Starting /dee2/code/volunteer_pipeline.sh SRR12671017 current disk space = 3050287247360 free memory = 1470994036 SRR12671017 SRAfilesize 925434648f037479086bbe141a254063 SRR12671017.sra SRR12671017.sra file validated SRR12671017 is paired end SRR12671017 is conventional basespace SRR12671017 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671017_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41375 37.0 37.0 37.0 37.0 37.0 2 36.446 37.0 37.0 37.0 37.0 37.0 3 36.555 37.0 37.0 37.0 37.0 37.0 4 36.6245 37.0 37.0 37.0 37.0 37.0 5 36.647 37.0 37.0 37.0 37.0 37.0 6 36.65 37.0 37.0 37.0 37.0 37.0 7 36.5295 37.0 37.0 37.0 37.0 37.0 8 36.647 37.0 37.0 37.0 37.0 37.0 9 36.606 37.0 37.0 37.0 37.0 37.0 10-14 36.6648 37.0 37.0 37.0 37.0 37.0 15-19 36.6289 37.0 37.0 37.0 37.0 37.0 20-24 36.5625 37.0 37.0 37.0 37.0 37.0 25-29 36.5441 37.0 37.0 37.0 37.0 37.0 30-34 36.514300000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.517700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.467200000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4407 37.0 37.0 37.0 37.0 37.0 50-54 36.4487 37.0 37.0 37.0 37.0 37.0 55-59 36.4165 37.0 37.0 37.0 37.0 37.0 60-64 36.3778 37.0 37.0 37.0 37.0 37.0 65-69 36.351800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.4167 37.0 37.0 37.0 37.0 37.0 75-79 36.3292 37.0 37.0 37.0 37.0 37.0 80-84 36.3341 37.0 37.0 37.0 37.0 37.0 85-89 36.28660000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2325 37.0 37.0 37.0 37.0 37.0 95-99 36.241099999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.222699999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1808 37.0 37.0 37.0 37.0 37.0 110-114 36.155199999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1338 37.0 37.0 37.0 37.0 37.0 120-124 36.0623 37.0 37.0 37.0 37.0 37.0 125-129 36.0342 37.0 37.0 37.0 37.0 37.0 130-134 35.8749 37.0 37.0 37.0 37.0 37.0 135-139 36.0113 37.0 37.0 37.0 37.0 37.0 140-144 35.8817 37.0 37.0 37.0 37.0 37.0 145-149 35.771 37.0 37.0 37.0 37.0 37.0 150-151 35.6175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 5.0 25 4.0 26 5.0 27 5.0 28 11.0 29 21.0 30 26.0 31 35.0 32 40.0 33 81.0 34 130.0 35 256.0 36 2730.0 37 647.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.68392098024506 10.102525631407852 8.027006751687923 46.186546636659166 2 16.75 12.425 39.900000000000006 30.925000000000004 3 17.599999999999998 14.799999999999999 27.150000000000002 40.45 4 23.275000000000002 24.325 22.575 29.825000000000003 5 24.775 29.625 24.6 21.0 6 21.275 32.375 24.925 21.425 7 15.25 26.5 41.325 16.925 8 16.6 24.224999999999998 35.3 23.875 9 17.299999999999997 22.625 35.125 24.95 10-14 19.355 29.160000000000004 28.435 23.05 15-19 19.67 27.985 28.515 23.830000000000002 20-24 20.035 28.53 27.91 23.525 25-29 19.689999999999998 28.355000000000004 27.91 24.044999999999998 30-34 19.64 28.73 27.525 24.104999999999997 35-39 20.335 27.735 28.33 23.599999999999998 40-44 19.75 28.939999999999998 27.77 23.54 45-49 19.625 28.310000000000002 28.275 23.79 50-54 19.82 27.935 28.07 24.175 55-59 19.384999999999998 28.51 28.565 23.54 60-64 19.78 28.21 27.725 24.285 65-69 19.91 28.849999999999998 27.705000000000002 23.535 70-74 20.525 28.46 27.405 23.61 75-79 19.975 28.144999999999996 28.685 23.195 80-84 20.055 28.065 28.645 23.235 85-89 20.13 27.6 28.02 24.25 90-94 20.294999999999998 28.055000000000003 27.66 23.990000000000002 95-99 19.915 28.49 28.144999999999996 23.45 100-104 20.69 28.13 27.655 23.525 105-109 19.900000000000002 28.03 27.99 24.08 110-114 19.765 28.08 28.389999999999997 23.765 115-119 20.43 27.894999999999996 27.88 23.794999999999998 120-124 20.075000000000003 28.525 27.800000000000004 23.599999999999998 125-129 20.655 27.644999999999996 27.845 23.855 130-134 20.49 28.68 27.38 23.45 135-139 20.485 28.15 27.865000000000002 23.5 140-144 20.349999999999998 28.67 27.565 23.415 145-149 20.71 28.13 28.095 23.064999999999998 150-151 20.4625 28.462500000000002 27.187499999999996 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.5 2 1.