Starting /dee2/code/volunteer_pipeline.sh SRR12671018 current disk space = 3050396790784 free memory = 1489040488 SRR12671018 SRAfilesize 0ade162dce6fa67e6a4551a2d30707ca SRR12671018.sra SRR12671018.sra file validated SRR12671018 is paired end SRR12671018 is conventional basespace SRR12671018 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671018_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46775 37.0 37.0 37.0 37.0 37.0 2 36.428 37.0 37.0 37.0 37.0 37.0 3 36.5235 37.0 37.0 37.0 37.0 37.0 4 36.6315 37.0 37.0 37.0 37.0 37.0 5 36.6455 37.0 37.0 37.0 37.0 37.0 6 36.633 37.0 37.0 37.0 37.0 37.0 7 36.615 37.0 37.0 37.0 37.0 37.0 8 36.5895 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.6029 37.0 37.0 37.0 37.0 37.0 15-19 36.613 37.0 37.0 37.0 37.0 37.0 20-24 36.5528 37.0 37.0 37.0 37.0 37.0 25-29 36.5239 37.0 37.0 37.0 37.0 37.0 30-34 36.457100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4323 37.0 37.0 37.0 37.0 37.0 40-44 36.3889 37.0 37.0 37.0 37.0 37.0 45-49 36.4273 37.0 37.0 37.0 37.0 37.0 50-54 36.3648 37.0 37.0 37.0 37.0 37.0 55-59 36.3474 37.0 37.0 37.0 37.0 37.0 60-64 36.2735 37.0 37.0 37.0 37.0 37.0 65-69 36.3179 37.0 37.0 37.0 37.0 37.0 70-74 36.3475 37.0 37.0 37.0 37.0 37.0 75-79 36.2755 37.0 37.0 37.0 37.0 37.0 80-84 36.2463 37.0 37.0 37.0 37.0 37.0 85-89 36.212900000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.170199999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.08630000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1618 37.0 37.0 37.0 37.0 37.0 105-109 36.0477 37.0 37.0 37.0 37.0 37.0 110-114 36.1052 37.0 37.0 37.0 37.0 37.0 115-119 36.034099999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.032599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.972699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.7974 37.0 37.0 37.0 37.0 37.0 135-139 35.851800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.85510000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.704499999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.4375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 3.0 22 6.0 23 2.0 24 5.0 25 2.0 26 7.0 27 10.0 28 15.0 29 14.0 30 22.0 31 41.0 32 49.0 33 77.0 34 133.0 35 282.0 36 2720.0 37 609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.402704733283244 12.071124467818683 6.486351114450288 37.039819684447785 2 18.85 10.674999999999999 37.175000000000004 33.300000000000004 3 17.224999999999998 14.625 27.750000000000004 40.400000000000006 4 22.025 22.05 24.375 31.55 5 23.974999999999998 28.325 25.8 21.9 6 20.45 32.9 23.549999999999997 23.1 7 14.924999999999999 28.225 40.300000000000004 16.55 8 15.725 26.325 33.75 24.2 9 16.625 24.25 35.199999999999996 23.925 10-14 19.075 30.17 28.335 22.42 15-19 19.605 27.985 28.02 24.39 20-24 19.555 28.28 28.470000000000002 23.695 25-29 19.13 28.139999999999997 28.78 23.95 30-34 19.785 27.395000000000003 28.425 24.395 35-39 19.56 28.665000000000003 28.425 23.35 40-44 19.935 28.835 27.925 23.305 45-49 19.88 28.910000000000004 27.42 23.79 50-54 20.275000000000002 28.26 27.91 23.555 55-59 19.78 28.64 28.18 23.400000000000002 60-64 19.794999999999998 27.82 28.595 23.79 65-69 20.205000000000002 27.87 27.98 23.945 70-74 19.63 28.455000000000002 27.72 24.195 75-79 20.09 28.025 28.21 23.674999999999997 80-84 19.805 28.46 27.87 23.865 85-89 19.89 28.48 28.07 23.56 90-94 19.545 28.595 28.12 23.74 95-99 20.424999999999997 28.139999999999997 28.395 23.04 100-104 20.560000000000002 28.04 27.79 23.61 105-109 20.315 28.38 26.99 24.315 110-114 19.935 27.775 28.235 24.055 115-119 19.950000000000003 28.634999999999998 27.685 23.73 120-124 20.52 28.67 27.345000000000002 23.465 125-129 20.495 28.315 27.73 23.46 130-134 20.54 28.49 27.134999999999998 23.835 135-139 20.915 28.335 27.625 23.125 140-144 20.465 28.405 27.529999999999998 23.599999999999998 145-149 20.330000000000002 28.34 27.115000000000002 24.215 150-151 20.7375 28.499999999999996 27.0625 23.