Starting /dee2/code/volunteer_pipeline.sh SRR12671010 current disk space = 3050632437760 free memory = 1485518288 SRR12671010 SRAfilesize d17cded2e6a138e1f7ed00d7fd81bcdc SRR12671010.sra SRR12671010.sra file validated SRR12671010 is paired end SRR12671010 is conventional basespace SRR12671010 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44825 37.0 37.0 37.0 37.0 37.0 2 36.3635 37.0 37.0 37.0 37.0 37.0 3 36.559 37.0 37.0 37.0 37.0 37.0 4 36.413 37.0 37.0 37.0 37.0 37.0 5 36.6585 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.5695 37.0 37.0 37.0 37.0 37.0 8 36.6735 37.0 37.0 37.0 37.0 37.0 9 36.5235 37.0 37.0 37.0 37.0 37.0 10-14 36.606500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.607800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5223 37.0 37.0 37.0 37.0 37.0 25-29 36.5049 37.0 37.0 37.0 37.0 37.0 30-34 36.4767 37.0 37.0 37.0 37.0 37.0 35-39 36.471999999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.430400000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3883 37.0 37.0 37.0 37.0 37.0 50-54 36.361900000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3412 37.0 37.0 37.0 37.0 37.0 60-64 36.311699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.29710000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.32899999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.245000000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.21130000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2495 37.0 37.0 37.0 37.0 37.0 90-94 36.1726 37.0 37.0 37.0 37.0 37.0 95-99 36.174400000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.139300000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0821 37.0 37.0 37.0 37.0 37.0 110-114 36.095 37.0 37.0 37.0 37.0 37.0 115-119 36.0154 37.0 37.0 37.0 37.0 37.0 120-124 35.961299999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.012299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.799400000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.831399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.8041 37.0 37.0 37.0 37.0 37.0 145-149 35.6872 37.0 37.0 37.0 37.0 37.0 150-151 35.5655 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 2.0 23 2.0 24 5.0 25 3.0 26 2.0 27 10.0 28 17.0 29 18.0 30 32.0 31 43.0 32 58.0 33 82.0 34 134.0 35 272.0 36 2691.0 37 625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.01300325081271 11.502875718929733 5.101275318829708 31.38284571142786 2 20.65 10.75 35.375 33.225 3 16.675 16.875 29.799999999999997 36.65 4 22.675 21.95 25.45 29.925 5 23.325000000000003 31.175000000000004 22.75 22.75 6 20.575 33.875 24.0 21.55 7 16.025 27.875 40.625 15.475 8 16.175 25.0 34.4 24.425 9 17.150000000000002 24.15 35.15 23.549999999999997 10-14 19.71 30.659999999999997 27.68 21.95 15-19 19.564999999999998 28.27 28.499999999999996 23.665 20-24 19.814999999999998 28.694999999999997 28.055000000000003 23.435 25-29 19.919999999999998 29.354999999999997 27.400000000000002 23.325000000000003 30-34 19.52 29.275000000000002 27.450000000000003 23.755000000000003 35-39 19.68 27.834999999999997 28.79 23.695 40-44 19.415 28.799999999999997 28.044999999999998 23.74 45-49 20.28 28.999999999999996 27.505000000000003 23.215 50-54 20.169999999999998 28.360000000000003 27.500000000000004 23.97 55-59 19.975 28.749999999999996 27.68 23.595 60-64 19.45 29.23 27.515 23.805 65-69 19.61 28.449999999999996 28.26 23.68 70-74 20.265 27.950000000000003 28.299999999999997 23.485 75-79 19.73 28.865000000000002 27.634999999999998 23.77 80-84 19.79 28.825 27.825 23.56 85-89 20.54 28.505000000000003 27.04 23.915 90-94 20.25 28.73 27.845 23.175 95-99 20.745 28.050000000000004 27.744999999999997 23.46 100-104 20.655 28.585 27.485 23.275000000000002 105-109 20.375 29.095 27.055 23.474999999999998 110-114 20.275000000000002 27.775 28.53 