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 3.0 25 7.0 26 10.0 27 8.5 28 9.0 29 11.0 30 16.0 31 21.5 32 29.5 33 45.5 34 54.0 35 69.5 36 92.5 37 107.5 38 127.0 39 160.5 40 195.0 41 196.5 42 201.5 43 249.5 44 267.0 45 266.5 46 268.5 47 258.5 48 243.5 49 222.0 50 186.5 51 141.0 52 126.5 53 107.0 54 70.5 55 47.0 56 41.0 57 40.0 58 25.0 59 14.0 60 15.5 61 12.5 62 6.0 63 1.5 64 1.5 65 3.0 66 2.5 67 1.0 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.16348018841785 81.35 2 8.977556109725686 16.2 3 0.7758381823219729 2.1 4 0.05541701302299806 0.2 5 0.0 0.0 6 0.02770850651149903 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0125 0.0 104-105 0.5125 0.0 0.0 0.025 0.0 106-107 0.575 0.0 0.0 0.025 0.0 108-109 0.8125 0.0 0.0 0.025 0.0 110-111 0.8875 0.0 0.0 0.025 0.0 112-113 0.9375 0.0 0.0 0.025 0.0 114-115 1.0375 0.0 0.0 0.025 0.0 116-117 1.125 0.0 0.0 0.025 0.0 118-119 1.325 0.0 0.0 0.025 0.0 120-121 1.5125 0.0 0.0 0.025 0.0 122-123 1.6125 0.0 0.0 0.025 0.0 124-125 1.7625000000000002 0.0 0.0 0.025 0.0 126-127 1.9 0.0 0.0 0.025 0.0 128-129 2.175 0.0 0.0 0.025 0.0 130-131 2.4000000000000004 0.0 0.0 0.025 0.0 132-133 2.5374999999999996 0.0 0.0 0.025 0.0 134-135 2.7375 0.0 0.0 0.025 0.0 136-137 2.9375 0.0 0.0 0.025 0.0 138-139 3.2750000000000004 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671017 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671017_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.225 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.2955 37.0 37.0 37.0 37.0 37.0 4 36.303 37.0 37.0 37.0 37.0 37.0 5 36.3295 37.0 37.0 37.0 37.0 37.0 6 36.3405 37.0 37.0 37.0 37.0 37.0 7 36.274 37.0 37.0 37.0 37.0 37.0 8 36.358 37.0 37.0 37.0 37.0 37.0 9 36.2485 37.0 37.0 37.0 37.0 37.0 10-14 36.3773 37.0 37.0 37.0 37.0 37.0 15-19 36.355 37.0 37.0 37.0 37.0 37.0 20-24 36.410399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3053 37.0 37.0 37.0 37.0 37.0 30-34 36.261900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2229 37.0 37.0 37.0 37.0 37.0 40-44 36.176300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1819 37.0 37.0 37.0 37.0 37.0 50-54 36.1679 37.0 37.0 37.0 37.0 37.0 55-59 36.1672 37.0 37.0 37.0 37.0 37.0 60-64 36.1726 37.0 37.0 37.0 37.0 37.0 65-69 36.1947 37.0 37.0 37.0 37.0 37.0 70-74 36.1732 37.0 37.0 37.0 37.0 37.0 75-79 36.1005 37.0 37.0 37.0 37.0 37.0 80-84 36.097699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0231 37.0 37.0 37.0 37.0 37.0 90-94 36.008500000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.0469 37.0 37.0 37.0 37.0 37.0 100-104 36.02310000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9863 37.0 37.0 37.0 37.0 37.0 110-114 35.9602 37.0 37.0 37.0 37.0 37.0 115-119 35.9014 37.0 37.0 37.0 37.0 37.0 120-124 35.8193 37.0 37.0 37.0 37.0 37.0 125-129 35.74660000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.786 37.0 37.0 37.0 37.0 37.0 135-139 35.6438 37.0 37.0 37.0 37.0 37.0 140-144 35.677299999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.3942 37.0 37.0 37.0 37.0 37.0 150-151 35.18825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 4.0 23 0.0 24 3.0 25 6.0 26 5.0 27 14.0 28 17.0 29 21.0 30 40.0 31 36.0 32 59.0 33 88.0 34 163.0 35 450.0 36 2620.0 37 468.