Starting /dee2/code/volunteer_pipeline.sh SRR12671014 current disk space = 3050306457600 free memory = 1577255592 SRR12671014 SRAfilesize 0c5d36337df2cc49288c983fcfd6b3d6 SRR12671014.sra SRR12671014.sra file validated SRR12671014 is paired end SRR12671014 is conventional basespace SRR12671014 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.468 37.0 37.0 37.0 37.0 37.0 2 36.406 37.0 37.0 37.0 37.0 37.0 3 36.4845 37.0 37.0 37.0 37.0 37.0 4 36.563 37.0 37.0 37.0 37.0 37.0 5 36.644 37.0 37.0 37.0 37.0 37.0 6 36.6205 37.0 37.0 37.0 37.0 37.0 7 36.513 37.0 37.0 37.0 37.0 37.0 8 36.627 37.0 37.0 37.0 37.0 37.0 9 36.7185 37.0 37.0 37.0 37.0 37.0 10-14 36.639 37.0 37.0 37.0 37.0 37.0 15-19 36.5966 37.0 37.0 37.0 37.0 37.0 20-24 36.5625 37.0 37.0 37.0 37.0 37.0 25-29 36.521100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.527 37.0 37.0 37.0 37.0 37.0 35-39 36.438900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4022 37.0 37.0 37.0 37.0 37.0 45-49 36.4239 37.0 37.0 37.0 37.0 37.0 50-54 36.4142 37.0 37.0 37.0 37.0 37.0 55-59 36.4118 37.0 37.0 37.0 37.0 37.0 60-64 36.3897 37.0 37.0 37.0 37.0 37.0 65-69 36.3821 37.0 37.0 37.0 37.0 37.0 70-74 36.3322 37.0 37.0 37.0 37.0 37.0 75-79 36.3637 37.0 37.0 37.0 37.0 37.0 80-84 36.2822 37.0 37.0 37.0 37.0 37.0 85-89 36.2707 37.0 37.0 37.0 37.0 37.0 90-94 36.2109 37.0 37.0 37.0 37.0 37.0 95-99 36.2124 37.0 37.0 37.0 37.0 37.0 100-104 36.2419 37.0 37.0 37.0 37.0 37.0 105-109 36.1533 37.0 37.0 37.0 37.0 37.0 110-114 36.1821 37.0 37.0 37.0 37.0 37.0 115-119 36.055600000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0755 37.0 37.0 37.0 37.0 37.0 125-129 36.0937 37.0 37.0 37.0 37.0 37.0 130-134 35.8865 37.0 37.0 37.0 37.0 37.0 135-139 35.988099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.872 37.0 37.0 37.0 37.0 37.0 145-149 35.6976 37.0 37.0 37.0 37.0 37.0 150-151 35.58225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 2.0 23 0.0 24 1.0 25 4.0 26 5.0 27 8.0 28 14.0 29 18.0 30 25.0 31 44.0 32 53.0 33 78.0 34 105.0 35 264.0 36 2715.0 37 660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.6 11.025 6.5 43.875 2 19.55 11.95 39.175 29.325000000000003 3 18.8 15.975 27.150000000000002 38.074999999999996 4 23.45 22.35 24.85 29.349999999999998 5 25.35 30.325000000000003 23.275000000000002 21.05 6 19.400000000000002 34.9 23.25 22.45 7 14.549999999999999 26.924999999999997 42.525 16.0 8 15.875 25.650000000000002 33.800000000000004 24.675 9 17.724999999999998 24.075 34.2 24.0 10-14 19.470000000000002 30.185000000000002 27.6 22.745 15-19 19.73 27.755000000000003 28.49 24.025 20-24 20.255000000000003 28.53 27.485 23.73 25-29 19.57 28.610000000000003 28.18 23.64 30-34 19.465 28.92 27.555000000000003 24.060000000000002 35-39 20.580000000000002 29.060000000000002 26.82 23.54 40-44 20.495 29.01 27.235 23.26 45-49 20.755000000000003 28.365000000000002 27.485 23.395 50-54 20.005 28.76 27.54 23.695 55-59 20.044999999999998 28.555000000000003 27.500000000000004 23.9 60-64 19.89 28.595 27.834999999999997 23.68 65-69 19.72 28.49 28.13 23.66 70-74 19.945 28.425 27.675 23.955000000000002 75-79 19.74 28.804999999999996 27.860000000000003 23.595 80-84 19.82 28.384999999999998 27.694999999999997 24.099999999999998 85-89 20.145 28.345 27.26 24.25 90-94 20.625 28.34 27.474999999999998 23.56 95-99 20.294999999999998 28.000000000000004 28.375 23.330000000000002 100-104 20.44 28.07 28.044999999999998 23.445 105-109 20.715 28.29 26.82 24.175 110-114 20.575 27.810000000000002 27.55 24.065 115-119 20.200000000000003 28.275 27.985 23.54 120-124 20.95 28.17 27.71 23.169999999999998 125-129 19.950000000000003 28.215 28.02 23.815 130-134 20.77 28.685 27.125 23.419999999999998 135-139 21.13 27.425 