Starting /dee2/code/volunteer_pipeline.sh SRR12671015 current disk space = 3050621751296 free memory = 1176040340 SRR12671015 SRAfilesize e40ced2bb05d3ad7be208852f56b7cff SRR12671015.sra SRR12671015.sra file validated SRR12671015 is paired end SRR12671015 is conventional basespace SRR12671015 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671015_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4025 37.0 37.0 37.0 37.0 37.0 2 36.451 37.0 37.0 37.0 37.0 37.0 3 36.525 37.0 37.0 37.0 37.0 37.0 4 36.6295 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.564 37.0 37.0 37.0 37.0 37.0 7 36.619 37.0 37.0 37.0 37.0 37.0 8 36.5935 37.0 37.0 37.0 37.0 37.0 9 36.5725 37.0 37.0 37.0 37.0 37.0 10-14 36.584900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.620200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.544 37.0 37.0 37.0 37.0 37.0 25-29 36.549600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5281 37.0 37.0 37.0 37.0 37.0 35-39 36.452 37.0 37.0 37.0 37.0 37.0 40-44 36.495400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4519 37.0 37.0 37.0 37.0 37.0 50-54 36.407799999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.412 37.0 37.0 37.0 37.0 37.0 60-64 36.3164 37.0 37.0 37.0 37.0 37.0 65-69 36.3296 37.0 37.0 37.0 37.0 37.0 70-74 36.324 37.0 37.0 37.0 37.0 37.0 75-79 36.2928 37.0 37.0 37.0 37.0 37.0 80-84 36.2726 37.0 37.0 37.0 37.0 37.0 85-89 36.2512 37.0 37.0 37.0 37.0 37.0 90-94 36.210699999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1632 37.0 37.0 37.0 37.0 37.0 100-104 36.1892 37.0 37.0 37.0 37.0 37.0 105-109 36.129999999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1614 37.0 37.0 37.0 37.0 37.0 115-119 35.98810000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.031400000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.00920000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.854000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.84499999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.8651 37.0 37.0 37.0 37.0 37.0 145-149 35.715999999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.49325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 3.0 25 5.0 26 8.0 27 9.0 28 18.0 29 20.0 30 24.0 31 44.0 32 42.0 33 88.0 34 134.0 35 259.0 36 2697.0 37 647.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.2 10.825 7.3 48.675000000000004 2 18.45 12.075 37.925 31.55 3 16.3 14.85 26.400000000000002 42.449999999999996 4 21.575 22.325 23.225 32.875 5 23.825 29.425 24.65 22.1 6 21.025 33.300000000000004 23.075000000000003 22.6 7 13.925 27.1 41.9 17.075000000000003 8 17.625 25.8 32.925 23.65 9 17.275 22.225 35.949999999999996 24.55 10-14 19.03 30.020000000000003 28.595 22.355 15-19 19.66 28.09 27.96 24.29 20-24 19.905 28.71 27.665 23.72 25-29 19.755 28.375 27.944999999999997 23.925 30-34 19.71 28.78 27.6 23.91 35-39 19.72 28.68 27.785 23.815 40-44 20.369999999999997 28.4 27.725 23.505000000000003 45-49 19.925 28.525 27.834999999999997 23.715 50-54 20.18 28.110000000000003 28.044999999999998 23.665 55-59 20.599999999999998 28.74 27.51 23.150000000000002 60-64 19.695 28.075 27.855 24.375 65-69 19.725 29.035 27.250000000000004 23.990000000000002 70-74 19.685 28.59 27.88 23.845 75-79 19.785 28.21 28.38 23.625 80-84 19.79 29.085 27.365000000000002 23.76 85-89 20.535 28.435 27.365000000000002 23.665 90-94 20.48 28.105000000000004 27.6 23.815 95-99 19.919999999999998 28.335 27.92 23.825 100-104 20.275000000000002 29.075 27.47 23.18 105-109 20.474999999999998 28.07 28.655 22.8 110-114 20.365 28.155 28.384999999999998 23.095 115-119 21.335 28.18 27.200000000000003 23.285 120-124 20.51 27.965 28.134999999999998 23.39 125-129 20.3 28.315 27.855 23.53 130-134 20.9 28.335 27.255000000000003 23.51 135-139 20.235 28.505000000000003 27.310000000000002 23.95 140-144 20.244999999999997 28.549999999999997 27.355 23.849999999999998 145-149 20.75207520752075 28.48284828482848 27.362736273627362 