Starting /dee2/code/volunteer_pipeline.sh SRR12671019 current disk space = 3050157776896 free memory = 1511146324 SRR12671019 SRAfilesize 9349e826bdec85f938b6a5c5222fcac8 SRR12671019.sra SRR12671019.sra file validated SRR12671019 is paired end SRR12671019 is conventional basespace SRR12671019 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671019_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.405 37.0 37.0 37.0 37.0 37.0 2 36.3975 37.0 37.0 37.0 37.0 37.0 3 36.596 37.0 37.0 37.0 37.0 37.0 4 36.675 37.0 37.0 37.0 37.0 37.0 5 36.6745 37.0 37.0 37.0 37.0 37.0 6 36.702 37.0 37.0 37.0 37.0 37.0 7 36.554 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.575 37.0 37.0 37.0 37.0 37.0 10-14 36.636399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5995 37.0 37.0 37.0 37.0 37.0 20-24 36.5529 37.0 37.0 37.0 37.0 37.0 25-29 36.4922 37.0 37.0 37.0 37.0 37.0 30-34 36.463699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.44500000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.482299999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4619 37.0 37.0 37.0 37.0 37.0 50-54 36.4133 37.0 37.0 37.0 37.0 37.0 55-59 36.4279 37.0 37.0 37.0 37.0 37.0 60-64 36.328500000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2996 37.0 37.0 37.0 37.0 37.0 70-74 36.353899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.328199999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3159 37.0 37.0 37.0 37.0 37.0 85-89 36.2593 37.0 37.0 37.0 37.0 37.0 90-94 36.2558 37.0 37.0 37.0 37.0 37.0 95-99 36.21339999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2325 37.0 37.0 37.0 37.0 37.0 105-109 36.16030000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1798 37.0 37.0 37.0 37.0 37.0 115-119 36.0871 37.0 37.0 37.0 37.0 37.0 120-124 36.0894 37.0 37.0 37.0 37.0 37.0 125-129 36.0227 37.0 37.0 37.0 37.0 37.0 130-134 35.8469 37.0 37.0 37.0 37.0 37.0 135-139 35.9129 37.0 37.0 37.0 37.0 37.0 140-144 35.864 37.0 37.0 37.0 37.0 37.0 145-149 35.697449999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.49575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.0 27 9.0 28 12.0 29 23.0 30 24.0 31 32.0 32 57.0 33 88.0 34 144.0 35 253.0 36 2686.0 37 659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.475 12.425 3.95 44.15 2 17.45 12.25 39.975 30.325000000000003 3 17.0 14.625 29.375 39.0 4 22.0 23.825 23.575 30.599999999999998 5 24.15 30.0 24.825 21.025 6 18.675 33.1 24.349999999999998 23.875 7 13.775 28.025 41.8 16.400000000000002 8 16.1 26.424999999999997 33.35 24.125 9 17.849999999999998 22.1 36.15 23.9 10-14 19.13 30.115 28.265 22.49 15-19 19.2 28.17 28.494999999999997 24.135 20-24 20.085 28.815 27.87 23.23 25-29 19.869999999999997 28.365000000000002 28.275 23.49 30-34 20.11 28.660000000000004 28.12 23.11 35-39 19.655 28.475 28.09 23.78 40-44 20.23 28.835 27.700000000000003 23.235 45-49 19.475 28.425 28.060000000000002 24.04 50-54 20.405 28.465 28.115000000000002 23.015 55-59 20.645 28.449999999999996 27.825 23.080000000000002 60-64 19.814999999999998 28.299999999999997 28.205000000000002 23.68 65-69 20.06 27.474999999999998 28.555000000000003 23.91 70-74 19.72 28.535 27.474999999999998 24.27 75-79 20.985 27.87 27.500000000000004 23.645 80-84 19.855 28.815 27.839999999999996 23.49 85-89 20.53 27.689999999999998 27.889999999999997 23.89 90-94 19.955000000000002 28.585 27.800000000000004 23.66 95-99 20.349999999999998 28.675 27.694999999999997 23.28 100-104 20.380000000000003 28.185 27.83 23.605 105-109 20.345 27.96 27.935 23.76 110-114 20.655 28.515 27.089999999999996 23.74 115-119 20.515 29.299999999999997 27.07 23.115 120-124 20.57 28.22 27.36 23.849999999999998 125-129 20.044999999999998 28.499999999999996 27.495000000000005 23.96 130-134 20.895 28.595 27.560000000000002 22.95 135-139 20.95 28.315 27.384999999999998 23.35 140-144 21.099999999999998 27.875 27.87 23.155 145-149 20.641032051602583 28.23641182059103 27.211360568028404 23.91119555977799 150-151 20.7375 28.3625 27.125 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.5 24 5.5 25 5.5 26 3.0 27 9.5 28 11.0 29 12.5 30 20.5 31 24.0 32 34.5 33 49.0 34 55.0 35 70.0 36 89.0 37 115.5 38 149.5 39 181.0 40 197.5 41 203.0 42 211.0 43 229.5 44 254.5 45 272.5 46 267.0 47 241.5 48 231.0 49 205.5 50 180.5 51 161.0 52 125.0 53 91.5 54 70.5 55 56.0 56 39.0 57 31.0 58 27.0 59 22.5 60 14.0 61 5.5 62 5.0 63 3.0 64 1.5 65 3.0 66 4.0 67 2.