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.375 22.5 12.425 31.7 2 23.674999999999997 26.325 33.775 16.225 3 20.45 26.950000000000003 32.074999999999996 20.525 4 22.975 33.7 24.075 19.25 5 25.5 36.55 22.25 15.7 6 19.825 39.275 23.0 17.9 7 19.925 21.375 40.075 18.625 8 19.8 25.074999999999996 30.55 24.575 9 21.224999999999998 24.7 31.275 22.8 10-14 22.355 29.955 26.765 20.925 15-19 23.16 28.65 27.495000000000005 20.695 20-24 21.93 28.720000000000002 28.355000000000004 20.995 25-29 22.52 28.975 27.339999999999996 21.165 30-34 22.495 28.17 27.915 21.42 35-39 22.54 28.084999999999997 28.54 20.835 40-44 22.68 27.79 28.77 20.76 45-49 22.015 28.055000000000003 28.749999999999996 21.18 50-54 22.665 27.68 28.425 21.23 55-59 22.915 28.265 28.005000000000003 20.815 60-64 22.195 27.865000000000002 28.449999999999996 21.490000000000002 65-69 22.74 28.42 27.725 21.115000000000002 70-74 22.915 28.325 27.595 21.165 75-79 22.33 28.225 28.139999999999997 21.305 80-84 22.975 27.665 27.815 21.545 85-89 23.150000000000002 28.18 27.76 20.91 90-94 22.905 28.910000000000004 27.310000000000002 20.875 95-99 23.145 28.585 27.46 20.810000000000002 100-104 23.21 28.865000000000002 27.29 20.635 105-109 23.07 27.685 28.305000000000003 20.94 110-114 23.005 27.55 28.37 21.075 115-119 22.62 28.485 27.644999999999996 21.25 120-124 23.22 28.494999999999997 27.505000000000003 20.78 125-129 23.235 27.944999999999997 28.000000000000004 20.82 130-134 23.455000000000002 27.47 28.735 20.34 135-139 23.810000000000002 27.115000000000002 28.825 20.25 140-144 24.52 27.47 27.555000000000003 20.455000000000002 145-149 24.279999999999998 27.875 27.785 20.06 150-151 24.725 28.1625 26.474999999999998 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 2.0 25 3.5 26 6.0 27 9.0 28 11.0 29 15.0 30 19.5 31 18.5 32 33.0 33 59.0 34 59.0 35 65.0 36 87.5 37 112.5 38 146.5 39 182.0 40 212.0 41 233.5 42 258.5 43 276.5 44 262.5 45 259.5 46 262.0 47 256.5 48 228.0 49 190.0 50 158.0 51 122.5 52 101.0 53 76.0 54 63.5 55 54.5 56 41.0 57 28.0 58 20.0 59 13.5 60 8.0 61 8.0 62 7.0 63 3.5 64 3.0 65 2.5 66 1.5 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.03046247576847 81.27499999999999 2 9.166435890335087 16.55 3 0.8031016338964275 2.175 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.5875000000000004 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGCAA 10 0.006830828 145.0 5 >>END_MODULE Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605478 spots for SRR12671017.sra Written 605478 spots for SRR12671017.sra Read 605479 spots for SRR12671017.sra Written 605479 spots for SRR12671017.sra SRR ids: ['SRR12671017.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b3vd0bvx SRR12671017.sra spots: 12109561 blocks: [[1, 605478], [605479, 1210956], [1210957, 1816434], [1816435, 2421912], [2421913, 3027390], [3027391, 3632868], [3632869, 4238346], [4238347, 4843824], [4843825, 5449302], [5449303, 6054780], [6054781, 6660258], [6660259, 7265736], [7265737, 7871214], [7871215, 8476692], [8476693, 9082170], [9082171, 9687648], [9687649, 10293126], [10293127, 10898604], [10898605, 11504082], [11504083, 12109561]] SRR12671017 file size 4093658 SRR12671017 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671017 SRR12671017_1.fastq SRR12671017_2.fastq Input file: SRR12671017_1.fastq Paired file: SRR12671017_2.fastq trimmed: SRR12671017-trimmed-pair1.fastq, SRR12671017-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:30:19 2025 >> started Tue Feb 11 13:30:39 2025 >> done (20.475s) 12109561 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 15142 ( 0.13%) empty read pairs filtered out after trimming by size control 12094383 (99.87%) read pairs available; of these: 653084 ( 5.40%) trimmed read pairs available after processing 11441299 (94.