23.402340234023402 150-151 19.8125 28.799999999999997 27.200000000000003 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 2.0 22 3.5 23 2.0 24 2.5 25 3.0 26 6.0 27 8.0 28 8.0 29 15.0 30 19.0 31 23.5 32 31.0 33 39.0 34 58.5 35 78.0 36 96.5 37 114.0 38 131.0 39 148.0 40 174.5 41 200.0 42 221.0 43 242.0 44 250.0 45 264.0 46 269.5 47 266.0 48 239.5 49 210.0 50 193.0 51 147.5 52 117.0 53 101.0 54 77.0 55 59.0 56 51.5 57 44.0 58 27.0 59 16.0 60 13.0 61 9.0 62 4.0 63 3.5 64 2.0 65 0.5 66 1.5 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69407894736842 83.625 2 7.401315789473683 13.5 3 0.6578947368421052 1.7999999999999998 4 0.1370614035087719 0.5 5 0.08223684210526315 0.375 6 0.0 0.0 7 0.0 0.0 8 0.027412280701754384 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCG 8 0.2 No Hit CACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACAC 5 0.125 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit GTTGCGACTTCATTCAGAAACAGATGCAATGTAGGTGATCAAGTCAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.4625000000000004 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.0250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGAAG 10 0.006830828 145.0 6 GTCCTGT 10 0.006830828 145.0 1 TCCTGTA 10 0.006830828 145.0 2 >>END_MODULE SRR12671015 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671015_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.362 37.0 37.0 37.0 37.0 37.0 2 36.3085 37.0 37.0 37.0 37.0 37.0 3 36.3415 37.0 37.0 37.0 37.0 37.0 4 36.3775 37.0 37.0 37.0 37.0 37.0 5 36.5245 37.0 37.0 37.0 37.0 37.0 6 36.4085 37.0 37.0 37.0 37.0 37.0 7 36.4195 37.0 37.0 37.0 37.0 37.0 8 36.441 37.0 37.0 37.0 37.0 37.0 9 36.3215 37.0 37.0 37.0 37.0 37.0 10-14 36.4668 37.0 37.0 37.0 37.0 37.0 15-19 36.4791 37.0 37.0 37.0 37.0 37.0 20-24 36.4961 37.0 37.0 37.0 37.0 37.0 25-29 36.4175 37.0 37.0 37.0 37.0 37.0 30-34 36.3774 37.0 37.0 37.0 37.0 37.0 35-39 36.386199999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3036 37.0 37.0 37.0 37.0 37.0 45-49 36.3532 37.0 37.0 37.0 37.0 37.0 50-54 36.303399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2664 37.0 37.0 37.0 37.0 37.0 60-64 36.2808 37.0 37.0 37.0 37.0 37.0 65-69 36.2824 37.0 37.0 37.0 37.0 37.0 70-74 36.2504 37.0 37.0 37.0 37.0 37.0 75-79 36.2154 37.0 37.0 37.0 37.0 37.0 80-84 36.2179 37.0 37.0 37.0 37.0 37.0 85-89 36.126799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.134 37.0 37.0 37.0 37.0 37.0 95-99 36.129900000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.091300000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.04 37.0 37.0 37.0 37.0 37.0 110-114 36.0384 37.0 37.0 37.0 37.0 37.0 115-119 35.9833 37.0 37.0 37.0 37.0 37.0 120-124 35.9345 37.0 37.0 37.0 37.0 37.0 125-129 35.9105 37.0 37.0 37.0 37.0 37.0 130-134 35.9028 37.0 37.0 37.0 37.0 37.0 135-139 35.856899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8742 37.0 37.0 37.0 37.0 37.0 145-149 35.7333 37.0 37.0 37.0 37.0 37.0 150-151 35.42775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 4.0 23 2.0 24 3.0 25 4.0 26 5.0 27 14.0 28 14.0 29 20.0 30 27.0 31 40.0 32 45.0 33 73.0 34 154.0 35 369.0 36 2629.0 37 596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.800000000000004 22.725 12.55 31.924999999999997 2 24.525 27.025 33.275 15.174999999999999 3 19.275000000000002 28.799999999999997 32.300000000000004 19.625 4 23.75 33.2 23.474999999999998 19.575 5 25.5 36.199999999999996 21.25 17.05 6 19.5 41.949999999999996 21.5 17.05 7 19.575 22.400000000000002 38.224999999999994 19.8 8 18.7 25.55 30.625000000000004 25.124999999999996 9 20.599999999999998 24.45 32.25 22.7 10-14 22.255 29.459999999999997 27.355 20.93 15-19 22.45 28.860000000000003 27.575 21.115000000000002 20-24 21.93 29.299999999999997 28.02 20.75 25-29 22.125 28.17 28.63 21.075 30-34 22.220000000000002 28.715000000000003 28.065 21.0 35-39 22.400000000000002 28.89 27.72 20.990000000000002 40-44 22.325 28.43 28.360000000000003 20.885 