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.07782101167315 81.025 2 8.810450250138967 15.85 3 1.000555864369094 2.7 4 0.08337965536409116 0.3 5 0.027793218454697052 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGAAGATGAGGCGGTTTGTAATTCAGCTGTTATCTGCTCCACTTTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.225 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.225 0.0 0.0 0.0 0.0 136-137 5.55 0.0 0.0 0.0 0.0 138-139 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTGAA 10 0.006830828 145.0 7 CGTGAAA 10 0.006830828 145.0 8 >>END_MODULE SRR12671019 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671019_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.334 37.0 37.0 37.0 37.0 37.0 2 36.339 37.0 37.0 37.0 37.0 37.0 3 36.377 37.0 37.0 37.0 37.0 37.0 4 36.388 37.0 37.0 37.0 37.0 37.0 5 36.5495 37.0 37.0 37.0 37.0 37.0 6 36.471 37.0 37.0 37.0 37.0 37.0 7 36.4265 37.0 37.0 37.0 37.0 37.0 8 36.5105 37.0 37.0 37.0 37.0 37.0 9 36.462 37.0 37.0 37.0 37.0 37.0 10-14 36.474599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5161 37.0 37.0 37.0 37.0 37.0 20-24 36.519400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.417100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.394 37.0 37.0 37.0 37.0 37.0 35-39 36.321400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3262 37.0 37.0 37.0 37.0 37.0 45-49 36.33120000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.2971 37.0 37.0 37.0 37.0 37.0 55-59 36.2548 37.0 37.0 37.0 37.0 37.0 60-64 36.2618 37.0 37.0 37.0 37.0 37.0 65-69 36.3103 37.0 37.0 37.0 37.0 37.0 70-74 36.241600000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.1874 37.0 37.0 37.0 37.0 37.0 80-84 36.182 37.0 37.0 37.0 37.0 37.0 85-89 36.173500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.163799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2009 37.0 37.0 37.0 37.0 37.0 100-104 36.1717 37.0 37.0 37.0 37.0 37.0 105-109 36.0565 37.0 37.0 37.0 37.0 37.0 110-114 36.0568 37.0 37.0 37.0 37.0 37.0 115-119 36.095150000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9538 37.0 37.0 37.0 37.0 37.0 125-129 35.846500000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.7941 37.0 37.0 37.0 37.0 37.0 135-139 35.7583 37.0 37.0 37.0 37.0 37.0 140-144 35.695449999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.453700000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.048500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 3.0 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 3.0 24 1.0 25 4.0 26 4.0 27 4.0 28 17.0 29 21.0 30 25.0 31 34.0 32 47.0 33 96.0 34 150.0 35 349.0 36 2644.0 37 587.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.75 24.099999999999998 8.649999999999999 28.499999999999996 2 25.025 25.55 34.575 14.85 3 20.025000000000002 26.275 33.925 19.775000000000002 4 23.65 32.225 24.775 19.35 5 26.625 35.725 21.8 15.85 6 19.125 40.0 23.0 17.875 7 19.1 22.275 39.175 19.45 8 18.05 25.55 32.550000000000004 23.849999999999998 9 22.025 25.15 29.95 22.875 10-14 22.79 29.775000000000002 26.534999999999997 20.9 15-19 23.05 28.16 27.779999999999998 21.01 20-24 22.42 29.15 27.74 20.69 25-29 22.91 27.884999999999998 28.23 20.974999999999998 30-34 22.68 27.93 28.215 21.175 35-39 22.33 28.305000000000003 28.515 20.849999999999998 40-44 23.055 27.860000000000003 28.32 20.765 45-49 22.37 27.765 28.685 21.18 