Starting /dee2/code/volunteer_pipeline.sh SRR12671011 current disk space = 3050410897408 free memory = 1501639640 SRR12671011 SRAfilesize d48dd470e8d6746a88d01e5b5b950383 SRR12671011.sra SRR12671011.sra file validated SRR12671011 is paired end SRR12671011 is conventional basespace SRR12671011 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671011_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50775 37.0 37.0 37.0 37.0 37.0 2 36.363 37.0 37.0 37.0 37.0 37.0 3 36.527 37.0 37.0 37.0 37.0 37.0 4 36.604 37.0 37.0 37.0 37.0 37.0 5 36.5885 37.0 37.0 37.0 37.0 37.0 6 36.566 37.0 37.0 37.0 37.0 37.0 7 36.5955 37.0 37.0 37.0 37.0 37.0 8 36.5895 37.0 37.0 37.0 37.0 37.0 9 36.5925 37.0 37.0 37.0 37.0 37.0 10-14 36.6123 37.0 37.0 37.0 37.0 37.0 15-19 36.577600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.500800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5327 37.0 37.0 37.0 37.0 37.0 30-34 36.435500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4542 37.0 37.0 37.0 37.0 37.0 40-44 36.472500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4401 37.0 37.0 37.0 37.0 37.0 50-54 36.4151 37.0 37.0 37.0 37.0 37.0 55-59 36.4122 37.0 37.0 37.0 37.0 37.0 60-64 36.351200000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.378699999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3557 37.0 37.0 37.0 37.0 37.0 75-79 36.290400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2795 37.0 37.0 37.0 37.0 37.0 85-89 36.2312 37.0 37.0 37.0 37.0 37.0 90-94 36.2599 37.0 37.0 37.0 37.0 37.0 95-99 36.195899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.2153 37.0 37.0 37.0 37.0 37.0 105-109 36.1928 37.0 37.0 37.0 37.0 37.0 110-114 36.127599999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.0327 37.0 37.0 37.0 37.0 37.0 120-124 36.0419 37.0 37.0 37.0 37.0 37.0 125-129 36.000099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.852 37.0 37.0 37.0 37.0 37.0 135-139 35.8784 37.0 37.0 37.0 37.0 37.0 140-144 35.8335 37.0 37.0 37.0 37.0 37.0 145-149 35.6958 37.0 37.0 37.0 37.0 37.0 150-151 35.4755 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 2.0 24 1.0 25 4.0 26 6.0 27 8.0 28 24.0 29 20.0 30 33.0 31 41.0 32 45.0 33 60.0 34 130.0 35 267.0 36 2655.0 37 700.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.911227806951736 10.877719429857464 5.87646911727932 38.33458364591148 2 17.65 11.575000000000001 39.050000000000004 31.724999999999998 3 17.675 15.174999999999999 27.0 40.150000000000006 4 23.3 24.224999999999998 23.95 28.525 5 25.3 29.425 23.875 21.4 6 20.225 34.075 23.175 22.525000000000002 7 14.674999999999999 27.35 42.1 15.875 8 16.575 25.85 33.725 23.849999999999998 9 15.425 23.95 36.075 24.55 10-14 19.555 29.86 28.299999999999997 22.285 15-19 19.845 27.96 28.065 24.13 20-24 19.595000000000002 27.889999999999997 28.15 24.365000000000002 25-29 19.81 28.59 27.48 24.12 30-34 19.82 28.555000000000003 27.99 23.635 35-39 20.075000000000003 28.425 27.485 24.015 40-44 20.635 28.18 27.54 23.645 45-49 20.095 28.134999999999998 27.965 23.805 50-54 19.915 29.2 27.24 23.645 55-59 20.76 27.79 27.625 23.825 60-64 19.91 28.585 27.49 24.015 65-69 20.375 28.615000000000002 27.88 23.13 70-74 20.76 28.215 27.935 23.09 75-79 20.835 28.38 27.455000000000002 23.330000000000002 80-84 19.84 28.82 27.615000000000002 23.724999999999998 85-89 20.150000000000002 28.365000000000002 27.775 23.71 90-94 20.125 28.939999999999998 27.365000000000002 23.57 95-99 21.125 27.500000000000004 27.750000000000004 23.625 100-104 20.965 27.99 27.534999999999997 23.51 105-109 20.75 27.755000000000003 27.884999999999998 23.61 110-114 20.29 28.83 27.589999999999996 23.29 115-119 20.835 27.485 28.360000000000003 23.32 120-124 20.285 27.805000000000003 28.025 23.885 125-129 20.415 27.88 27.250000000000004 24.455 130-134 20.95 28.015 27.689999999999998 23.345 135-139 20.995 