23.419999999999998 115-119 20.5 28.29 27.485 23.724999999999998 120-124 20.78 28.46 27.075 23.685000000000002 125-129 20.395 28.375 27.42 23.810000000000002 130-134 19.99 28.694999999999997 27.939999999999998 23.375 135-139 20.380000000000003 28.060000000000002 27.43 24.13 140-144 20.515 27.87 27.625 23.990000000000002 145-149 20.945 28.655 27.0 23.400000000000002 150-151 20.275000000000002 28.9125 26.8125 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 4.0 22 3.0 23 1.5 24 2.5 25 5.0 26 7.5 27 10.5 28 12.5 29 15.0 30 23.0 31 29.5 32 33.5 33 37.0 34 50.5 35 74.0 36 86.5 37 109.0 38 140.0 39 158.5 40 182.0 41 217.5 42 235.5 43 243.0 44 267.0 45 281.5 46 265.5 47 241.5 48 220.5 49 198.5 50 171.0 51 144.0 52 118.0 53 95.0 54 85.5 55 63.5 56 43.5 57 31.0 58 19.5 59 18.5 60 15.0 61 6.5 62 4.5 63 5.0 64 5.0 65 5.0 66 2.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.16164903715757 84.95 2 7.268782207756984 13.4 3 0.4882017900732303 1.35 4 0.08136696501220504 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.8624999999999998 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.4625000000000004 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAATTT 10 0.006830828 145.0 3 CAAGCTA 10 0.006830828 145.0 5 >>END_MODULE SRR12671010 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671010_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1425 37.0 37.0 37.0 37.0 37.0 2 36.109 37.0 37.0 37.0 37.0 37.0 3 36.261 37.0 37.0 37.0 37.0 37.0 4 36.267 37.0 37.0 37.0 37.0 37.0 5 36.3315 37.0 37.0 37.0 37.0 37.0 6 36.436 37.0 37.0 37.0 37.0 37.0 7 36.349 37.0 37.0 37.0 37.0 37.0 8 36.371 37.0 37.0 37.0 37.0 37.0 9 36.379 37.0 37.0 37.0 37.0 37.0 10-14 36.414500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.374 37.0 37.0 37.0 37.0 37.0 20-24 36.4162 37.0 37.0 37.0 37.0 37.0 25-29 36.3218 37.0 37.0 37.0 37.0 37.0 30-34 36.3871 37.0 37.0 37.0 37.0 37.0 35-39 36.272 37.0 37.0 37.0 37.0 37.0 40-44 36.233700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2975 37.0 37.0 37.0 37.0 37.0 50-54 36.2063 37.0 37.0 37.0 37.0 37.0 55-59 36.223 37.0 37.0 37.0 37.0 37.0 60-64 36.2018 37.0 37.0 37.0 37.0 37.0 65-69 36.206100000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.196 37.0 37.0 37.0 37.0 37.0 75-79 36.0596 37.0 37.0 37.0 37.0 37.0 80-84 36.0924 37.0 37.0 37.0 37.0 37.0 85-89 36.0381 37.0 37.0 37.0 37.0 37.0 90-94 36.1098 37.0 37.0 37.0 37.0 37.0 95-99 36.0888 37.0 37.0 37.0 37.0 37.0 100-104 36.0603 37.0 37.0 37.0 37.0 37.0 105-109 35.919399999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9857 37.0 37.0 37.0 37.0 37.0 115-119 35.96339999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.903 37.0 37.0 37.0 37.0 37.0 125-129 35.8138 37.0 37.0 37.0 37.0 37.0 130-134 35.8523 37.0 37.0 37.0 37.0 37.0 135-139 35.7494 37.0 37.0 37.0 37.0 37.0 140-144 35.69 37.0 37.0 37.0 37.0 37.0 145-149 35.5295 37.0 37.0 37.0 37.0 37.0 150-151 35.286249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 3.0 23 5.0 24 4.0 25 4.0 26 12.0 27 15.0 28 10.0 29 18.0 30 34.0 31 29.0 32 53.0 33 79.0 34 160.0 35 382.0 36 2667.0 37 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.125 26.325 6.6000000000000005 20.95 2 27.125 26.674999999999997 30.2 16.0 3 19.950000000000003 27.275 35.05 17.724999999999998 4 24.075 34.175 22.8 18.95 5 25.374999999999996 39.074999999999996 20.025000000000002 15.525 6 21.025 40.050000000000004 20.5 18.425 7 20.625 24.95 35.65 18.775 8 19.05 28.425 27.750000000000004 24.775 9 21.675 24.575 28.95 24.8 10-14 23.1 31.045 25.905 19.950000000000003 15-19 22.6 28.88 27.905 20.615 20-24 23.064999999999998 29.07 27.47 20.395 25-29 23.294999999999998 28.194999999999997 28.044999999999998 20.465 30-34 23.02 28.625 28.105000000000004 20.25 35-39 22.875 28.349999999999998 28.13 20.645 40-44 23.075000000000003 