Starting /dee2/code/volunteer_pipeline.sh SRR12671016 current disk space = 3050324299776 free memory = 1489933044 SRR12671016 SRAfilesize f12a27a0d71e0d51c7780f767b08043e SRR12671016.sra SRR12671016.sra file validated SRR12671016 is paired end SRR12671016 is conventional basespace SRR12671016 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671016_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54425 37.0 37.0 37.0 37.0 37.0 2 36.5225 37.0 37.0 37.0 37.0 37.0 3 36.665 37.0 37.0 37.0 37.0 37.0 4 36.617 37.0 37.0 37.0 37.0 37.0 5 36.6895 37.0 37.0 37.0 37.0 37.0 6 36.616 37.0 37.0 37.0 37.0 37.0 7 36.602 37.0 37.0 37.0 37.0 37.0 8 36.659 37.0 37.0 37.0 37.0 37.0 9 36.6525 37.0 37.0 37.0 37.0 37.0 10-14 36.6334 37.0 37.0 37.0 37.0 37.0 15-19 36.6243 37.0 37.0 37.0 37.0 37.0 20-24 36.5685 37.0 37.0 37.0 37.0 37.0 25-29 36.5526 37.0 37.0 37.0 37.0 37.0 30-34 36.5375 37.0 37.0 37.0 37.0 37.0 35-39 36.489900000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.5356 37.0 37.0 37.0 37.0 37.0 45-49 36.4768 37.0 37.0 37.0 37.0 37.0 50-54 36.4172 37.0 37.0 37.0 37.0 37.0 55-59 36.395999999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.399100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.4099 37.0 37.0 37.0 37.0 37.0 70-74 36.427099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.33829999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3457 37.0 37.0 37.0 37.0 37.0 85-89 36.290200000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.3013 37.0 37.0 37.0 37.0 37.0 95-99 36.2338 37.0 37.0 37.0 37.0 37.0 100-104 36.286899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1761 37.0 37.0 37.0 37.0 37.0 110-114 36.2025 37.0 37.0 37.0 37.0 37.0 115-119 36.133900000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.122299999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.1414 37.0 37.0 37.0 37.0 37.0 130-134 35.941500000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.0087 37.0 37.0 37.0 37.0 37.0 140-144 35.961200000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8386 37.0 37.0 37.0 37.0 37.0 150-151 35.64625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 3.0 25 4.0 26 6.0 27 8.0 28 10.0 29 16.0 30 21.0 31 35.0 32 48.0 33 75.0 34 117.0 35 246.0 36 2731.0 37 676.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.06101525381345 12.528132033008252 4.651162790697675 38.759689922480625 2 18.525 11.3 38.275 31.900000000000002 3 17.7 14.575 26.0 41.725 4 22.400000000000002 19.45 25.074999999999996 33.074999999999996 5 23.9 30.4 23.599999999999998 22.1 6 20.474999999999998 32.375 23.3 23.849999999999998 7 15.6 29.349999999999998 39.775 15.275 8 15.5 25.25 35.125 24.125 9 17.349999999999998 24.3 35.35 23.0 10-14 19.564999999999998 29.23 29.215000000000003 21.990000000000002 15-19 19.885 27.875 28.4 23.84 20-24 20.105 28.475 27.62 23.799999999999997 25-29 19.950000000000003 27.625 28.205000000000002 24.22 30-34 19.57 28.34 27.985 24.104999999999997 35-39 19.939999999999998 28.62 27.860000000000003 23.580000000000002 40-44 20.185 28.79 27.615000000000002 23.41 45-49 20.07 28.494999999999997 27.42 24.015 50-54 20.785 28.225 27.694999999999997 23.294999999999998 55-59 20.02 28.17 27.755000000000003 24.055 60-64 20.21 28.615000000000002 27.865000000000002 23.31 65-69 20.44 29.020000000000003 27.05 23.49 70-74 20.885 28.044999999999998 27.93 23.14 75-79 20.505000000000003 27.834999999999997 27.884999999999998 23.775 80-84 20.76 28.38 27.305 23.555 85-89 20.655 28.384999999999998 26.805 24.154999999999998 90-94 20.69 28.26 27.534999999999997 23.515 95-99 20.515 28.455000000000002 27.525 23.505000000000003 100-104 20.205000000000002 29.080000000000002 27.375 23.34 105-109 20.46 27.839999999999996 27.339999999999996 24.36 110-114 20.625 28.09 27.52 23.765 115-119 21.23 28.485 26.97 23.315 120-124 20.375 27.98 27.805000000000003 23.84 125-129 20.7 28.105000000000004 27.16 24.035 130-134 20.705000000000002 27.55 27.525 24.22 135-139 21.035 28.720000000000002 27.26 22.985 140-144 21.22 28.060000000000002 27.015 23.705000000000002 145-149 21.402140214021404 27.642764276427645 27.377737773777376 23.577357735773578 150-151 21.6625 27.8625 26.974999999999998 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 2.0 19 1.