45-49 22.98 28.285 27.83 20.905 50-54 21.905 28.59 27.985 21.52 55-59 22.445 28.205000000000002 28.335 21.015 60-64 22.355 27.935 28.29 21.42 65-69 22.245 27.779999999999998 28.515 21.46 70-74 23.064999999999998 27.61 27.82 21.505 75-79 23.005 27.52 27.68 21.795 80-84 22.975 28.325 28.03 20.669999999999998 85-89 23.055 28.005000000000003 27.939999999999998 21.0 90-94 23.76 27.515 27.76 20.965 95-99 23.435 28.065 28.060000000000002 20.44 100-104 22.625 28.665000000000003 27.474999999999998 21.235 105-109 23.549999999999997 28.185 27.715 20.549999999999997 110-114 23.84 27.584999999999997 27.68 20.895 115-119 23.587358735873586 29.117911791179118 27.22772277227723 20.067006700670067 120-124 23.525 28.68 27.005000000000003 20.79 125-129 23.380000000000003 28.645 27.375 20.599999999999998 130-134 23.724999999999998 28.235 27.74 20.3 135-139 23.865 28.01 27.85 20.275000000000002 140-144 24.337433743374337 27.61276127612761 27.362736273627362 20.687068706870686 145-149 24.34 28.225 27.32 20.115 150-151 24.6125 27.287499999999998 26.775 21.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 1.0 23 3.0 24 3.5 25 5.5 26 6.0 27 4.0 28 8.5 29 12.0 30 18.5 31 26.0 32 32.0 33 47.0 34 58.5 35 76.0 36 98.0 37 116.5 38 135.5 39 153.0 40 198.0 41 250.0 42 275.5 43 285.0 44 278.0 45 260.0 46 256.0 47 254.0 48 226.0 49 187.0 50 153.0 51 118.5 52 78.5 53 72.0 54 80.5 55 62.0 56 40.0 57 31.0 58 23.5 59 15.0 60 16.0 61 11.5 62 5.5 63 3.0 64 1.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.5057915057915 82.95 2 7.584114726971871 13.750000000000002 3 0.6894649751792609 1.875 4 0.11031439602868175 0.4 5 0.027578599007170437 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027578599007170437 0.22499999999999998 >10 0.05515719801434087 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 14 0.35000000000000003 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 13 0.325 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit AGCTGCAAAGGCTGTGGGGAAGGTGCTACCTGCTTTGAATGGCAAGCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGTG 10 0.006830828 145.0 4 AGAGAAC 10 0.006830828 145.0 2 AATCAAT 40 0.0076550315 18.125 50-54 >>END_MODULE Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra Read 605039 spots for SRR12671015.sra Written 605039 spots for SRR12671015.sra SRR ids: ['SRR12671015.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4aw0fs7n SRR12671015.sra spots: 12100780 blocks: [[1, 605039], [605040, 1210078], [1210079, 1815117], [1815118, 2420156], [2420157, 3025195], [3025196, 3630234], [3630235, 4235273], [4235274, 4840312], [4840313, 5445351], [5445352, 6050390], [6050391, 6655429], [6655430, 7260468], [7260469, 7865507], [7865508, 8470546], [8470547, 9075585], [9075586, 9680624], [9680625, 10285663], [10285664, 10890702], [10890703, 11495741], [11495742, 12100780]] SRR12671015 file size 4090674 SRR12671015 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671015 SRR12671015_1.fastq SRR12671015_2.fastq Input file: SRR12671015_1.fastq Paired file: SRR12671015_2.fastq trimmed: SRR12671015-trimmed-pair1.fastq, SRR12671015-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:09:47 2025 >> started Tue Feb 11 13:10:07 2025 >> done (20.160s) 12100780 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 539 ( 0.00%) empty read pairs filtered out after trimming by size control 12100209 (100.00%) read pairs available; of these: 585065 ( 4.84%) trimmed read pairs available after processing 11515144 (95.