27.689999999999998 27.35 23.965 140-144 21.349999999999998 28.134999999999998 27.24 23.275000000000002 145-149 21.029999999999998 27.395000000000003 28.04 23.535 150-151 21.3 27.825 26.8125 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.5 18 1.0 19 1.0 20 1.5 21 0.5 22 2.0 23 3.5 24 3.0 25 4.0 26 4.0 27 6.0 28 11.5 29 16.0 30 20.5 31 24.0 32 32.5 33 42.0 34 50.5 35 69.5 36 83.0 37 98.0 38 124.0 39 147.5 40 170.0 41 215.5 42 233.0 43 248.5 44 269.5 45 247.0 46 247.5 47 258.0 48 237.5 49 216.5 50 189.5 51 148.5 52 127.5 53 103.0 54 91.0 55 72.0 56 47.5 57 36.0 58 25.0 59 19.5 60 15.5 61 14.0 62 6.0 63 2.5 64 1.0 65 1.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.375 #Duplication Level Percentage of deduplicated Percentage of total 1 89.56643356643357 80.05 2 9.202797202797203 16.45 3 1.034965034965035 2.775 4 0.16783216783216784 0.6 5 0.027972027972027972 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCACTTGAAGGAAGGAAGAGATCATGTTTCTGGTCTTTATAAGCACTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCGG 10 0.006830828 145.0 145 >>END_MODULE SRR12671011 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671011_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2295 37.0 37.0 37.0 37.0 37.0 2 36.038 37.0 37.0 37.0 37.0 37.0 3 36.221 37.0 37.0 37.0 37.0 37.0 4 36.237 37.0 37.0 37.0 37.0 37.0 5 36.384 37.0 37.0 37.0 37.0 37.0 6 36.295 37.0 37.0 37.0 37.0 37.0 7 36.253 37.0 37.0 37.0 37.0 37.0 8 36.346 37.0 37.0 37.0 37.0 37.0 9 36.345 37.0 37.0 37.0 37.0 37.0 10-14 36.3389 37.0 37.0 37.0 37.0 37.0 15-19 36.30459999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.346900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.26969999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.2021 37.0 37.0 37.0 37.0 37.0 35-39 36.1625 37.0 37.0 37.0 37.0 37.0 40-44 36.12650000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.18150000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1576 37.0 37.0 37.0 37.0 37.0 55-59 36.157799999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.1372 37.0 37.0 37.0 37.0 37.0 65-69 36.1302 37.0 37.0 37.0 37.0 37.0 70-74 36.0933 37.0 37.0 37.0 37.0 37.0 75-79 36.099900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.01690000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.0207 37.0 37.0 37.0 37.0 37.0 90-94 35.9489 37.0 37.0 37.0 37.0 37.0 95-99 36.034000000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.966499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.908100000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.83540000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8726 37.0 37.0 37.0 37.0 37.0 120-124 35.8314 37.0 37.0 37.0 37.0 37.0 125-129 35.729400000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.7565 37.0 37.0 37.0 37.0 37.0 135-139 35.610400000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.644999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.44670000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.224500000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 0.0 16 2.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 2.0 23 8.0 24 7.0 25 12.0 26 11.0 27 17.0 28 14.0 29 18.0 30 22.0 31 38.0 32 74.0 33 72.0 34 168.0 35 425.0 36 2643.0 37 461.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 25.424999999999997 8.85 26.075 2 26.05 27.800000000000004 30.349999999999998 15.8 3 20.674999999999997 27.025 32.35 19.950000000000003 4 24.675 33.675 21.775 19.875 5 24.75 37.0 21.925 16.325 6 19.400000000000002 39.875 21.625 19.1 7 19.675 21.45 38.75 20.125 8 19.425 25.424999999999997 29.825000000000003 25.324999999999996 9 22.025 24.099999999999998 29.849999999999998 24.025 10-14 23.11 29.64 26.255 20.995 15-19 22.965 27.634999999999998 28.175 21.224999999999998 20-24 22.665 28.53 27.615000000000002 21.19 25-29 22.055 28.794999999999998 28.235 