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.5 25 2.5 26 5.0 27 6.0 28 8.5 29 14.0 30 17.0 31 25.5 32 29.0 33 37.0 34 58.0 35 68.0 36 78.5 37 103.5 38 127.5 39 153.5 40 177.0 41 198.5 42 227.5 43 248.0 44 263.0 45 263.0 46 258.5 47 243.5 48 240.0 49 224.5 50 182.5 51 154.5 52 131.0 53 111.0 54 90.0 55 69.0 56 46.0 57 29.0 58 22.0 59 18.0 60 14.5 61 17.0 62 9.5 63 2.0 64 5.5 65 4.5 66 1.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.52224371373308 81.89999999999999 2 8.56590218292346 15.5 3 0.8013263332412269 2.175 4 0.08289582757667864 0.3 5 0.027631942525559547 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTTCTAGTAGACCAACAAGCATGCGTTTATCGGGTTTAATGGTCTTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1624999999999996 0.0 0.0 0.0 0.0 124-125 2.4375 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGTAG 10 0.006830828 145.0 1 GGCAATA 10 0.006830828 145.0 2 GTAAGAT 10 0.006830828 145.0 8 >>END_MODULE SRR12671016 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671016_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1385 37.0 37.0 37.0 37.0 37.0 2 36.3055 37.0 37.0 37.0 37.0 37.0 3 36.2055 37.0 37.0 37.0 37.0 37.0 4 36.3855 37.0 37.0 37.0 37.0 37.0 5 36.417 37.0 37.0 37.0 37.0 37.0 6 36.39 37.0 37.0 37.0 37.0 37.0 7 36.3755 37.0 37.0 37.0 37.0 37.0 8 36.4465 37.0 37.0 37.0 37.0 37.0 9 36.4425 37.0 37.0 37.0 37.0 37.0 10-14 36.43769999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4781 37.0 37.0 37.0 37.0 37.0 20-24 36.4599 37.0 37.0 37.0 37.0 37.0 25-29 36.3512 37.0 37.0 37.0 37.0 37.0 30-34 36.3738 37.0 37.0 37.0 37.0 37.0 35-39 36.346199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3054 37.0 37.0 37.0 37.0 37.0 45-49 36.3223 37.0 37.0 37.0 37.0 37.0 50-54 36.3138 37.0 37.0 37.0 37.0 37.0 55-59 36.27040000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.2707 37.0 37.0 37.0 37.0 37.0 65-69 36.2565 37.0 37.0 37.0 37.0 37.0 70-74 36.229699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.1892 37.0 37.0 37.0 37.0 37.0 80-84 36.1531 37.0 37.0 37.0 37.0 37.0 85-89 36.1084 37.0 37.0 37.0 37.0 37.0 90-94 36.1215 37.0 37.0 37.0 37.0 37.0 95-99 36.1095 37.0 37.0 37.0 37.0 37.0 100-104 36.1571 37.0 37.0 37.0 37.0 37.0 105-109 36.037400000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.073899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.96775 37.0 37.0 37.0 37.0 37.0 120-124 35.968599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9209 37.0 37.0 37.0 37.0 37.0 130-134 35.88799999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.8599 37.0 37.0 37.0 37.0 37.0 140-144 35.905049999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.631 37.0 37.0 37.0 37.0 37.0 150-151 35.358999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 0.0 16 2.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 3.0 23 0.0 24 6.0 25 3.0 26 9.0 27 6.0 28 10.0 29 16.0 30 26.0 31 40.0 32 57.0 33 72.0 34 132.0 35 367.0 36 2715.0 37 528.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.85 27.474999999999998 8.5 25.174999999999997 2 26.974999999999998 26.275 31.225 15.525 3 19.75 29.175 33.5 17.575 4 24.975 32.7 23.825 18.5 5 26.35 36.775000000000006 21.55 15.325 6 20.525 39.875 22.650000000000002 16.950000000000003 7 20.5 23.375 37.7 18.425 8 19.650000000000002 26.375 28.749999999999996 25.224999999999998 9 22.125 24.025 31.624999999999996 22.225 10-14 22.89 29.555 26.865 20.69 15-19 23.135 28.560000000000002 27.525 20.78 20-24 23.07 29.145 27.095000000000002 20.69 25-29 23.03 28.27 27.860000000000003 20.84 30-34 22.425 28.08 28.415000000000003 21.08 35-39 23.22 28.265 27.334999999999997 21.18 40-44 