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 5 0.00% 22 1 0.00% 23 6 0.00% 24 6 0.00% 25 2 0.00% 26 5 0.00% 27 8 0.00% 28 2 0.00% 29 6 0.00% 30 3 0.00% 31 5 0.00% 32 7 0.00% 33 8 0.00% 34 2 0.00% 35 6 0.00% 36 4 0.00% 37 4 0.00% 38 5 0.00% 39 6 0.00% 40 5 0.00% 41 5 0.00% 42 4 0.00% 43 5 0.00% 44 9 0.00% 45 8 0.00% 46 12 0.00% 47 8 0.00% 48 14 0.00% 49 18 0.00% 50 18 0.00% 51 25 0.00% 52 26 0.00% 53 18 0.00% 54 25 0.00% 55 21 0.00% 56 36 0.00% 57 25 0.00% 58 34 0.00% 59 35 0.00% 60 53 0.00% 61 50 0.00% 62 73 0.00% 63 75 0.00% 64 90 0.00% 65 77 0.00% 66 75 0.00% 67 84 0.00% 68 122 0.00% 69 137 0.00% 70 155 0.00% 71 164 0.00% 72 160 0.00% 73 215 0.00% 74 280 0.00% 75 252 0.00% 76 290 0.00% 77 346 0.00% 78 352 0.00% 79 432 0.00% 80 455 0.00% 81 536 0.00% 82 600 0.00% 83 608 0.01% 84 808 0.01% 85 855 0.01% 86 960 0.01% 87 980 0.01% 88 1136 0.01% 89 1227 0.01% 90 1343 0.01% 91 1503 0.01% 92 1494 0.01% 93 1689 0.01% 94 1870 0.02% 95 2062 0.02% 96 2193 0.02% 97 2478 0.02% 98 2517 0.02% 99 2776 0.02% 100 2932 0.02% 101 3223 0.03% 102 3292 0.03% 103 3598 0.03% 104 3615 0.03% 105 4073 0.03% 106 4192 0.03% 107 4628 0.04% 108 4774 0.04% 109 4955 0.04% 110 5164 0.04% 111 5476 0.05% 112 5716 0.05% 113 5947 0.05% 114 6331 0.05% 115 6553 0.05% 116 6957 0.06% 117 7276 0.06% 118 7751 0.06% 119 8080 0.07% 120 8452 0.07% 121 8589 0.07% 122 9159 0.08% 123 9385 0.08% 124 9577 0.08% 125 10044 0.08% 126 10630 0.09% 127 10768 0.09% 128 11197 0.09% 129 11522 0.10% 130 12291 0.10% 131 12183 0.10% 132 12767 0.11% 133 12993 0.11% 134 13371 0.11% 135 13708 0.11% 136 14467 0.12% 137 14970 0.12% 138 15415 0.13% 139 16127 0.13% 140 16522 0.14% 141 17279 0.14% 142 17673 0.15% 143 17696 0.15% 144 18535 0.15% 145 18734 0.15% 146 19685 0.16% 147 19819 0.16% 148 21332 0.18% 149 21335 0.18% 150 22285 0.18% 151 11515144 95.16% 12100209 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=6.44 fanout-score-rank=8 prefix-density=0.61 prefix-fanout=3.5 sequence=TTGCAGCCATTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=101.15 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=ATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=5.99 fanout-score-rank=13 prefix-density=2.15 prefix-fanout=1.7 sequence=CACCTGCGACACCTGCGACTGCG criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=39.43 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12671015 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:10:51 Started mapping on | Feb 11 13:10:52 Finished on | Feb 11 13:12:28 Mapping speed, Million of reads per hour | 453.76 Number of input reads | 12100209 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11443812 Uniquely mapped reads % | 94.58% Average mapped length | 298.67 Number of splices: Total | 11689449 Number of splices: Annotated (sjdb) | 11414467 Number of splices: GT/AG | 11470508 Number of splices: GC/AG | 172389 Number of splices: AT/AC | 7729 Number of splices: Non-canonical | 38823 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328792 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 35306 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327605 327605 327605 N_multimapping 328792 328792 328792 N_noFeature 457721 11234041 508670 N_ambiguous 242836 694 83681 UnstrandedReadsAssigned:10743255 PositiveStrandReadsAssigned:209077 NegativeStrandReadsAssigned:10851461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671015 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671015-trimmed-pair1.fastq SRR12671015-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,100,209 reads, 10,759,734 reads pseudoaligned [quant] estimated average fragment length: 288.956 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12671015.ke.tsv 34699 SRR12671015.se.tsv 87100 total ==> SRR12671015.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.04 702 28.277 Potri.005G024800.1.v4.1 1035 747.044 238 22.2016 Potri.004G059700.1.v4.1 961 673.337 3 0.310486 Potri.007G009000.2.v4.1 1416 1128.04 0 0 Potri.003G141000.2.v4.1 2943 2655.04 643 16.8769 Potri.016G087400.1.v4.1 270 71.1994 639 625.429 Potri.015G069301.1.v4.1 564 295.065 0 0 Potri.010G195200.1.v4.1 1773 1485.04 312 14.6409 Potri.012G127500.1.v4.1 977 689.221 178 17.9976 ==> SRR12671015.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 43 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671015 completed mapping pipeline successfully