27.810000000000002 23.635 140-144 20.625 28.225 27.26 23.89 145-149 20.62 28.349999999999998 26.724999999999998 24.305 150-151 20.724999999999998 28.925 26.700000000000003 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 4.5 25 7.0 26 6.5 27 5.5 28 10.5 29 15.0 30 17.5 31 27.0 32 36.0 33 42.0 34 48.5 35 67.0 36 90.5 37 108.0 38 126.0 39 147.5 40 180.5 41 210.5 42 240.0 43 257.0 44 265.0 45 265.5 46 258.5 47 255.0 48 244.0 49 201.0 50 170.5 51 160.0 52 123.5 53 94.5 54 76.0 55 60.0 56 53.0 57 39.5 58 23.0 59 18.5 60 11.5 61 8.0 62 8.0 63 3.5 64 1.5 65 1.5 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.128810766273 82.95 2 8.019774787146389 14.6 3 0.7140895358418017 1.95 4 0.137324910738808 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.4000000000000004 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.5375 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.300000000000001 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671014 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671014_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2205 37.0 37.0 37.0 37.0 37.0 2 36.074 37.0 37.0 37.0 37.0 37.0 3 36.293 37.0 37.0 37.0 37.0 37.0 4 36.304 37.0 37.0 37.0 37.0 37.0 5 36.2865 37.0 37.0 37.0 37.0 37.0 6 36.2855 37.0 37.0 37.0 37.0 37.0 7 36.3165 37.0 37.0 37.0 37.0 37.0 8 36.2685 37.0 37.0 37.0 37.0 37.0 9 36.359 37.0 37.0 37.0 37.0 37.0 10-14 36.376400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.358900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.34159999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.27 37.0 37.0 37.0 37.0 37.0 30-34 36.2721 37.0 37.0 37.0 37.0 37.0 35-39 36.217 37.0 37.0 37.0 37.0 37.0 40-44 36.2167 37.0 37.0 37.0 37.0 37.0 45-49 36.1971 37.0 37.0 37.0 37.0 37.0 50-54 36.2022 37.0 37.0 37.0 37.0 37.0 55-59 36.1747 37.0 37.0 37.0 37.0 37.0 60-64 36.150099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1588 37.0 37.0 37.0 37.0 37.0 70-74 36.1271 37.0 37.0 37.0 37.0 37.0 75-79 36.1037 37.0 37.0 37.0 37.0 37.0 80-84 36.0834 37.0 37.0 37.0 37.0 37.0 85-89 36.0152 37.0 37.0 37.0 37.0 37.0 90-94 36.0311 37.0 37.0 37.0 37.0 37.0 95-99 35.9882 37.0 37.0 37.0 37.0 37.0 100-104 35.970099999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.874 37.0 37.0 37.0 37.0 37.0 110-114 35.9119 37.0 37.0 37.0 37.0 37.0 115-119 35.8536 37.0 37.0 37.0 37.0 37.0 120-124 35.755399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.668099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.6945 37.0 37.0 37.0 37.0 37.0 135-139 35.659299999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5984 37.0 37.0 37.0 37.0 37.0 145-149 35.3902 37.0 37.0 37.0 37.0 37.0 150-151 35.08425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 1.0 15 2.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 1.0 24 3.0 25 5.0 26 9.0 27 15.0 28 13.0 29 14.0 30 35.0 31 35.0 32 72.0 33 92.0 34 161.0 35 441.0 36 2640.0 37 448.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 22.275 11.25 28.9 2 25.95 25.55 32.4 16.1 3 19.950000000000003 26.900000000000002 34.0 19.15 4 23.599999999999998 34.55 24.025 17.825 5 25.074999999999996 36.975 20.849999999999998 17.1 6 19.0 39.825 22.775000000000002 18.4 7 19.675 22.125 39.675 18.525 8 20.05 24.625 30.625000000000004 24.7 9 21.725 23.35 30.55 24.375 10-14 22.63 30.48 26.284999999999997 20.605 15-19 22.835 28.79 27.21 21.165 20-24 22.759999999999998 28.249999999999996 27.985 21.005 25-29 22.515 28.235 28.544999999999998 20.705000000000002 30-34 22.545 28.215 28.425 20.815 35-39 22.48 28.000000000000004 28.535 20.985 40-44 22.53 28.17 28.065 21.235 45-49 22.93 27.55 28.37 21.15 50-54 22.509999999999998 28.26 27.825 21.404999999999998 55-59 22.89 