22.955000000000002 27.97 27.939999999999998 21.135 45-49 23.119999999999997 27.98 27.875 21.025 50-54 23.3 28.244999999999997 27.49 20.965 55-59 23.255 27.725 27.295 21.725 60-64 23.494999999999997 27.67 27.29 21.545 65-69 23.0 27.800000000000004 28.08 21.12 70-74 23.9 27.500000000000004 27.134999999999998 21.465 75-79 22.994999999999997 28.175 27.48 21.349999999999998 80-84 23.115 28.255000000000003 27.310000000000002 21.32 85-89 23.715 27.74 26.99 21.555 90-94 23.845 27.595 27.83 20.73 95-99 23.72 27.750000000000004 27.465 21.065 100-104 23.1 27.245 28.415000000000003 21.240000000000002 105-109 23.3 27.589999999999996 28.000000000000004 21.11 110-114 23.885 27.994999999999997 27.48 20.64 115-119 23.77618880944047 28.361418070903543 27.35136756837842 20.511025551277566 120-124 24.055 28.155 27.04 20.75 125-129 23.885 28.165000000000003 27.08 20.87 130-134 24.610000000000003 27.115000000000002 27.305 20.97 135-139 24.03 27.800000000000004 27.85 20.32 140-144 24.72623631181559 27.50637531876594 27.27136356817841 20.49602480124006 145-149 24.515 27.99 26.83 20.665 150-151 25.2125 27.3125 27.0 20.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 2.0 22 1.5 23 1.0 24 4.0 25 5.5 26 4.0 27 5.5 28 7.5 29 6.5 30 11.0 31 23.5 32 36.5 33 40.5 34 43.5 35 54.0 36 77.5 37 100.0 38 130.0 39 165.5 40 202.5 41 224.5 42 244.5 43 264.0 44 275.5 45 283.0 46 262.5 47 257.0 48 235.0 49 195.5 50 169.5 51 141.5 52 103.0 53 82.0 54 82.5 55 66.0 56 48.0 57 34.0 58 22.5 59 17.5 60 15.0 61 13.0 62 8.5 63 4.5 64 2.5 65 1.0 66 0.5 67 0.5 68 0.0 69 1.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.3808729496803 81.27499999999999 2 8.56269113149847 15.4 3 0.8062274117319989 2.175 4 0.13900472616068948 0.5 5 0.027800945232137893 0.125 6 0.027800945232137893 0.15 7 0.027800945232137893 0.17500000000000002 8 0.027800945232137893 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGTACAGCGACACCAAAACAATTTTCTCACCTGCCAGTTTTGCAGAACAC 6 0.15 No Hit GGGATGATGCTGCGCGGCATGGGATTCGATAACAACACTTCAATTTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTTC 10 0.006830828 145.0 9 AAAGGCT 20 3.5877043E-4 108.75 145 >>END_MODULE Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609368 spots for SRR12671016.sra Written 609368 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra Read 609356 spots for SRR12671016.sra Written 609356 spots for SRR12671016.sra SRR ids: ['SRR12671016.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t8a7b3x7 SRR12671016.sra spots: 12187132 blocks: [[1, 609356], [609357, 1218712], [1218713, 1828068], [1828069, 2437424], [2437425, 3046780], [3046781, 3656136], [3656137, 4265492], [4265493, 4874848], [4874849, 5484204], [5484205, 6093560], [6093561, 6702916], [6702917, 7312272], [7312273, 7921628], [7921629, 8530984], [8530985, 9140340], [9140341, 9749696], [9749697, 10359052], [10359053, 10968408], [10968409, 11577764], [11577765, 12187132]] SRR12671016 file size 4120020 SRR12671016 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671016 SRR12671016_1.fastq SRR12671016_2.fastq Input file: SRR12671016_1.fastq Paired file: SRR12671016_2.fastq trimmed: SRR12671016-trimmed-pair1.fastq, SRR12671016-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:56:13 2025 >> started Tue Feb 11 13:56:26 2025 >> done (13.686s) 12187132 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 3126 ( 0.03%) empty read pairs filtered out after trimming by size control 12183926 (99.97%) read pairs available; of these: 837262 ( 6.87%) trimmed read pairs available after processing 11346664 (93.