Starting /dee2/code/volunteer_pipeline.sh SRR12671012 current disk space = 3050346786816 free memory = 1086399208 SRR12671012 SRAfilesize 0de1fc4b1b711aac342576705d142321 SRR12671012.sra SRR12671012.sra file validated SRR12671012 is paired end SRR12671012 is conventional basespace SRR12671012 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.379 37.0 37.0 37.0 37.0 37.0 2 36.35 37.0 37.0 37.0 37.0 37.0 3 36.443 37.0 37.0 37.0 37.0 37.0 4 36.558 37.0 37.0 37.0 37.0 37.0 5 36.5515 37.0 37.0 37.0 37.0 37.0 6 36.5505 37.0 37.0 37.0 37.0 37.0 7 36.551 37.0 37.0 37.0 37.0 37.0 8 36.618 37.0 37.0 37.0 37.0 37.0 9 36.594 37.0 37.0 37.0 37.0 37.0 10-14 36.5978 37.0 37.0 37.0 37.0 37.0 15-19 36.571 37.0 37.0 37.0 37.0 37.0 20-24 36.5979 37.0 37.0 37.0 37.0 37.0 25-29 36.54110000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.482600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4966 37.0 37.0 37.0 37.0 37.0 40-44 36.45139999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.427800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.410199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3845 37.0 37.0 37.0 37.0 37.0 60-64 36.3719 37.0 37.0 37.0 37.0 37.0 65-69 36.366600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3535 37.0 37.0 37.0 37.0 37.0 75-79 36.3596 37.0 37.0 37.0 37.0 37.0 80-84 36.2795 37.0 37.0 37.0 37.0 37.0 85-89 36.296499999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.272 37.0 37.0 37.0 37.0 37.0 95-99 36.2039 37.0 37.0 37.0 37.0 37.0 100-104 36.214 37.0 37.0 37.0 37.0 37.0 105-109 36.21660000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1947 37.0 37.0 37.0 37.0 37.0 115-119 36.08669999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0789 37.0 37.0 37.0 37.0 37.0 125-129 36.0501 37.0 37.0 37.0 37.0 37.0 130-134 35.9523 37.0 37.0 37.0 37.0 37.0 135-139 35.9426 37.0 37.0 37.0 37.0 37.0 140-144 35.927099999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.82809999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.54575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 2.0 24 2.0 25 4.0 26 7.0 27 8.0 28 11.0 29 24.0 30 19.0 31 44.0 32 58.0 33 70.0 34 111.0 35 228.0 36 2775.0 37 633.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.023011505752876 12.406203101550775 5.452726363181591 36.11805902951476 2 18.825 11.4 36.775000000000006 33.0 3 18.15 15.75 27.700000000000003 38.4 4 23.05 23.200000000000003 22.725 31.025000000000002 5 22.775000000000002 29.775000000000002 25.75 21.7 6 21.875 32.275 24.525 21.325 7 15.299999999999999 27.125 41.4 16.175 8 17.275 25.624999999999996 32.45 24.65 9 17.724999999999998 23.775 34.75 23.75 10-14 19.6 30.535 27.73 22.134999999999998 15-19 20.23 27.985 28.16 23.625 20-24 20.14 28.444999999999997 27.62 23.794999999999998 25-29 20.455000000000002 28.465 27.534999999999997 23.544999999999998 30-34 20.474999999999998 28.68 26.97 23.875 35-39 20.23 28.585 27.52 23.665 40-44 20.495 28.749999999999996 27.634999999999998 23.119999999999997 45-49 20.565 28.060000000000002 27.845 23.53 50-54 20.19 28.994999999999997 27.644999999999996 23.169999999999998 55-59 19.695 28.51 28.275 23.52 60-64 19.61 28.355000000000004 27.839999999999996 24.195 65-69 20.69 27.855 27.93 23.525 70-74 20.105 28.225 28.044999999999998 23.625 75-79 20.805 27.994999999999997 28.055000000000003 23.145 80-84 20.745 28.08 27.965 23.21 85-89 21.044999999999998 28.235 27.36 23.36 90-94 21.04 27.905 27.715 23.34 95-99 20.200000000000003 28.32 27.834999999999997 23.645 100-104 20.544999999999998 27.900000000000002 27.939999999999998 23.615 105-109 20.985 28.09 27.544999999999998 23.380000000000003 110-114 20.575 27.794999999999998 28.105000000000004 23.525 115-119 20.515 28.42 27.279999999999998 23.785 120-124 20.849999999999998 28.33 27.16 23.66 125-129 