28.29 27.495000000000005 21.325 60-64 23.115 28.189999999999998 27.755000000000003 20.94 65-69 23.56 27.384999999999998 27.715 21.34 70-74 22.845 27.245 27.994999999999997 21.915000000000003 75-79 22.78 28.03 28.12 21.07 80-84 23.465 28.189999999999998 26.965 21.38 85-89 23.505000000000003 27.560000000000002 27.48 21.455 90-94 23.465 27.965 27.495000000000005 21.075 95-99 22.795 27.634999999999998 28.144999999999996 21.425 100-104 23.75 28.025 27.334999999999997 20.89 105-109 23.18 27.455000000000002 28.435 20.93 110-114 23.735 28.660000000000004 27.38 20.225 115-119 23.95 28.134999999999998 27.445000000000004 20.47 120-124 24.240000000000002 28.205000000000002 27.150000000000002 20.405 125-129 23.905 28.804999999999996 26.615 20.674999999999997 130-134 24.13 27.52 27.74 20.61 135-139 24.585 27.54 27.639999999999997 20.235 140-144 24.345 27.725 28.12 19.81 145-149 25.095 27.93 27.08 19.895 150-151 23.8375 27.487499999999997 27.675 21.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 2.0 20 1.5 21 1.0 22 1.5 23 2.5 24 3.5 25 2.5 26 4.0 27 6.5 28 10.0 29 17.0 30 18.5 31 19.5 32 26.0 33 37.5 34 53.0 35 63.0 36 85.0 37 107.5 38 128.0 39 169.0 40 197.5 41 224.0 42 258.0 43 289.0 44 288.5 45 269.0 46 254.5 47 253.5 48 228.5 49 177.0 50 155.0 51 147.5 52 114.5 53 75.5 54 70.5 55 57.0 56 43.5 57 34.5 58 21.5 59 22.0 60 16.0 61 4.5 62 6.5 63 6.5 64 3.0 65 1.0 66 1.5 67 2.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.07734806629834 82.425 2 7.900552486187845 14.299999999999999 3 0.8563535911602209 2.325 4 0.05524861878453039 0.2 5 0.05524861878453039 0.25 6 0.027624309392265196 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027624309392265196 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 14 0.35000000000000003 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.15 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.85 0.0 0.0 0.0 0.0 136-137 4.2125 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra Read 544721 spots for SRR12671014.sra Written 544721 spots for SRR12671014.sra SRR ids: ['SRR12671014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd___ry53l3 SRR12671014.sra spots: 10894420 blocks: [[1, 544721], [544722, 1089442], [1089443, 1634163], [1634164, 2178884], [2178885, 2723605], [2723606, 3268326], [3268327, 3813047], [3813048, 4357768], [4357769, 4902489], [4902490, 5447210], [5447211, 5991931], [5991932, 6536652], [6536653, 7081373], [7081374, 7626094], [7626095, 8170815], [8170816, 8715536], [8715537, 9260257], [9260258, 9804978], [9804979, 10349699], [10349700, 10894420]] SRR12671014 file size 3680700 SRR12671014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671014 SRR12671014_1.fastq SRR12671014_2.fastq Input file: SRR12671014_1.fastq Paired file: SRR12671014_2.fastq trimmed: SRR12671014-trimmed-pair1.fastq, SRR12671014-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:44:48 2025 >> started Tue Feb 11 13:44:59 2025 >> done (11.824s) 10894420 read pairs processed; of these: 43 ( 0.00%) short read pairs filtered out after trimming by size control 729 ( 0.01%) empty read pairs filtered out after trimming by size control 10893648 (99.99%) read pairs available; of these: 693026 ( 6.36%) trimmed read pairs available after processing 10200622 (93.