Mapping speed, Million of reads per hour | 439.99 Number of input reads | 10999819 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 10150140 Uniquely mapped reads % | 92.28% Average mapped length | 298.79 Number of splices: Total | 10268239 Number of splices: Annotated (sjdb) | 10065533 Number of splices: GT/AG | 10067313 Number of splices: GC/AG | 162708 Number of splices: AT/AC | 6108 Number of splices: Non-canonical | 32110 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297770 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 132329 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551909 551909 551909 N_multimapping 297770 297770 297770 N_noFeature 371065 9973709 414195 N_ambiguous 210339 644 76721 UnstrandedReadsAssigned:9568736 PositiveStrandReadsAssigned:175787 NegativeStrandReadsAssigned:9659224 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671009 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671009-trimmed-pair1.fastq SRR12671009-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,999,819 reads, 9,681,506 reads pseudoaligned [quant] estimated average fragment length: 295.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12671009.ke.tsv 34699 SRR12671009.se.tsv 87100 total ==> SRR12671009.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.57 584 27.7897 Potri.005G024800.1.v4.1 1035 740.569 271 30.0126 Potri.004G059700.1.v4.1 961 666.748 0 0 Potri.007G009000.2.v4.1 1416 1121.57 0 0 Potri.003G141000.2.v4.1 2943 2648.57 650 20.128 Potri.016G087400.1.v4.1 270 67.6362 555 672.997 Potri.015G069301.1.v4.1 564 286.82 0 0 Potri.010G195200.1.v4.1 1773 1478.57 127 7.04468 Potri.012G127500.1.v4.1 977 682.676 95 11.4132 ==> SRR12671009.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 179 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 85 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671009 completed mapping pipeline successfully