20.59 28.15 26.965 24.295 130-134 20.46 28.155 27.575 23.810000000000002 135-139 20.565 28.17 27.63 23.635 140-144 20.84 27.87 27.744999999999997 23.544999999999998 145-149 20.78 28.465 26.8 23.955000000000002 150-151 20.575 28.349999999999998 26.55 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 2.0 23 3.0 24 2.0 25 2.5 26 4.5 27 6.5 28 8.5 29 14.0 30 19.0 31 24.0 32 34.0 33 50.0 34 60.5 35 66.5 36 79.5 37 101.0 38 117.0 39 135.0 40 172.0 41 209.5 42 227.0 43 243.5 44 260.0 45 268.5 46 265.0 47 267.0 48 257.0 49 213.5 50 180.5 51 146.5 52 125.5 53 112.5 54 80.0 55 58.5 56 48.0 57 38.0 58 29.0 59 15.5 60 14.0 61 11.0 62 4.5 63 5.5 64 3.5 65 1.0 66 0.5 67 0.5 68 0.0 69 0.0 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97278911564626 84.5 2 7.29251700680272 13.4 3 0.6802721088435374 1.875 4 0.027210884353741496 0.1 5 0.027210884353741496 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.3625 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCATA 10 0.006830828 145.0 1 >>END_MODULE SRR12671012 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671012_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3115 37.0 37.0 37.0 37.0 37.0 2 36.1835 37.0 37.0 37.0 37.0 37.0 3 36.3025 37.0 37.0 37.0 37.0 37.0 4 36.254 37.0 37.0 37.0 37.0 37.0 5 36.2985 37.0 37.0 37.0 37.0 37.0 6 36.274 37.0 37.0 37.0 37.0 37.0 7 36.357 37.0 37.0 37.0 37.0 37.0 8 36.3845 37.0 37.0 37.0 37.0 37.0 9 36.301 37.0 37.0 37.0 37.0 37.0 10-14 36.3489 37.0 37.0 37.0 37.0 37.0 15-19 36.351 37.0 37.0 37.0 37.0 37.0 20-24 36.3121 37.0 37.0 37.0 37.0 37.0 25-29 36.2491 37.0 37.0 37.0 37.0 37.0 30-34 36.248999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1903 37.0 37.0 37.0 37.0 37.0 40-44 36.1404 37.0 37.0 37.0 37.0 37.0 45-49 36.1689 37.0 37.0 37.0 37.0 37.0 50-54 36.1529 37.0 37.0 37.0 37.0 37.0 55-59 36.115300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.147400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.101299999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.0918 37.0 37.0 37.0 37.0 37.0 75-79 36.0115 37.0 37.0 37.0 37.0 37.0 80-84 36.094899999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0264 37.0 37.0 37.0 37.0 37.0 90-94 35.991600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.983900000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.0355 37.0 37.0 37.0 37.0 37.0 105-109 35.886199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.9074 37.0 37.0 37.0 37.0 37.0 115-119 35.9377 37.0 37.0 37.0 37.0 37.0 120-124 35.8198 37.0 37.0 37.0 37.0 37.0 125-129 35.7214 37.0 37.0 37.0 37.0 37.0 130-134 35.793400000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7554 37.0 37.0 37.0 37.0 37.0 140-144 35.74849999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.550799999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.25675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 0.0 14 6.0 15 4.0 16 2.0 17 1.0 18 3.0 19 1.0 20 2.0 21 4.0 22 8.0 23 6.0 24 5.0 25 5.0 26 12.0 27 9.0 28 7.0 29 27.0 30 26.0 31 18.0 32 46.0 33 77.0 34 157.0 35 352.0 36 2647.0 37 572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.2 25.525 9.55 24.725 2 27.750000000000004 25.025 30.7 16.525000000000002 3 20.25 26.724999999999998 33.900000000000006 19.125 4 24.4 33.875 23.45 18.275 5 24.55 39.1 20.625 15.725 6 20.325 41.075 21.0 17.599999999999998 7 20.925 23.150000000000002 37.5 18.425 8 21.2 26.575 27.725 24.5 9 20.974999999999998 24.975 31.075000000000003 22.975 10-14 22.455 29.01 27.165 21.37 15-19 22.795 28.249999999999996 27.255000000000003 21.7 20-24 22.655 28.95 27.775 20.62 25-29 22.585 27.76 28.43 21.224999999999998 30-34 22.81 28.249999999999996 27.93 21.01 35-39 22.405 28.444999999999997 27.855 21.295 40-44 22.555 28.605000000000004 27.71 21.13 45-49 22.805 28.04 28.17 20.985 50-54 