28.110000000000003 28.095 20.72 45-49 22.805 28.18 28.27 20.745 50-54 23.29 28.01 27.685 21.015 55-59 23.03 28.660000000000004 27.465 20.845 60-64 23.599999999999998 27.61 27.584999999999997 21.205 65-69 22.994999999999997 27.700000000000003 28.27 21.035 70-74 22.99 28.89 27.215 20.905 75-79 23.32 28.360000000000003 27.63 20.69 80-84 23.44 27.589999999999996 28.07 20.9 85-89 23.77 27.67 27.775 20.785 90-94 23.885 27.994999999999997 27.755000000000003 20.365 95-99 23.880000000000003 28.134999999999998 27.36 20.625 100-104 23.810000000000002 28.15 27.584999999999997 20.455000000000002 105-109 23.294999999999998 28.115000000000002 28.425 20.165 110-114 23.474999999999998 28.005000000000003 28.084999999999997 20.435 115-119 23.419999999999998 28.4 27.779999999999998 20.4 120-124 23.919999999999998 28.299999999999997 27.55 20.23 125-129 23.945 28.38 27.060000000000002 20.615 130-134 24.68 27.43 27.560000000000002 20.330000000000002 135-139 24.41 27.800000000000004 27.925 19.865 140-144 24.51 28.23 27.215 20.044999999999998 145-149 24.47 28.249999999999996 26.790000000000003 20.49 150-151 24.5375 28.537499999999998 26.825 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.0 15 0.0 16 1.5 17 1.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 3.0 25 2.0 26 4.0 27 5.5 28 8.0 29 14.0 30 19.5 31 22.5 32 32.5 33 46.0 34 56.5 35 71.0 36 91.5 37 115.0 38 133.0 39 173.0 40 195.0 41 197.5 42 245.0 43 283.0 44 276.0 45 274.5 46 277.5 47 249.5 48 222.0 49 198.5 50 165.0 51 128.5 52 101.0 53 87.5 54 75.0 55 57.0 56 39.5 57 27.5 58 20.5 59 23.0 60 17.0 61 8.5 62 6.0 63 4.0 64 2.5 65 0.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.226148409894 84.82499999999999 2 6.985593911388964 12.85 3 0.6523511823865181 1.7999999999999998 4 0.10872519706441967 0.4 5 0.02718129926610492 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.5875000000000004 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.4 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATAGA 10 0.006830828 145.0 6 >>END_MODULE Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705983 spots for SRR12671010.sra Written 705983 spots for SRR12671010.sra Read 705998 spots for SRR12671010.sra Written 705998 spots for SRR12671010.sra SRR ids: ['SRR12671010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k_b8ph4p SRR12671010.sra spots: 14119675 blocks: [[1, 705983], [705984, 1411966], [1411967, 2117949], [2117950, 2823932], [2823933, 3529915], [3529916, 4235898], [4235899, 4941881], [4941882, 5647864], [5647865, 6353847], [6353848, 7059830], [7059831, 7765813], [7765814, 8471796], [8471797, 9177779], [9177780, 9883762], [9883763, 10589745], [10589746, 11295728], [11295729, 12001711], [12001712, 12707694], [12707695, 13413677], [13413678, 14119675]] SRR12671010 file size 4776782 SRR12671010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671010 SRR12671010_1.fastq SRR12671010_2.fastq Input file: SRR12671010_1.fastq Paired file: SRR12671010_2.fastq trimmed: SRR12671010-trimmed-pair1.fastq, SRR12671010-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:59:49 2025 >> started Tue Feb 11 13:00:05 2025 >> done (15.400s) 14119675 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 6337 ( 0.04%) empty read pairs filtered out after trimming by size control 14113266 (99.95%) read pairs available; of these: 822398 ( 5.83%) trimmed read pairs available after processing 13290868 (94.