Starting /dee2/code/volunteer_pipeline.sh SRR12671013 current disk space = 3050312617984 free memory = 1458225536 SRR12671013 SRAfilesize 6a7a9687ba2d0c5d97e6d1a5299f71c3 SRR12671013.sra SRR12671013.sra file validated SRR12671013 is paired end SRR12671013 is conventional basespace SRR12671013 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.462 37.0 37.0 37.0 37.0 37.0 2 36.359 37.0 37.0 37.0 37.0 37.0 3 36.5555 37.0 37.0 37.0 37.0 37.0 4 36.619 37.0 37.0 37.0 37.0 37.0 5 36.619 37.0 37.0 37.0 37.0 37.0 6 36.6545 37.0 37.0 37.0 37.0 37.0 7 36.631 37.0 37.0 37.0 37.0 37.0 8 36.5915 37.0 37.0 37.0 37.0 37.0 9 36.6045 37.0 37.0 37.0 37.0 37.0 10-14 36.603899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5899 37.0 37.0 37.0 37.0 37.0 20-24 36.5292 37.0 37.0 37.0 37.0 37.0 25-29 36.54729999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.4842 37.0 37.0 37.0 37.0 37.0 35-39 36.5323 37.0 37.0 37.0 37.0 37.0 40-44 36.3889 37.0 37.0 37.0 37.0 37.0 45-49 36.021699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.13459999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.7074 37.0 37.0 37.0 37.0 37.0 60-64 35.71150000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.590199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8627 37.0 37.0 37.0 37.0 37.0 75-79 36.313100000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.281 37.0 37.0 37.0 37.0 37.0 85-89 36.2341 37.0 37.0 37.0 37.0 37.0 90-94 36.276700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2439 37.0 37.0 37.0 37.0 37.0 100-104 36.221799999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1605 37.0 37.0 37.0 37.0 37.0 110-114 36.123200000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.073 37.0 37.0 37.0 37.0 37.0 120-124 36.063 37.0 37.0 37.0 37.0 37.0 125-129 36.0711 37.0 37.0 37.0 37.0 37.0 130-134 35.9177 37.0 37.0 37.0 37.0 37.0 135-139 35.934000000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.888400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.772749999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.59425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 2.0 24 0.0 25 1.0 26 5.0 27 7.0 28 20.0 29 20.0 30 30.0 31 55.0 32 58.0 33 160.0 34 151.0 35 256.0 36 2576.0 37 654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.74999999999999 11.275 5.2749999999999995 31.7 2 19.875 13.725000000000001 36.225 30.175 3 16.325 15.55 31.35 36.775000000000006 4 21.349999999999998 21.224999999999998 24.125 33.300000000000004 5 28.9 27.224999999999998 23.225 20.65 6 22.95 32.225 22.825 22.0 7 14.975 30.599999999999998 38.35 16.075 8 15.725 29.825000000000003 31.900000000000002 22.55 9 19.2 23.375 33.925 23.5 10-14 19.825 30.55 26.810000000000002 22.814999999999998 15-19 20.595 28.115000000000002 27.495000000000005 23.794999999999998 20-24 20.555 28.715000000000003 27.61 23.119999999999997 25-29 19.939999999999998 28.105000000000004 27.54 24.415 30-34 18.94 28.465 28.025 24.57 35-39 21.23 27.13 28.355000000000004 23.285 40-44 19.994999999999997 27.51 28.505000000000003 23.990000000000002 45-49 20.445 28.345 28.16 23.05 50-54 21.515 26.724999999999998 27.555000000000003 24.205 55-59 20.29 26.76 28.544999999999998 24.404999999999998 60-64 20.830000000000002 27.505000000000003 28.49 23.175 65-69 20.355 30.070000000000004 27.02 22.555 70-74 22.775000000000002 27.41 26.8 23.015 75-79 23.3 27.675 26.88 22.145 80-84 23.305 27.025 26.200000000000003 23.47 85-89 23.575 27.345000000000002 26.41 22.67 90-94 23.169999999999998 26.615 26.06 24.154999999999998 95-99 23.35 26.69 26.56 23.400000000000002 100-104 23.525 27.3 26.400000000000002 22.775000000000002 105-109 22.685 26.195 27.845 23.275000000000002 110-114 23.425 26.705000000000002 27.229999999999997 22.64 115-119 24.22 26.915 26.86 22.005 120-124 24.065 26.99 26.58 22.365 125-129 23.845 27.415 26.22 22.52 130-134 23.925 26.334999999999997 26.6 23.14 135-139 24.535 26.44 26.76 22.264999999999997 140-144 23.56 27.01 26.27 23.16 145-149 24.24121206060303 26.48632431621581 25.796289814490724 23.476173808690433 150-151 23.9 26.937499999999996 26.6125 22.