50-54 22.185 28.38 28.185 21.25 55-59 22.74 27.66 27.935 21.665 60-64 22.555 27.389999999999997 28.444999999999997 21.61 65-69 22.905 27.82 28.155 21.12 70-74 23.285 27.560000000000002 28.249999999999996 20.905 75-79 23.415 28.02 27.560000000000002 21.005 80-84 23.330000000000002 28.435 27.705000000000002 20.53 85-89 23.555 28.349999999999998 27.22 20.875 90-94 23.685000000000002 27.689999999999998 27.994999999999997 20.630000000000003 95-99 23.115 27.944999999999997 28.199999999999996 20.74 100-104 22.86 28.315 27.839999999999996 20.985 105-109 23.325000000000003 28.065 28.205000000000002 20.405 110-114 23.49 27.32 28.675 20.515 115-119 24.331216560828043 26.901345067253363 28.021401070053503 20.746037301865094 120-124 24.37 28.54 27.13 19.96 125-129 24.610000000000003 27.700000000000003 27.334999999999997 20.355 130-134 24.465 28.535 27.195000000000004 19.805 135-139 24.45 27.889999999999997 27.534999999999997 20.125 140-144 24.14620731036552 28.531426571328566 27.536376818840942 19.785989299464973 145-149 25.395 28.325 26.66 19.62 150-151 25.45 28.599999999999998 26.474999999999998 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 1.5 24 2.5 25 4.5 26 4.5 27 7.0 28 9.0 29 13.5 30 20.5 31 25.5 32 34.0 33 40.5 34 47.5 35 65.5 36 92.5 37 120.0 38 150.5 39 179.5 40 189.5 41 220.0 42 249.5 43 266.0 44 279.0 45 258.0 46 252.5 47 251.5 48 223.0 49 198.5 50 169.5 51 134.0 52 103.0 53 81.0 54 77.0 55 62.5 56 46.0 57 32.5 58 16.5 59 11.5 60 13.0 61 9.5 62 7.0 63 5.0 64 1.5 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.8 #Duplication Level Percentage of deduplicated Percentage of total 1 90.06124721603564 80.875 2 8.825167037861915 15.85 3 0.9187082405345212 2.475 4 0.08351893095768374 0.3 5 0.11135857461024498 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 3.7125000000000004 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.7 0.0 0.0 0.0 0.0 134-135 5.175 0.0 0.0 0.0 0.0 136-137 5.5 0.0 0.0 0.0 0.0 138-139 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGAAC 10 0.006830828 145.0 145 ATAGAGG 10 0.006830828 145.0 6 TAGAGGG 10 0.006830828 145.0 7 >>END_MODULE Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537883 spots for SRR12671019.sra Written 537883 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra Read 537870 spots for SRR12671019.sra Written 537870 spots for SRR12671019.sra SRR ids: ['SRR12671019.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_icvb3wbs SRR12671019.sra spots: 10757413 blocks: [[1, 537870], [537871, 1075740], [1075741, 1613610], [1613611, 2151480], [2151481, 2689350], [2689351, 3227220], [3227221, 3765090], [3765091, 4302960], [4302961, 4840830], [4840831, 5378700], [5378701, 5916570], [5916571, 6454440], [6454441, 6992310], [6992311, 7530180], [7530181, 8068050], [8068051, 8605920], [8605921, 9143790], [9143791, 9681660], [9681661, 10219530], [10219531, 10757413]] SRR12671019 file size 3634139 SRR12671019 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671019 SRR12671019_1.fastq SRR12671019_2.fastq Input file: SRR12671019_1.fastq Paired file: SRR12671019_2.fastq trimmed: SRR12671019-trimmed-pair1.fastq, SRR12671019-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:06:51 2025 >> started Tue Feb 11 14:07:07 2025 >> done (16.245s) 10757413 read pairs processed; of these: 41 ( 0.00%) short read pairs filtered out after trimming by size control 586 ( 0.01%) empty read pairs filtered out after trimming by size control 10756786 (99.99%) read pairs available; of these: 899945 ( 8.37%) trimmed read pairs available after processing 9856841 (91.