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 5 0.00% 22 15 0.00% 23 20 0.00% 24 12 0.00% 25 21 0.00% 26 17 0.00% 27 21 0.00% 28 25 0.00% 29 16 0.00% 30 13 0.00% 31 17 0.00% 32 24 0.00% 33 13 0.00% 34 21 0.00% 35 24 0.00% 36 17 0.00% 37 22 0.00% 38 14 0.00% 39 20 0.00% 40 24 0.00% 41 19 0.00% 42 19 0.00% 43 30 0.00% 44 39 0.00% 45 25 0.00% 46 25 0.00% 47 31 0.00% 48 21 0.00% 49 44 0.00% 50 52 0.00% 51 53 0.00% 52 60 0.00% 53 68 0.00% 54 68 0.00% 55 78 0.00% 56 80 0.00% 57 75 0.00% 58 97 0.00% 59 103 0.00% 60 152 0.00% 61 172 0.00% 62 157 0.00% 63 183 0.00% 64 197 0.00% 65 202 0.00% 66 244 0.00% 67 254 0.00% 68 257 0.00% 69 380 0.00% 70 428 0.00% 71 467 0.00% 72 561 0.00% 73 592 0.00% 74 697 0.00% 75 691 0.00% 76 839 0.01% 77 889 0.01% 78 933 0.01% 79 1149 0.01% 80 1137 0.01% 81 1434 0.01% 82 1522 0.01% 83 1625 0.01% 84 1873 0.01% 85 2043 0.01% 86 2175 0.02% 87 2405 0.02% 88 2494 0.02% 89 2688 0.02% 90 2881 0.02% 91 3117 0.02% 92 3275 0.02% 93 3641 0.03% 94 3885 0.03% 95 4133 0.03% 96 4561 0.03% 97 4710 0.03% 98 4748 0.03% 99 5119 0.04% 100 5412 0.04% 101 5475 0.04% 102 5835 0.04% 103 6276 0.04% 104 6463 0.05% 105 6752 0.05% 106 7417 0.05% 107 7590 0.05% 108 7846 0.06% 109 8190 0.06% 110 8437 0.06% 111 8555 0.06% 112 9051 0.06% 113 9187 0.07% 114 9766 0.07% 115 10247 0.07% 116 10520 0.07% 117 10807 0.08% 118 11280 0.08% 119 11650 0.08% 120 11910 0.08% 121 12535 0.09% 122 12823 0.09% 123 13051 0.09% 124 13867 0.10% 125 13904 0.10% 126 14637 0.10% 127 15044 0.11% 128 15777 0.11% 129 16042 0.11% 130 16268 0.12% 131 16589 0.12% 132 17391 0.12% 133 17315 0.12% 134 17767 0.13% 135 18493 0.13% 136 18754 0.13% 137 19370 0.14% 138 20146 0.14% 139 20923 0.15% 140 21185 0.15% 141 21907 0.16% 142 21990 0.16% 143 22604 0.16% 144 23306 0.17% 145 23465 0.17% 146 24219 0.17% 147 25250 0.18% 148 25905 0.18% 149 25793 0.18% 150 27137 0.19% 151 13290868 94.17% 14113266 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=12.86 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=6.3 sequence=TTGATGAAGAGGCAGCACATCTTTCCCTTCTTCTTGATTATATCAGCCGCCTCACGGTACCTTTGCCTGATAAG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=29 fanout-score=45.37 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=13.9 sequence=AAAGAAAAGAAAA SRR12671010 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:00:50 Started mapping on | Feb 11 13:00:50 Finished on | Feb 11 13:02:33 Mapping speed, Million of reads per hour | 493.28 Number of input reads | 14113266 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13143419 Uniquely mapped reads % | 93.13% Average mapped length | 297.75 Number of splices: Total | 13575472 Number of splices: Annotated (sjdb) | 13288964 Number of splices: GT/AG | 13312317 Number of splices: GC/AG | 214104 Number of splices: AT/AC | 8568 Number of splices: Non-canonical | 40483 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366148 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 42071 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 603699 603699 603699 N_multimapping 366148 366148 366148 N_noFeature 482754 12939486 548238 N_ambiguous 234749 888 95921 UnstrandedReadsAssigned:12425916 PositiveStrandReadsAssigned:203045 NegativeStrandReadsAssigned:12499260 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671010 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671010-trimmed-pair1.fastq SRR12671010-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,113,266 reads, 12,427,999 reads pseudoaligned [quant] estimated average fragment length: 279.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR12671010.ke.tsv 34699 SRR12671010.se.tsv 87100 total ==> SRR12671010.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.96 552 21.795 Potri.005G024800.1.v4.1 1035 756.955 213 19.3315 Potri.004G059700.1.v4.1 961 683.109 0 0 Potri.007G009000.2.v4.1 1416 1137.96 0 0 Potri.003G141000.2.v4.1 2943 2664.96 827 21.3192 Potri.016G087400.1.v4.1 270 73.5531 888 829.408 Potri.015G069301.1.v4.1 564 300.732 0 0 Potri.010G195200.1.v4.1 1773 1494.96 185 8.50158 Potri.012G127500.1.v4.1 977 699.052 59 5.79827 ==> SRR12671010.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671010 completed mapping pipeline successfully