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 9 0.00% 21 8 0.00% 22 11 0.00% 23 11 0.00% 24 15 0.00% 25 7 0.00% 26 11 0.00% 27 11 0.00% 28 15 0.00% 29 8 0.00% 30 9 0.00% 31 12 0.00% 32 11 0.00% 33 11 0.00% 34 26 0.00% 35 12 0.00% 36 20 0.00% 37 14 0.00% 38 16 0.00% 39 28 0.00% 40 28 0.00% 41 17 0.00% 42 19 0.00% 43 11 0.00% 44 24 0.00% 45 15 0.00% 46 19 0.00% 47 25 0.00% 48 26 0.00% 49 36 0.00% 50 35 0.00% 51 26 0.00% 52 51 0.00% 53 38 0.00% 54 47 0.00% 55 60 0.00% 56 54 0.00% 57 68 0.00% 58 67 0.00% 59 81 0.00% 60 86 0.00% 61 94 0.00% 62 117 0.00% 63 143 0.00% 64 149 0.00% 65 125 0.00% 66 188 0.00% 67 193 0.00% 68 196 0.00% 69 225 0.00% 70 292 0.00% 71 343 0.00% 72 413 0.00% 73 398 0.00% 74 445 0.00% 75 525 0.00% 76 564 0.00% 77 645 0.01% 78 690 0.01% 79 773 0.01% 80 841 0.01% 81 988 0.01% 82 1099 0.01% 83 1191 0.01% 84 1377 0.01% 85 1508 0.01% 86 1605 0.01% 87 1799 0.01% 88 1975 0.02% 89 2092 0.02% 90 2303 0.02% 91 2517 0.02% 92 2642 0.02% 93 2985 0.02% 94 3172 0.03% 95 3603 0.03% 96 3862 0.03% 97 4137 0.03% 98 4275 0.04% 99 4602 0.04% 100 4840 0.04% 101 4935 0.04% 102 5329 0.04% 103 5670 0.05% 104 6165 0.05% 105 6497 0.05% 106 7009 0.06% 107 7254 0.06% 108 7721 0.06% 109 7855 0.06% 110 8144 0.07% 111 8529 0.07% 112 8964 0.07% 113 9143 0.08% 114 9470 0.08% 115 10235 0.08% 116 10587 0.09% 117 11265 0.09% 118 11636 0.10% 119 11840 0.10% 120 12407 0.10% 121 12770 0.10% 122 13182 0.11% 123 13411 0.11% 124 13955 0.11% 125 14111 0.12% 126 15197 0.12% 127 15706 0.13% 128 16453 0.14% 129 16536 0.14% 130 17417 0.14% 131 17574 0.14% 132 17875 0.15% 133 18502 0.15% 134 18986 0.16% 135 19255 0.16% 136 19798 0.16% 137 20768 0.17% 138 21184 0.17% 139 22213 0.18% 140 22460 0.18% 141 23350 0.19% 142 23866 0.20% 143 24464 0.20% 144 24770 0.20% 145 24951 0.20% 146 25829 0.21% 147 26359 0.22% 148 27458 0.23% 149 27756 0.23% 150 29418 0.24% 151 11346664 93.13% 12183926 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.39 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=78.76 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=36 prefix-density=0.42 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=35 fanout-score=72.61 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=12.7 sequence=AGAAAAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCA SRR12671016 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:57:08 Started mapping on | Feb 11 13:57:09 Finished on | Feb 11 13:58:40 Mapping speed, Million of reads per hour | 482.00 Number of input reads | 12183926 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11454091 Uniquely mapped reads % | 94.01% Average mapped length | 297.68 Number of splices: Total | 11695861 Number of splices: Annotated (sjdb) | 11457437 Number of splices: GT/AG | 11467048 Number of splices: GC/AG | 187656 Number of splices: AT/AC | 7748 Number of splices: Non-canonical | 33409 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264713 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 48267 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 465122 465122 465122 N_multimapping 264713 264713 264713 N_noFeature 428427 11254484 484707 N_ambiguous 217328 825 73661 UnstrandedReadsAssigned:10808336 PositiveStrandReadsAssigned:198782 NegativeStrandReadsAssigned:10895723 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671016 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671016-trimmed-pair1.fastq SRR12671016-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,183,926 reads, 10,853,829 reads pseudoaligned [quant] estimated average fragment length: 268.034 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR12671016.ke.tsv 34699 SRR12671016.se.tsv 87100 total ==> SRR12671016.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.97 328 13.0811 Potri.005G024800.1.v4.1 1035 767.966 126 11.4571 Potri.004G059700.1.v4.1 961 694.089 4 0.402431 Potri.007G009000.2.v4.1 1416 1148.97 0 0 Potri.003G141000.2.v4.1 2943 2675.97 468.907 12.2364 Potri.016G087400.1.v4.1 270 75.5937 593 547.792 Potri.015G069301.1.v4.1 564 308.841 0 0 Potri.010G195200.1.v4.1 1773 1505.97 38 1.76204 Potri.012G127500.1.v4.1 977 710.06 125 12.2931 ==> SRR12671016.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 168 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671016 completed mapping pipeline successfully