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 1.5 3 1.0 4 0.5 5 0.0 6 1.0 7 1.5 8 0.5 9 0.0 10 0.5 11 0.5 12 1.0 13 1.5 14 1.0 15 1.5 16 2.0 17 1.0 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 3.5 24 6.0 25 5.0 26 5.0 27 7.0 28 9.5 29 12.5 30 16.0 31 29.0 32 38.5 33 44.0 34 57.0 35 71.0 36 79.0 37 91.5 38 112.0 39 150.0 40 183.5 41 199.5 42 231.5 43 251.0 44 255.0 45 287.0 46 293.0 47 269.0 48 241.5 49 209.5 50 176.5 51 148.0 52 128.0 53 96.5 54 73.0 55 54.0 56 40.0 57 32.0 58 23.0 59 18.5 60 15.0 61 5.5 62 1.5 63 1.0 64 0.5 65 1.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97145993413831 82.875 2 8.369923161361141 15.25 3 0.5762897914379802 1.575 4 0.0823271130625686 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8500000000000001 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGTA 10 0.006830828 145.0 1 TTGTTGA 10 0.006830828 145.0 8 >>END_MODULE SRR12671018 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671018_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.269 37.0 37.0 37.0 37.0 37.0 2 36.3635 37.0 37.0 37.0 37.0 37.0 3 36.421 37.0 37.0 37.0 37.0 37.0 4 36.3535 37.0 37.0 37.0 37.0 37.0 5 36.4415 37.0 37.0 37.0 37.0 37.0 6 36.444 37.0 37.0 37.0 37.0 37.0 7 36.4895 37.0 37.0 37.0 37.0 37.0 8 36.5115 37.0 37.0 37.0 37.0 37.0 9 36.531 37.0 37.0 37.0 37.0 37.0 10-14 36.4272 37.0 37.0 37.0 37.0 37.0 15-19 36.394999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4174 37.0 37.0 37.0 37.0 37.0 25-29 36.3301 37.0 37.0 37.0 37.0 37.0 30-34 36.321400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.270799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.29690000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2975 37.0 37.0 37.0 37.0 37.0 50-54 36.278800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2268 37.0 37.0 37.0 37.0 37.0 60-64 36.189299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2178 37.0 37.0 37.0 37.0 37.0 70-74 36.1847 37.0 37.0 37.0 37.0 37.0 75-79 36.128600000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1385 37.0 37.0 37.0 37.0 37.0 85-89 36.05310000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.099900000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.0678 37.0 37.0 37.0 37.0 37.0 100-104 36.0533 37.0 37.0 37.0 37.0 37.0 105-109 36.016999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9828 37.0 37.0 37.0 37.0 37.0 115-119 35.989250000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.9135 37.0 37.0 37.0 37.0 37.0 125-129 35.7877 37.0 37.0 37.0 37.0 37.0 130-134 35.89110000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.8095 37.0 37.0 37.0 37.0 37.0 140-144 35.849900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.55839999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.418 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 2.0 16 2.0 17 0.0 18 0.0 19 2.0 20 0.0 21 1.0 22 2.0 23 0.0 24 6.0 25 4.0 26 9.0 27 12.0 28 15.0 29 25.0 30 35.0 31 34.0 32 41.0 33 84.0 34 146.0 35 343.0 36 2707.0 37 527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 25.974999999999998 9.6 23.799999999999997 2 26.200000000000003 24.825 31.724999999999998 17.25 3 20.75 26.825 33.725 18.7 4 23.200000000000003 34.65 22.95 19.2 5 25.174999999999997 38.125 21.575 15.125 6 21.675 40.050000000000004 21.625 16.650000000000002 7 20.175 23.974999999999998 37.824999999999996 18.025 8 19.975 25.874999999999996 29.175 24.975 9 21.224999999999998 24.675 29.95 24.15 10-14 22.57 29.525000000000002 26.77 21.135 15-19 22.105 28.410000000000004 28.299999999999997 21.185000000000002 20-24 22.305 29.830000000000002 27.205000000000002 20.66 25-29 22.54 28.24 28.205000000000002 21.015 30-34 22.220000000000002 29.099999999999998 27.445000000000004 21.235 35-39 22.98 27.595 28.449999999999996 20.974999999999998 40-44 22.134999999999998 28.51 28.455000000000002 20.9 45-49 22.53 28.505000000000003 28.360000000000003 20.605 50-54 22.95 28.33 27.245 21.475 55-59 