20.915 30-34 22.41 28.244999999999997 28.01 21.335 35-39 23.150000000000002 27.92 27.700000000000003 21.23 40-44 22.845 28.144999999999996 27.92 21.09 45-49 23.51 27.465 27.894999999999996 21.13 50-54 22.63 28.244999999999997 28.050000000000004 21.075 55-59 23.265 28.235 27.51 20.990000000000002 60-64 23.27 27.525 27.775 21.43 65-69 22.884999999999998 27.625 28.025 21.465 70-74 23.385 27.985 27.075 21.555 75-79 22.785 27.965 27.785 21.465 80-84 23.185 28.134999999999998 27.339999999999996 21.34 85-89 22.795 28.005000000000003 27.88 21.32 90-94 23.615 27.750000000000004 27.52 21.115000000000002 95-99 23.044999999999998 28.33 27.415 21.21 100-104 23.745 27.72 27.485 21.05 105-109 23.66 28.285 27.055 21.0 110-114 23.635 27.55 27.944999999999997 20.87 115-119 23.875 27.6 27.474999999999998 21.05 120-124 23.985 28.225 27.51 20.28 125-129 24.005000000000003 28.22 27.375 20.4 130-134 24.19 27.355 27.785 20.669999999999998 135-139 24.295 27.839999999999996 27.58 20.285 140-144 24.560000000000002 27.060000000000002 27.82 20.560000000000002 145-149 24.125 28.249999999999996 27.16 20.465 150-151 24.425 28.487499999999997 26.937499999999996 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 1.5 25 1.5 26 4.0 27 9.0 28 9.5 29 10.5 30 18.0 31 22.5 32 28.0 33 36.0 34 53.0 35 74.0 36 78.5 37 92.0 38 118.5 39 166.0 40 210.5 41 237.0 42 238.5 43 248.0 44 272.5 45 266.0 46 258.5 47 247.0 48 232.0 49 215.0 50 177.0 51 137.0 52 108.5 53 95.5 54 81.0 55 59.0 56 45.0 57 32.0 58 26.5 59 21.5 60 15.0 61 11.0 62 10.0 63 8.5 64 3.5 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.45 #Duplication Level Percentage of deduplicated Percentage of total 1 89.7428731134712 80.27499999999999 2 9.02738960313024 16.150000000000002 3 1.0061486864169928 2.7 4 0.1956400223588597 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.027948574622694244 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 3.9625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512283 spots for SRR12671011.sra Written 512283 spots for SRR12671011.sra Read 512284 spots for SRR12671011.sra Written 512284 spots for SRR12671011.sra SRR ids: ['SRR12671011.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4p5g7k3n SRR12671011.sra spots: 10245661 blocks: [[1, 512283], [512284, 1024566], [1024567, 1536849], [1536850, 2049132], [2049133, 2561415], [2561416, 3073698], [3073699, 3585981], [3585982, 4098264], [4098265, 4610547], [4610548, 5122830], [5122831, 5635113], [5635114, 6147396], [6147397, 6659679], [6659680, 7171962], [7171963, 7684245], [7684246, 8196528], [8196529, 8708811], [8708812, 9221094], [9221095, 9733377], [9733378, 10245661]] SRR12671011 file size 3460223 SRR12671011 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671011 SRR12671011_1.fastq SRR12671011_2.fastq Input file: SRR12671011_1.fastq Paired file: SRR12671011_2.fastq trimmed: SRR12671011-trimmed-pair1.fastq, SRR12671011-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:37:53 2025 >> started Tue Feb 11 13:38:05 2025 >> done (12.068s) 10245661 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 1482 ( 0.01%) empty read pairs filtered out after trimming by size control 10244128 (99.99%) read pairs available; of these: 524412 ( 5.12%) trimmed read pairs available after processing 9719716 (94.