22.99 28.655 27.36 20.995 55-59 23.22 28.610000000000003 27.650000000000002 20.52 60-64 22.675 28.060000000000002 27.97 21.295 65-69 23.0 28.125 27.79 21.085 70-74 22.75 28.175 27.66 21.415 75-79 22.82 28.005000000000003 27.644999999999996 21.529999999999998 80-84 23.21 28.294999999999998 27.27 21.224999999999998 85-89 23.265 28.27 27.105 21.36 90-94 23.445 27.67 27.71 21.175 95-99 23.674999999999997 28.015 27.29 21.02 100-104 23.599999999999998 27.6 28.005000000000003 20.794999999999998 105-109 23.75 27.775 27.605 20.87 110-114 23.195 28.23 27.655 20.919999999999998 115-119 23.775 28.15 26.685 21.39 120-124 23.455000000000002 28.345 27.04 21.16 125-129 23.080000000000002 28.655 27.245 21.02 130-134 23.765 28.235 27.01 20.990000000000002 135-139 24.095 27.925 27.235 20.745 140-144 23.44 28.285 27.91 20.365 145-149 24.565 27.615000000000002 27.310000000000002 20.51 150-151 23.974999999999998 27.725 27.6125 20.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 1.5 16 1.5 17 0.0 18 1.0 19 1.5 20 2.5 21 3.5 22 3.5 23 3.5 24 4.5 25 5.0 26 7.5 27 9.0 28 9.5 29 14.0 30 15.0 31 18.0 32 30.5 33 34.5 34 47.5 35 60.5 36 78.0 37 115.5 38 147.5 39 167.5 40 176.5 41 208.0 42 236.5 43 268.5 44 297.0 45 287.5 46 268.5 47 240.0 48 224.0 49 207.5 50 169.0 51 139.0 52 115.5 53 90.0 54 74.0 55 56.5 56 39.0 57 29.0 58 19.5 59 15.0 60 12.5 61 9.5 62 5.5 63 2.5 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 1.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.84619580038178 84.2 2 7.444777747477501 13.65 3 0.5726752113444232 1.575 4 0.08181074447777476 0.3 5 0.02727024815925825 0.125 6 0.02727024815925825 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.8499999999999996 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 75 0.0012377208 13.533334 140-144 >>END_MODULE Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064222 spots for SRR12671012.sra Written 1064222 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra Read 1064211 spots for SRR12671012.sra Written 1064211 spots for SRR12671012.sra SRR ids: ['SRR12671012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8_br7q4z SRR12671012.sra spots: 21284231 blocks: [[1, 1064211], [1064212, 2128422], [2128423, 3192633], [3192634, 4256844], [4256845, 5321055], [5321056, 6385266], [6385267, 7449477], [7449478, 8513688], [8513689, 9577899], [9577900, 10642110], [10642111, 11706321], [11706322, 12770532], [12770533, 13834743], [13834744, 14898954], [14898955, 15963165], [15963166, 17027376], [17027377, 18091587], [18091588, 19155798], [19155799, 20220009], [20220010, 21284231]] SRR12671012 file size 7211612 SRR12671012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671012 SRR12671012_1.fastq SRR12671012_2.fastq Input file: SRR12671012_1.fastq Paired file: SRR12671012_2.fastq trimmed: SRR12671012-trimmed-pair1.fastq, SRR12671012-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:22:13 2025 >> started Tue Feb 11 13:22:38 2025 >> done (24.515s) 21284231 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 6500 ( 0.03%) empty read pairs filtered out after trimming by size control 21277682 (99.97%) read pairs available; of these: 957576 ( 4.50%) trimmed read pairs available after processing 20320106 (95.