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 1.0 13 2.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.5 24 3.0 25 3.5 26 5.0 27 9.0 28 11.5 29 12.5 30 15.0 31 16.5 32 26.0 33 35.0 34 48.0 35 72.5 36 86.0 37 95.5 38 114.0 39 138.0 40 162.0 41 189.5 42 214.5 43 234.0 44 245.0 45 243.5 46 240.0 47 248.5 48 235.0 49 210.5 50 207.0 51 173.5 52 127.5 53 100.0 54 77.5 55 63.0 56 54.0 57 40.5 58 24.5 59 18.5 60 13.5 61 8.0 62 8.5 63 6.0 64 9.5 65 23.0 66 37.0 67 38.0 68 24.0 69 12.0 70 4.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.76834862385321 79.14999999999999 2 7.597477064220183 13.25 3 1.261467889908257 3.3000000000000003 4 0.25802752293577985 0.8999999999999999 5 0.028669724770642203 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05733944954128441 1.0 >50 0.028669724770642203 2.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGTCGGTATCTCGTAT 91 2.275 TruSeq Adapter, Index 15 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGTCGGTATCGCGTAT 28 0.7000000000000001 TruSeq Adapter, Index 15 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGTCGGTATCTCGTTT 12 0.3 TruSeq Adapter, Index 15 (97% over 38bp) GTAGCTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671013 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671013_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1 37.0 37.0 37.0 37.0 37.0 2 36.031 37.0 37.0 37.0 37.0 37.0 3 36.0215 37.0 37.0 37.0 37.0 37.0 4 36.1175 37.0 37.0 37.0 37.0 37.0 5 36.132 37.0 37.0 37.0 37.0 37.0 6 36.168 37.0 37.0 37.0 37.0 37.0 7 36.034 37.0 37.0 37.0 37.0 37.0 8 36.006 37.0 37.0 37.0 37.0 37.0 9 36.1345 37.0 37.0 37.0 37.0 37.0 10-14 35.908 37.0 37.0 37.0 37.0 37.0 15-19 35.8822 37.0 37.0 37.0 37.0 37.0 20-24 35.865700000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.4985 37.0 37.0 37.0 37.0 37.0 30-34 35.449799999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.3368 37.0 37.0 37.0 37.0 37.0 40-44 35.3035 37.0 37.0 37.0 37.0 37.0 45-49 35.2878 37.0 37.0 37.0 37.0 37.0 50-54 35.229600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.3373 37.0 37.0 37.0 37.0 37.0 60-64 35.427 37.0 37.0 37.0 37.0 37.0 65-69 35.3585 37.0 37.0 37.0 37.0 37.0 70-74 35.211499999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.153999999999996 37.0 37.0 37.0 34.6 37.0 80-84 35.3231 37.0 37.0 37.0 37.0 37.0 85-89 35.4823 37.0 37.0 37.0 37.0 37.0 90-94 35.60209999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.6551 37.0 37.0 37.0 37.0 37.0 100-104 35.7668 37.0 37.0 37.0 37.0 37.0 105-109 35.6302 37.0 37.0 37.0 37.0 37.0 110-114 35.6603 37.0 37.0 37.0 37.0 37.0 115-119 35.683350000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6086 37.0 37.0 37.0 37.0 37.0 125-129 35.541399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.54729999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.558800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.572050000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.38440000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.121 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 8.0 14 8.0 15 2.0 16 4.0 17 6.0 18 4.0 19 10.0 20 9.0 21 5.0 22 12.0 23 13.0 24 15.0 25 16.0 26 15.0 27 30.0 28 35.0 29 37.0 30 40.0 31 41.0 32 65.0 33 85.0 34 179.0 35 410.0 36 2519.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.05 24.525 8.05 20.375 2 30.525000000000002 25.674999999999997 28.349999999999998 15.45 3 23.05 26.75 32.425 17.775 4 26.55 32.65 22.975 17.825 5 27.3 35.775 20.775 16.150000000000002 6 23.5 36.85 21.775 17.875 7 23.200000000000003 22.125 35.125 19.55 8 22.075 26.125 27.925 23.875 9 25.275 24.325 28.15 22.25 10-14 25.965 28.105000000000004 25.2 20.73 15-19 25.540000000000003 27.07 26.400000000000002 20.990000000000002 20-24 25.97 27.450000000000003 26.534999999999997 20.044999999999998 25-29 25.88 26.945000000000004 26.784999999999997 20.39 30-34 25.395 26.72 27.175 20.71 35-39 24.84 26.965 27.6 20.595 40-44 24.875 26.91 27.805000000000003 20.41 45-49 24.635 26.46 