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 6 0.00% 21 6 0.00% 22 3 0.00% 23 5 0.00% 24 7 0.00% 25 11 0.00% 26 4 0.00% 27 5 0.00% 28 7 0.00% 29 4 0.00% 30 10 0.00% 31 9 0.00% 32 7 0.00% 33 1 0.00% 34 4 0.00% 35 5 0.00% 36 5 0.00% 37 7 0.00% 38 9 0.00% 39 6 0.00% 40 15 0.00% 41 15 0.00% 42 11 0.00% 43 12 0.00% 44 6 0.00% 45 13 0.00% 46 20 0.00% 47 17 0.00% 48 15 0.00% 49 20 0.00% 50 29 0.00% 51 24 0.00% 52 21 0.00% 53 18 0.00% 54 26 0.00% 55 15 0.00% 56 31 0.00% 57 34 0.00% 58 45 0.00% 59 36 0.00% 60 69 0.00% 61 78 0.00% 62 73 0.00% 63 78 0.00% 64 111 0.00% 65 97 0.00% 66 128 0.00% 67 111 0.00% 68 134 0.00% 69 157 0.00% 70 192 0.00% 71 235 0.00% 72 235 0.00% 73 282 0.00% 74 320 0.00% 75 326 0.00% 76 373 0.00% 77 408 0.00% 78 461 0.00% 79 532 0.01% 80 562 0.01% 81 618 0.01% 82 731 0.01% 83 785 0.01% 84 902 0.01% 85 983 0.01% 86 1089 0.01% 87 1182 0.01% 88 1395 0.01% 89 1426 0.01% 90 1590 0.02% 91 1588 0.02% 92 1767 0.02% 93 1955 0.02% 94 2120 0.02% 95 2299 0.02% 96 2427 0.02% 97 2535 0.02% 98 2711 0.03% 99 2864 0.03% 100 3034 0.03% 101 3204 0.03% 102 3511 0.03% 103 3701 0.04% 104 3764 0.04% 105 4074 0.04% 106 4177 0.04% 107 4630 0.05% 108 4560 0.04% 109 4916 0.05% 110 5046 0.05% 111 5224 0.05% 112 5401 0.05% 113 5532 0.05% 114 6041 0.06% 115 6113 0.06% 116 6658 0.06% 117 6732 0.07% 118 7068 0.07% 119 7232 0.07% 120 7670 0.07% 121 7960 0.08% 122 7984 0.08% 123 8270 0.08% 124 8925 0.09% 125 8979 0.09% 126 9458 0.09% 127 9656 0.09% 128 9943 0.10% 129 10416 0.10% 130 10664 0.10% 131 10840 0.11% 132 11169 0.11% 133 11374 0.11% 134 11757 0.11% 135 12117 0.12% 136 12309 0.12% 137 13004 0.13% 138 13316 0.13% 139 13789 0.13% 140 13940 0.14% 141 14484 0.14% 142 14979 0.15% 143 15045 0.15% 144 15761 0.15% 145 15940 0.16% 146 16560 0.16% 147 16874 0.16% 148 17453 0.17% 149 17900 0.17% 150 18779 0.18% 151 9719716 94.88% 10244128 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=10.86 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.3 sequence=TCTCCATACTTCTAAGCACTCAACTTTGCTTGCTTCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=26 prefix-density=0.66 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.18 sequence-density-rank=27 fanout-score=19.05 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=6.0 sequence=GCAATGGCAGCCTCAGTTATGGCTTCATT SRR12671011 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:39:00 Started mapping on | Feb 11 13:39:01 Finished on | Feb 11 13:40:02 Mapping speed, Million of reads per hour | 604.57 Number of input reads | 10244128 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9195039 Uniquely mapped reads % | 89.76% Average mapped length | 295.02 Number of splices: Total | 9322541 Number of splices: Annotated (sjdb) | 9146094 Number of splices: GT/AG | 9132126 Number of splices: GC/AG | 157482 Number of splices: AT/AC | 5525 Number of splices: Non-canonical | 27408 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237247 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 90777 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.86% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 811842 811842 811842 N_multimapping 237247 237247 237247 N_noFeature 335192 9053879 375554 N_ambiguous 181471 996 79942 UnstrandedReadsAssigned:8678376 PositiveStrandReadsAssigned:140164 NegativeStrandReadsAssigned:8739543 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671011 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671011-trimmed-pair1.fastq SRR12671011-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,244,128 reads, 9,097,350 reads pseudoaligned [quant] estimated average fragment length: 279.518 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 999 rounds 52401 SRR12671011.ke.tsv 34699 SRR12671011.se.tsv 87100 total ==> SRR12671011.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.48 394 21.2963 Potri.005G024800.1.v4.1 1035 756.482 101 12.5531 Potri.004G059700.1.v4.1 961 682.68 1 0.137724 Potri.007G009000.2.v4.1 1416 1137.48 0 0 Potri.003G141000.2.v4.1 2943 2664.48 591.616 20.8764 Potri.016G087400.1.v4.1 270 74.1402 373 473.024 Potri.015G069301.1.v4.1 564 301.509 0 0 Potri.010G195200.1.v4.1 1773 1494.48 79 4.97009 Potri.012G127500.1.v4.1 977 698.586 16 2.15342 ==> SRR12671011.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 90 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671011 completed mapping pipeline successfully