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 6 0.00% 23 9 0.00% 24 10 0.00% 25 1 0.00% 26 3 0.00% 27 6 0.00% 28 7 0.00% 29 7 0.00% 30 6 0.00% 31 15 0.00% 32 5 0.00% 33 5 0.00% 34 7 0.00% 35 7 0.00% 36 7 0.00% 37 13 0.00% 38 15 0.00% 39 7 0.00% 40 10 0.00% 41 14 0.00% 42 20 0.00% 43 13 0.00% 44 13 0.00% 45 14 0.00% 46 20 0.00% 47 29 0.00% 48 26 0.00% 49 28 0.00% 50 32 0.00% 51 46 0.00% 52 37 0.00% 53 48 0.00% 54 55 0.00% 55 48 0.00% 56 69 0.00% 57 63 0.00% 58 95 0.00% 59 107 0.00% 60 103 0.00% 61 150 0.00% 62 164 0.00% 63 193 0.00% 64 209 0.00% 65 231 0.00% 66 226 0.00% 67 252 0.00% 68 287 0.00% 69 355 0.00% 70 411 0.00% 71 447 0.00% 72 559 0.01% 73 619 0.01% 74 706 0.01% 75 738 0.01% 76 850 0.01% 77 939 0.01% 78 1042 0.01% 79 1134 0.01% 80 1255 0.01% 81 1421 0.01% 82 1612 0.01% 83 1711 0.02% 84 1904 0.02% 85 1999 0.02% 86 2317 0.02% 87 2564 0.02% 88 2724 0.03% 89 2777 0.03% 90 3069 0.03% 91 3247 0.03% 92 3503 0.03% 93 3796 0.04% 94 4109 0.04% 95 4365 0.04% 96 4650 0.04% 97 4954 0.05% 98 5155 0.05% 99 5381 0.05% 100 5804 0.05% 101 5819 0.05% 102 6337 0.06% 103 6514 0.06% 104 6990 0.06% 105 7305 0.07% 106 7688 0.07% 107 8067 0.07% 108 8373 0.08% 109 8618 0.08% 110 8897 0.08% 111 9621 0.09% 112 9571 0.09% 113 9936 0.09% 114 10501 0.10% 115 10784 0.10% 116 11451 0.11% 117 12067 0.11% 118 12457 0.12% 119 12776 0.12% 120 13406 0.12% 121 13734 0.13% 122 14054 0.13% 123 14663 0.14% 124 14964 0.14% 125 15548 0.14% 126 16446 0.15% 127 16447 0.15% 128 17173 0.16% 129 17761 0.17% 130 18355 0.17% 131 18462 0.17% 132 19228 0.18% 133 19497 0.18% 134 19866 0.18% 135 20299 0.19% 136 20970 0.19% 137 21646 0.20% 138 22402 0.21% 139 23396 0.22% 140 23774 0.22% 141 23993 0.22% 142 24713 0.23% 143 25087 0.23% 144 25783 0.24% 145 25836 0.24% 146 26535 0.25% 147 26873 0.25% 148 28106 0.26% 149 28660 0.27% 150 29625 0.28% 151 9856841 91.63% 10756786 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=9.90 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=5.5 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.95 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=36.60 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=CCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12671019 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:07:50 Started mapping on | Feb 11 14:07:50 Finished on | Feb 11 14:09:09 Mapping speed, Million of reads per hour | 490.18 Number of input reads | 10756786 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10205901 Uniquely mapped reads % | 94.88% Average mapped length | 296.88 Number of splices: Total | 10382312 Number of splices: Annotated (sjdb) | 10173869 Number of splices: GT/AG | 10172893 Number of splices: GC/AG | 172978 Number of splices: AT/AC | 6257 Number of splices: Non-canonical | 30184 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230715 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 68418 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 320170 320170 320170 N_multimapping 230715 230715 230715 N_noFeature 433324 10052321 486570 N_ambiguous 162524 603 61856 UnstrandedReadsAssigned:9610053 PositiveStrandReadsAssigned:152977 NegativeStrandReadsAssigned:9657475 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671019 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671019-trimmed-pair1.fastq SRR12671019-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,756,786 reads, 9,661,224 reads pseudoaligned [quant] estimated average fragment length: 262.103 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR12671019.ke.tsv 34699 SRR12671019.se.tsv 87100 total ==> SRR12671019.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.9 283 15.0497 Potri.005G024800.1.v4.1 1035 773.897 97 11.7105 Potri.004G059700.1.v4.1 961 700.04 5 0.667321 Potri.007G009000.2.v4.1 1416 1154.9 0 0 Potri.003G141000.2.v4.1 2943 2681.9 603.603 21.028 Potri.016G087400.1.v4.1 270 79.7368 429 502.674 Potri.015G069301.1.v4.1 564 315.976 0 0 Potri.010G195200.1.v4.1 1773 1511.9 14 0.865155 Potri.012G127500.1.v4.1 977 715.963 29 3.78439 ==> SRR12671019.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671019 completed mapping pipeline successfully