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 7 0.00% 21 6 0.00% 22 1 0.00% 23 2 0.00% 24 6 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 5 0.00% 29 8 0.00% 30 7 0.00% 31 5 0.00% 32 4 0.00% 33 7 0.00% 34 4 0.00% 35 11 0.00% 36 4 0.00% 37 10 0.00% 38 8 0.00% 39 9 0.00% 40 7 0.00% 41 9 0.00% 42 9 0.00% 43 18 0.00% 44 24 0.00% 45 8 0.00% 46 10 0.00% 47 21 0.00% 48 16 0.00% 49 21 0.00% 50 24 0.00% 51 25 0.00% 52 41 0.00% 53 28 0.00% 54 26 0.00% 55 30 0.00% 56 34 0.00% 57 34 0.00% 58 41 0.00% 59 54 0.00% 60 72 0.00% 61 83 0.00% 62 80 0.00% 63 103 0.00% 64 103 0.00% 65 117 0.00% 66 110 0.00% 67 138 0.00% 68 161 0.00% 69 189 0.00% 70 217 0.00% 71 223 0.00% 72 227 0.00% 73 298 0.00% 74 303 0.00% 75 390 0.00% 76 447 0.00% 77 456 0.00% 78 498 0.00% 79 565 0.00% 80 619 0.01% 81 686 0.01% 82 778 0.01% 83 906 0.01% 84 1008 0.01% 85 1104 0.01% 86 1226 0.01% 87 1340 0.01% 88 1544 0.01% 89 1604 0.01% 90 1788 0.01% 91 1923 0.02% 92 2085 0.02% 93 2196 0.02% 94 2471 0.02% 95 2669 0.02% 96 2893 0.02% 97 2930 0.02% 98 3308 0.03% 99 3509 0.03% 100 3736 0.03% 101 3897 0.03% 102 4160 0.03% 103 4528 0.04% 104 4578 0.04% 105 5050 0.04% 106 5310 0.04% 107 5492 0.05% 108 5705 0.05% 109 6065 0.05% 110 6081 0.05% 111 6559 0.05% 112 6827 0.06% 113 7080 0.06% 114 7285 0.06% 115 7922 0.07% 116 8267 0.07% 117 8709 0.07% 118 9113 0.08% 119 9369 0.08% 120 9635 0.08% 121 10098 0.08% 122 10223 0.08% 123 10408 0.09% 124 10975 0.09% 125 11365 0.09% 126 11893 0.10% 127 12392 0.10% 128 12477 0.10% 129 13058 0.11% 130 13513 0.11% 131 13711 0.11% 132 13794 0.11% 133 14521 0.12% 134 14551 0.12% 135 15452 0.13% 136 15750 0.13% 137 16022 0.13% 138 16702 0.14% 139 17501 0.14% 140 17716 0.15% 141 18315 0.15% 142 18533 0.15% 143 19076 0.16% 144 19704 0.16% 145 19949 0.16% 146 20431 0.17% 147 21170 0.18% 148 21684 0.18% 149 21921 0.18% 150 22846 0.19% 151 11441299 94.60% 12094383 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=28 prefix-density=0.32 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=42.10 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.5 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=28 prefix-density=0.75 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=39.17 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.4 sequence=AAAGAAAAGAAAA SRR12671017 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:31:30 Started mapping on | Feb 11 13:31:31 Finished on | Feb 11 13:34:57 Mapping speed, Million of reads per hour | 211.36 Number of input reads | 12094383 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11386825 Uniquely mapped reads % | 94.15% Average mapped length | 298.29 Number of splices: Total | 11350433 Number of splices: Annotated (sjdb) | 11111751 Number of splices: GT/AG | 11136481 Number of splices: GC/AG | 174762 Number of splices: AT/AC | 7414 Number of splices: Non-canonical | 31776 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279670 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 55069 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427888 427888 427888 N_multimapping 279670 279670 279670 N_noFeature 455168 11219733 503096 N_ambiguous 189012 695 69430 UnstrandedReadsAssigned:10742645 PositiveStrandReadsAssigned:166397 NegativeStrandReadsAssigned:10814299 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671017 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671017-trimmed-pair1.fastq SRR12671017-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,094,383 reads, 10,778,146 reads pseudoaligned [quant] estimated average fragment length: 290.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR12671017.ke.tsv 34699 SRR12671017.se.tsv 87100 total ==> SRR12671017.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.19 449 20.7709 Potri.005G024800.1.v4.1 1035 745.191 192 20.5984 Potri.004G059700.1.v4.1 961 671.498 1 0.119057 Potri.007G009000.2.v4.1 1416 1126.19 0 0 Potri.003G141000.2.v4.1 2943 2653.19 600 18.0793 Potri.016G087400.1.v4.1 270 73.1741 608 664.272 Potri.015G069301.1.v4.1 564 294.886 0 0 Potri.010G195200.1.v4.1 1773 1483.19 76 4.09653 Potri.012G127500.1.v4.1 977 687.354 86 10.0027 ==> SRR12671017.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 136 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671017 completed mapping pipeline successfully