22.93 27.950000000000003 27.810000000000002 21.310000000000002 60-64 22.53 28.075 28.24 21.154999999999998 65-69 22.955000000000002 28.189999999999998 28.16 20.695 70-74 22.74 27.725 28.095 21.44 75-79 23.04 27.955000000000002 27.61 21.395 80-84 22.900000000000002 28.15 27.865000000000002 21.085 85-89 23.175 28.48 27.015 21.33 90-94 23.04 27.894999999999996 28.025 21.04 95-99 23.549999999999997 27.735 27.655 21.060000000000002 100-104 23.03 27.815 28.15 21.005 105-109 23.06 28.189999999999998 27.765 20.985 110-114 23.25 28.09 27.875 20.785 115-119 23.59617980899045 28.066403320166007 27.44637231861593 20.891044552227612 120-124 23.435 28.235 27.495000000000005 20.835 125-129 23.18 27.810000000000002 27.800000000000004 21.21 130-134 23.82 27.965 27.515 20.7 135-139 23.315 27.605 27.965 21.115000000000002 140-144 23.09 28.384999999999998 28.15 20.375 145-149 24.055 28.15 27.884999999999998 19.91 150-151 23.150000000000002 28.175 27.950000000000003 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 3.0 24 5.5 25 3.5 26 5.0 27 9.5 28 12.0 29 14.0 30 15.0 31 21.0 32 33.5 33 45.5 34 53.0 35 67.5 36 86.5 37 106.5 38 146.0 39 181.5 40 188.5 41 208.5 42 253.5 43 275.5 44 280.5 45 292.0 46 276.0 47 235.5 48 220.0 49 198.0 50 157.0 51 133.0 52 106.0 53 80.5 54 66.5 55 62.5 56 49.0 57 30.5 58 25.0 59 17.0 60 8.5 61 3.5 62 3.0 63 2.5 64 2.5 65 1.5 66 0.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.80649600880815 82.475 2 8.367740159647674 15.2 3 0.7431874483897605 2.025 4 0.08257638315441783 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.6375 0.0 0.0 0.0 0.0 132-133 1.7375 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAAT 10 0.006830828 145.0 6 TGACTGT 10 0.006830828 145.0 8 >>END_MODULE Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751675 spots for SRR12671018.sra Written 751675 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra Read 751670 spots for SRR12671018.sra Written 751670 spots for SRR12671018.sra SRR ids: ['SRR12671018.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4sdy1745 SRR12671018.sra spots: 15033405 blocks: [[1, 751670], [751671, 1503340], [1503341, 2255010], [2255011, 3006680], [3006681, 3758350], [3758351, 4510020], [4510021, 5261690], [5261691, 6013360], [6013361, 6765030], [6765031, 7516700], [7516701, 8268370], [8268371, 9020040], [9020041, 9771710], [9771711, 10523380], [10523381, 11275050], [11275051, 12026720], [12026721, 12778390], [12778391, 13530060], [13530061, 14281730], [14281731, 15033405]] SRR12671018 file size 5087308 SRR12671018 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671018 SRR12671018_1.fastq SRR12671018_2.fastq Input file: SRR12671018_1.fastq Paired file: SRR12671018_2.fastq trimmed: SRR12671018-trimmed-pair1.fastq, SRR12671018-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:37:04 2025 >> started Tue Feb 11 13:37:21 2025 >> done (16.330s) 15033405 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 3616 ( 0.02%) empty read pairs filtered out after trimming by size control 15029709 (99.98%) read pairs available; of these: 556383 ( 3.70%) trimmed read pairs available after processing 14473326 (96.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 9 0.00% 20 6 0.00% 21 6 0.00% 22 6 0.00% 23 11 0.00% 24 14 0.00% 25 9 0.00% 26 10 0.00% 27 9 0.00% 28 13 0.00% 29 10 0.00% 30 15 0.00% 31 7 0.00% 32 13 0.00% 33 23 0.00% 34 14 0.00% 35 14 0.00% 36 18 0.00% 37 16 0.00% 38 19 0.00% 39 13 0.00% 40 17 0.00% 41 14 0.00% 42 9 0.00% 43 18 0.00% 44 5 0.00% 45 15 0.00% 46 9 0.00% 47 20 0.00% 48 18 0.00% 49 18 0.00% 50 20 0.00% 51 39 0.00% 52 24 0.00% 53 23 0.00% 54 30 0.00% 55 35 0.00% 56 33 0.00% 57 43 0.00% 58 45 0.00% 59 49 0.00% 60 49 0.00% 61 78 0.00% 62 60 0.00% 63 98 0.00% 64 102 0.00% 65 105 0.00% 66 121 0.00% 67 117 0.00% 68 132 0.00% 69 149 0.00% 70 146 0.00% 71 191 0.00% 72 209 0.00% 73 269 0.00% 74 319 0.00% 75 301 0.00% 76 364 0.00% 77 404 0.00% 78 438 0.00% 79 457 0.00% 