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 7 0.00% 23 3 0.00% 24 4 0.00% 25 6 0.00% 26 8 0.00% 27 6 0.00% 28 3 0.00% 29 6 0.00% 30 9 0.00% 31 8 0.00% 32 3 0.00% 33 7 0.00% 34 9 0.00% 35 11 0.00% 36 9 0.00% 37 10 0.00% 38 11 0.00% 39 13 0.00% 40 10 0.00% 41 14 0.00% 42 11 0.00% 43 24 0.00% 44 15 0.00% 45 24 0.00% 46 29 0.00% 47 21 0.00% 48 27 0.00% 49 31 0.00% 50 46 0.00% 51 36 0.00% 52 53 0.00% 53 68 0.00% 54 62 0.00% 55 68 0.00% 56 74 0.00% 57 84 0.00% 58 88 0.00% 59 102 0.00% 60 128 0.00% 61 159 0.00% 62 168 0.00% 63 158 0.00% 64 201 0.00% 65 222 0.00% 66 263 0.00% 67 249 0.00% 68 302 0.00% 69 349 0.00% 70 423 0.00% 71 466 0.00% 72 508 0.00% 73 578 0.01% 74 656 0.01% 75 751 0.01% 76 838 0.01% 77 912 0.01% 78 1022 0.01% 79 1079 0.01% 80 1208 0.01% 81 1390 0.01% 82 1438 0.01% 83 1647 0.02% 84 1803 0.02% 85 2029 0.02% 86 2159 0.02% 87 2366 0.02% 88 2506 0.02% 89 2653 0.02% 90 2768 0.03% 91 2933 0.03% 92 3201 0.03% 93 3523 0.03% 94 3586 0.03% 95 4046 0.04% 96 4154 0.04% 97 4472 0.04% 98 4614 0.04% 99 4760 0.04% 100 5031 0.05% 101 5092 0.05% 102 5399 0.05% 103 5763 0.05% 104 6106 0.06% 105 6218 0.06% 106 6547 0.06% 107 6878 0.06% 108 7070 0.06% 109 7430 0.07% 110 7421 0.07% 111 7753 0.07% 112 7980 0.07% 113 8446 0.08% 114 8324 0.08% 115 9008 0.08% 116 9200 0.08% 117 9693 0.09% 118 10110 0.09% 119 10173 0.09% 120 10547 0.10% 121 10788 0.10% 122 10945 0.10% 123 11227 0.10% 124 11608 0.11% 125 11847 0.11% 126 12385 0.11% 127 12645 0.12% 128 12818 0.12% 129 13395 0.12% 130 13779 0.13% 131 13614 0.12% 132 14119 0.13% 133 14277 0.13% 134 14539 0.13% 135 15070 0.14% 136 15372 0.14% 137 16105 0.15% 138 16125 0.15% 139 16859 0.15% 140 16911 0.16% 141 17292 0.16% 142 17896 0.16% 143 18047 0.17% 144 18613 0.17% 145 18339 0.17% 146 19189 0.18% 147 19388 0.18% 148 20310 0.19% 149 20438 0.19% 150 21174 0.19% 151 10200622 93.64% 10893648 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=409.04 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=25 prefix-density=0.48 prefix-fanout=2.7 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=44.12 fanout-score-rank=1 prefix-density=2.66 prefix-fanout=2.0 sequence=CACCTGCGACAACTGCGACTGCG SRR12671014 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:45:49 Started mapping on | Feb 11 13:45:49 Finished on | Feb 11 13:47:02 Mapping speed, Million of reads per hour | 537.22 Number of input reads | 10893648 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10200817 Uniquely mapped reads % | 93.64% Average mapped length | 297.51 Number of splices: Total | 10402924 Number of splices: Annotated (sjdb) | 10185696 Number of splices: GT/AG | 10205689 Number of splices: GC/AG | 159485 Number of splices: AT/AC | 6323 Number of splices: Non-canonical | 31427 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244839 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 93401 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 447992 447992 447992 N_multimapping 244839 244839 244839 N_noFeature 364578 10010305 413424 N_ambiguous 201506 625 59544 UnstrandedReadsAssigned:9634733 PositiveStrandReadsAssigned:189887 NegativeStrandReadsAssigned:9727849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671014 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671014-trimmed-pair1.fastq SRR12671014-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,893,648 reads, 9,701,661 reads pseudoaligned [quant] estimated average fragment length: 282.642 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR12671014.ke.tsv 34699 SRR12671014.se.tsv 87100 total ==> SRR12671014.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.36 394 18.4223 Potri.005G024800.1.v4.1 1035 753.358 164 17.6738 Potri.004G059700.1.v4.1 961 679.615 11 1.31407 Potri.007G009000.2.v4.1 1416 1134.36 0 0 Potri.003G141000.2.v4.1 2943 2661.36 526.493 16.0612 Potri.016G087400.1.v4.1 270 74.8508 614 665.978 Potri.015G069301.1.v4.1 564 298.608 0 0 Potri.010G195200.1.v4.1 1773 1491.36 58 3.15743 Potri.012G127500.1.v4.1 977 695.506 94 10.9727 ==> SRR12671014.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671014 completed mapping pipeline successfully