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 6 0.00% 23 9 0.00% 24 10 0.00% 25 12 0.00% 26 11 0.00% 27 9 0.00% 28 12 0.00% 29 16 0.00% 30 20 0.00% 31 8 0.00% 32 8 0.00% 33 9 0.00% 34 14 0.00% 35 9 0.00% 36 5 0.00% 37 15 0.00% 38 19 0.00% 39 9 0.00% 40 11 0.00% 41 17 0.00% 42 26 0.00% 43 14 0.00% 44 23 0.00% 45 17 0.00% 46 22 0.00% 47 41 0.00% 48 39 0.00% 49 50 0.00% 50 49 0.00% 51 42 0.00% 52 46 0.00% 53 50 0.00% 54 56 0.00% 55 66 0.00% 56 67 0.00% 57 84 0.00% 58 73 0.00% 59 114 0.00% 60 101 0.00% 61 145 0.00% 62 150 0.00% 63 153 0.00% 64 216 0.00% 65 228 0.00% 66 207 0.00% 67 271 0.00% 68 269 0.00% 69 342 0.00% 70 365 0.00% 71 429 0.00% 72 496 0.00% 73 546 0.00% 74 697 0.00% 75 696 0.00% 76 760 0.00% 77 894 0.00% 78 950 0.00% 79 965 0.00% 80 1114 0.01% 81 1346 0.01% 82 1367 0.01% 83 1597 0.01% 84 1767 0.01% 85 1912 0.01% 86 2173 0.01% 87 2325 0.01% 88 2531 0.01% 89 2677 0.01% 90 2949 0.01% 91 3117 0.01% 92 3342 0.02% 93 3705 0.02% 94 4000 0.02% 95 4320 0.02% 96 4483 0.02% 97 4771 0.02% 98 5117 0.02% 99 5192 0.02% 100 5601 0.03% 101 5746 0.03% 102 6097 0.03% 103 6557 0.03% 104 6885 0.03% 105 7066 0.03% 106 7570 0.04% 107 7981 0.04% 108 8274 0.04% 109 8386 0.04% 110 8707 0.04% 111 9297 0.04% 112 9534 0.04% 113 9878 0.05% 114 10387 0.05% 115 10929 0.05% 116 11488 0.05% 117 12066 0.06% 118 12583 0.06% 119 12869 0.06% 120 13756 0.06% 121 13987 0.07% 122 14287 0.07% 123 14917 0.07% 124 15559 0.07% 125 15965 0.08% 126 16866 0.08% 127 17428 0.08% 128 17678 0.08% 129 18330 0.09% 130 19105 0.09% 131 19334 0.09% 132 19849 0.09% 133 20772 0.10% 134 21200 0.10% 135 22386 0.11% 136 22788 0.11% 137 23654 0.11% 138 24382 0.11% 139 25735 0.12% 140 26276 0.12% 141 26934 0.13% 142 27609 0.13% 143 28326 0.13% 144 28915 0.14% 145 29724 0.14% 146 30373 0.14% 147 31220 0.15% 148 33159 0.16% 149 33688 0.16% 150 35663 0.17% 151 20320106 95.50% 21277682 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=24 fanout-score=14.09 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=2.2 sequence=TGCTTGCTTCTAATCTTAA criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=27 prefix-density=1.21 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=31.39 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.1 sequence=AAAACACAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTATCATTGCCTTCTCTCC SRR12671012 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:23:22 Started mapping on | Feb 11 13:23:23 Finished on | Feb 11 13:26:02 Mapping speed, Million of reads per hour | 481.76 Number of input reads | 21277682 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19758521 Uniquely mapped reads % | 92.86% Average mapped length | 298.56 Number of splices: Total | 20123469 Number of splices: Annotated (sjdb) | 19705850 Number of splices: GT/AG | 19717369 Number of splices: GC/AG | 326494 Number of splices: AT/AC | 11805 Number of splices: Non-canonical | 67801 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518089 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 72945 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1001072 1001072 1001072 N_multimapping 518089 518089 518089 N_noFeature 679653 19420447 770716 N_ambiguous 396270 1213 148618 UnstrandedReadsAssigned:18682598 PositiveStrandReadsAssigned:336861 NegativeStrandReadsAssigned:18839187 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671012 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671012-trimmed-pair1.fastq SRR12671012-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,277,682 reads, 18,822,906 reads pseudoaligned [quant] estimated average fragment length: 284.743 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12671012.ke.tsv 34699 SRR12671012.se.tsv 87100 total ==> SRR12671012.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.26 730 17.687 Potri.005G024800.1.v4.1 1035 751.257 344 19.2404 Potri.004G059700.1.v4.1 961 677.483 1 0.0620219 Potri.007G009000.2.v4.1 1416 1132.26 0 0 Potri.003G141000.2.v4.1 2943 2659.26 1562.23 24.6847 Potri.016G087400.1.v4.1 270 70.1516 1166 698.4 Potri.015G069301.1.v4.1 564 296.099 0 0 Potri.010G195200.1.v4.1 1773 1489.26 81 2.28538 Potri.012G127500.1.v4.1 977 693.372 157 9.51431 ==> SRR12671012.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 224 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR12671012 completed mapping pipeline successfully