80 572 0.00% 81 565 0.00% 82 685 0.00% 83 777 0.01% 84 909 0.01% 85 976 0.01% 86 1025 0.01% 87 1193 0.01% 88 1254 0.01% 89 1348 0.01% 90 1479 0.01% 91 1488 0.01% 92 1801 0.01% 93 1926 0.01% 94 2103 0.01% 95 2224 0.01% 96 2453 0.02% 97 2679 0.02% 98 2768 0.02% 99 2878 0.02% 100 3189 0.02% 101 3230 0.02% 102 3446 0.02% 103 3614 0.02% 104 3933 0.03% 105 4160 0.03% 106 4429 0.03% 107 4518 0.03% 108 4861 0.03% 109 4949 0.03% 110 5172 0.03% 111 5443 0.04% 112 5687 0.04% 113 6004 0.04% 114 6216 0.04% 115 6708 0.04% 116 6681 0.04% 117 7167 0.05% 118 7469 0.05% 119 7648 0.05% 120 8163 0.05% 121 8436 0.06% 122 8578 0.06% 123 8893 0.06% 124 9273 0.06% 125 9481 0.06% 126 10183 0.07% 127 10372 0.07% 128 10330 0.07% 129 10917 0.07% 130 11563 0.08% 131 11469 0.08% 132 12076 0.08% 133 12263 0.08% 134 12528 0.08% 135 13319 0.09% 136 13388 0.09% 137 13761 0.09% 138 14430 0.10% 139 15075 0.10% 140 15137 0.10% 141 15579 0.10% 142 16009 0.11% 143 16562 0.11% 144 16745 0.11% 145 17109 0.11% 146 17582 0.12% 147 18256 0.12% 148 19103 0.13% 149 19185 0.13% 150 20140 0.13% 151 14473326 96.30% 15029709 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=144.00 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=17.5 sequence=CAGCAACAACATCAGGATGGCTGAATATCTTAGCAGCATCACATCTCTTATTTGTCGGAATTGGCTCGCCAGCAGGAGTATAAGCGTCACATATGACGAGGATGTTATTGCCCCTCCTAAATGGATCTCTGAAAATAGCTTGTGGATATAGGATCACTTCACTGTCTTGTCCAGGAGCCTGGCCTGTGCTGGAACCATCATAGTTCCATTTGGGAAGCTTTGCAGGATCACTAACTGGGCCGGAAAGAGTCCTTGCTTTGCTCCTTATATCCAATCCAGATCCACCAATCCATAAGTACTCAGCAATGATTTTCTCAGTGGAGTCTGAGAGGTTAAGGTTAATGAGATCTGAAAGCAACGA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=37 prefix-density=0.49 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=66.93 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=12.4 sequence=TTGTTGGTGCTGGCTCTGCTGGTCTTTCTTGTGCTTATGAGCTAAGCAAGAACCCTTCAGTTCGTGTTGCTATAATTGAGCAATCGGTTAGCCCTGGAGGTGGTGCATGGCTTGGTGGCCAGCTATTTTCA SRR12671018 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:38:05 Started mapping on | Feb 11 13:38:06 Finished on | Feb 11 13:39:41 Mapping speed, Million of reads per hour | 569.55 Number of input reads | 15029709 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14205875 Uniquely mapped reads % | 94.52% Average mapped length | 299.07 Number of splices: Total | 14537294 Number of splices: Annotated (sjdb) | 14239826 Number of splices: GT/AG | 14254134 Number of splices: GC/AG | 236275 Number of splices: AT/AC | 8820 Number of splices: Non-canonical | 38065 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334486 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 62547 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489348 489348 489348 N_multimapping 334486 334486 334486 N_noFeature 535976 14000093 589851 N_ambiguous 239162 754 86962 UnstrandedReadsAssigned:13430737 PositiveStrandReadsAssigned:205028 NegativeStrandReadsAssigned:13529062 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671018 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671018-trimmed-pair1.fastq SRR12671018-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,029,709 reads, 13,494,617 reads pseudoaligned [quant] estimated average fragment length: 299.2 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR12671018.ke.tsv 34699 SRR12671018.se.tsv 87100 total ==> SRR12671018.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.8 443 15.8181 Potri.005G024800.1.v4.1 1035 736.8 182 15.1688 Potri.004G059700.1.v4.1 961 663 9 0.8336 Potri.007G009000.2.v4.1 1416 1117.8 0 0 Potri.003G141000.2.v4.1 2943 2644.8 572.832 13.3003 Potri.016G087400.1.v4.1 270 66.6243 741 682.99 Potri.015G069301.1.v4.1 564 283.791 0 0 Potri.010G195200.1.v4.1 1773 1474.8 36 1.49899 Potri.012G127500.1.v4.1 977 678.899 83 7.50761 ==> SRR12671018.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 124 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR12671018 completed mapping pipeline successfully