28.389999999999997 20.515 50-54 24.725 26.974999999999998 27.525 20.775 55-59 25.135 27.01 26.86 20.995 60-64 26.415 26.61 26.290000000000003 20.685000000000002 65-69 24.965 27.275 26.834999999999997 20.925 70-74 25.264999999999997 27.685 27.13 19.919999999999998 75-79 24.985 27.05 26.974999999999998 20.990000000000002 80-84 25.515 27.515 26.150000000000002 20.82 85-89 26.295 27.41 26.08 20.215 90-94 26.179999999999996 26.419999999999998 26.590000000000003 20.810000000000002 95-99 25.874999999999996 26.8 27.025 20.3 100-104 26.400000000000002 26.765 26.534999999999997 20.3 105-109 26.384999999999998 26.69 26.935 19.99 110-114 26.33 27.27 26.224999999999998 20.175 115-119 27.03635181759088 27.471373568678437 26.10130506525326 19.390969548477425 120-124 27.0 26.99 26.38 19.63 125-129 27.084999999999997 26.584999999999997 26.119999999999997 20.21 130-134 26.529999999999998 26.375 26.605 20.49 135-139 27.255000000000003 26.8 26.13 19.814999999999998 140-144 26.63633181659083 27.076353817690883 26.32131606580329 19.965998299914997 145-149 28.005000000000003 26.57 25.6 19.825 150-151 27.487499999999997 27.1625 26.0625 19.287499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.5 23 3.5 24 2.5 25 2.5 26 5.0 27 8.0 28 12.0 29 12.5 30 11.5 31 16.0 32 21.5 33 31.5 34 40.0 35 51.0 36 69.5 37 94.5 38 114.5 39 145.5 40 182.0 41 199.5 42 217.5 43 252.0 44 272.0 45 278.5 46 279.5 47 254.0 48 225.5 49 206.0 50 171.0 51 133.0 52 114.0 53 92.5 54 78.5 55 69.0 56 51.0 57 33.0 58 22.5 59 21.5 60 19.5 61 11.5 62 7.5 63 7.5 64 6.0 65 2.0 66 1.0 67 1.0 68 1.0 69 1.5 70 2.0 71 3.0 72 3.0 73 2.0 74 2.0 75 1.5 76 2.0 77 2.0 78 1.5 79 1.5 80 1.0 81 2.0 82 3.0 83 2.0 84 2.0 85 2.0 86 2.0 87 1.5 88 2.0 89 3.5 90 3.0 91 3.0 92 2.5 93 2.5 94 4.0 95 4.0 96 5.0 97 6.5 98 11.5 99 13.0 100 22.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.75 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64345403899722 82.25 2 6.629526462395543 11.899999999999999 3 1.3370473537604457 3.5999999999999996 4 0.3064066852367688 1.0999999999999999 5 0.05571030640668524 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02785515320334262 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 36 0.8999999999999999 No Hit GCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCATC 5 0.125 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.7999999999999998 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.00593511 29.0 50-54 >>END_MODULE Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695659 spots for SRR12671013.sra Written 695659 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra Read 695647 spots for SRR12671013.sra Written 695647 spots for SRR12671013.sra SRR ids: ['SRR12671013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ncu527l SRR12671013.sra spots: 13912952 blocks: [[1, 695647], [695648, 1391294], [1391295, 2086941], [2086942, 2782588], [2782589, 3478235], [3478236, 4173882], [4173883, 4869529], [4869530, 5565176], [5565177, 6260823], [6260824, 6956470], [6956471, 7652117], [7652118, 8347764], [8347765, 9043411], [9043412, 9739058], [9739059, 10434705], [10434706, 11130352], [11130353, 11825999], [11826000, 12521646], [12521647, 13217293], [13217294, 13912952]] SRR12671013 file size 4706529 SRR12671013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671013 SRR12671013_1.fastq SRR12671013_2.fastq Input file: SRR12671013_1.fastq Paired file: SRR12671013_2.fastq trimmed: SRR12671013-trimmed-pair1.fastq, SRR12671013-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:26:30 2025 >> started Tue Feb 11 13:26:45 2025 >> done (15.758s) 13912952 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 460593 ( 3.31%) empty read pairs filtered out after trimming by size control 13452281 (96.69%) read pairs available; of these: 635530 ( 4.72%) trimmed read pairs available after processing 12816751 (95.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 11 0.00% 21 7 0.00% 22 6 0.00% 23 12 0.00% 24 11 0.00% 25 12 0.00% 26 12 0.00% 27 12 0.00% 28 20 0.00% 29 17 0.00% 30 23 0.00% 31 20 0.00% 32 18 0.00% 33 12 0.00% 34 13 0.00% 35 20 0.00% 36 20 0.00% 37 19 0.00% 38 21 0.00% 39 14 0.00% 40 13 0.00% 41 30 0.00% 42 20 0.00% 43 20 0.00% 44 15 0.00% 45 19 0.00% 46 37 0.00% 47 28 0.00% 48 27 0.00% 49 35 0.00% 50 42 0.00% 51 48 0.00% 52 55 0.00% 53 60 0.00% 54 60 0.00% 55 75 0.00% 56 77 0.00% 57 58 0.00% 58 79 0.00% 59 83 0.00% 60 94 0.00% 61 103 0.00% 62 119 0.00% 63 162 0.00% 64 178 0.00% 65 189 0.00% 66 192 0.00% 67 195 0.00% 68 246 0.00% 69 281 0.00% 70 331 0.00% 71 366 0.00% 72 413 0.00% 73 443 0.00% 74 500 0.00% 75 599 0.00% 76 641 0.00% 77 719 0.01% 78 774 0.01% 79 841 0.01% 80 916 0.01% 81 1114 0.01% 82 1127 0.01% 83 1270 0.01% 84 1403 0.01% 85 1543 0.01% 86 1790 0.01% 87 1839 0.01% 88 1910 0.01% 89 2114 0.02% 90 2226 0.02% 91 2434 0.02% 92 2535 0.02% 93 2821 0.02% 94 2983 0.02% 95 3267 0.02% 96 3504 0.03% 97 3712 0.03% 98 3709 0.03% 99 3944 0.03% 100 4099 0.03% 101 4334 0.03% 102 4658 0.03% 103 4964 0.04% 104 5079 0.04% 105 5351 0.04% 106 5636 0.04% 107 5757 0.04% 108 6120 0.05% 109 6059 0.05% 110 6467 0.05% 111 6419 0.05% 112 6900 0.05% 113 7125 0.05% 114 7363 0.05% 115 7557 0.06% 116 8095 0.06% 117 8435 0.06% 118 8633 0.06% 119 8920 0.07% 120 9292 0.07% 121 9540 0.07% 122 9648 0.07% 123 10042 0.07% 124 10801 0.08% 125 10756 0.08% 126 11289 0.08% 127 11421 0.08% 128 11478 0.09% 129 12271 0.09% 130 12451 0.09% 131 12897 0.10% 132 13412 0.10% 133 13512 0.10% 134 13902 0.10% 135 14252 0.11% 136 14884 0.11% 137 14745 0.11% 138 15168 0.11% 139 16249 0.12% 140 16214 0.12% 141 16647 0.12% 142 17175 0.13% 143 17888 0.13% 144 17996 0.13% 145 18518 0.14% 146 19277 0.14% 147 19260 0.14% 148 20121 0.15% 149 20275 0.15% 150 21435 0.16% 151 12816751 95.28% 13452281 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=22.68 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=1.09 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=135.28 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.6 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12671013 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:27:51 Started mapping on | Feb 11 13:27:51 Finished on | Feb 11 13:29:24 Mapping speed, Million of reads per hour | 520.73 Number of input reads | 13452281 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12578182 Uniquely mapped reads % | 93.50% Average mapped length | 298.35 Number of splices: Total | 12746315 Number of splices: Annotated (sjdb) | 12535030 Number of splices: GT/AG | 12487682 Number of splices: GC/AG | 221952 Number of splices: AT/AC | 6978 Number of splices: Non-canonical | 29703 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331321 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 41536 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 542778 542778 542778 N_multimapping 331321 331321 331321 N_noFeature 350926 12389147 408210 N_ambiguous 219747 663 87673 UnstrandedReadsAssigned:12007509 PositiveStrandReadsAssigned:188372 NegativeStrandReadsAssigned:12082299 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671013 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671013-trimmed-pair1.fastq SRR12671013-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,452,281 reads, 12,138,726 reads pseudoaligned [quant] estimated average fragment length: 286.276 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR12671013.ke.tsv 34699 SRR12671013.se.tsv 87100 total ==> SRR12671013.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.72 400 16.2479 Potri.005G024800.1.v4.1 1035 749.724 179 16.8042 Potri.004G059700.1.v4.1 961 675.89 31 3.22814 Potri.007G009000.2.v4.1 1416 1130.72 0 0 Potri.003G141000.2.v4.1 2943 2657.72 588 15.5716 Potri.016G087400.1.v4.1 270 70.2993 500.394 500.987 Potri.015G069301.1.v4.1 564 293.743 0 0 Potri.010G195200.1.v4.1 1773 1487.72 54 2.55468 Potri.012G127500.1.v4.1 977 691.834 244 24.823 ==> SRR12671013.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 486 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12671013 completed mapping pipeline successfully