Starting /dee2/code/volunteer_pipeline.sh SRR12671020 current disk space = 3050329419776 free memory = 1400940180 SRR12671020 SRAfilesize 5ab367cb9f8243ac2d3e1150c5068ced SRR12671020.sra SRR12671020.sra file validated SRR12671020 is paired end SRR12671020 is conventional basespace SRR12671020 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671020_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.356 37.0 37.0 37.0 37.0 37.0 2 36.354 37.0 37.0 37.0 37.0 37.0 3 36.5085 37.0 37.0 37.0 37.0 37.0 4 36.598 37.0 37.0 37.0 37.0 37.0 5 36.5565 37.0 37.0 37.0 37.0 37.0 6 36.5875 37.0 37.0 37.0 37.0 37.0 7 36.5285 37.0 37.0 37.0 37.0 37.0 8 36.533 37.0 37.0 37.0 37.0 37.0 9 36.5605 37.0 37.0 37.0 37.0 37.0 10-14 36.631299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5663 37.0 37.0 37.0 37.0 37.0 20-24 36.4951 37.0 37.0 37.0 37.0 37.0 25-29 36.509299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4536 37.0 37.0 37.0 37.0 37.0 35-39 36.4313 37.0 37.0 37.0 37.0 37.0 40-44 36.4625 37.0 37.0 37.0 37.0 37.0 45-49 36.427299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3749 37.0 37.0 37.0 37.0 37.0 55-59 36.369299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.281499999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.358599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.305 37.0 37.0 37.0 37.0 37.0 75-79 36.272000000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.244600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2553 37.0 37.0 37.0 37.0 37.0 90-94 36.21040000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.130700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1464 37.0 37.0 37.0 37.0 37.0 105-109 36.130100000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0426 37.0 37.0 37.0 37.0 37.0 115-119 35.98955 37.0 37.0 37.0 37.0 37.0 120-124 36.0355 37.0 37.0 37.0 37.0 37.0 125-129 35.9888 37.0 37.0 37.0 37.0 37.0 130-134 35.7606 37.0 37.0 37.0 37.0 37.0 135-139 35.883599999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.7635 37.0 37.0 37.0 37.0 37.0 145-149 35.674400000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.45825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 7.0 26 4.0 27 14.0 28 15.0 29 23.0 30 27.0 31 45.0 32 67.0 33 69.0 34 130.0 35 275.0 36 2759.0 37 562.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.85092546273137 11.430715357678839 4.6773386693346675 32.04102051025512 2 19.900000000000002 11.225 35.625 33.25 3 16.950000000000003 15.125 28.65 39.275 4 21.05 22.8 25.1 31.05 5 24.474999999999998 29.875 24.5 21.15 6 21.224999999999998 32.324999999999996 24.025 22.425 7 15.2 27.175 40.949999999999996 16.675 8 15.875 26.450000000000003 33.75 23.925 9 17.424999999999997 23.325000000000003 36.05 23.200000000000003 10-14 19.845 29.705 28.285 22.165000000000003 15-19 20.085 27.384999999999998 27.725 24.805 20-24 19.994999999999997 27.97 27.889999999999997 24.145 25-29 20.115 27.894999999999996 28.38 23.61 30-34 19.919999999999998 27.965 27.965 24.15 35-39 20.080000000000002 28.139999999999997 27.800000000000004 23.98 40-44 20.16 27.875 28.565 23.400000000000002 45-49 20.39 28.13 27.439999999999998 24.04 50-54 20.03 28.244999999999997 28.360000000000003 23.365 55-59 20.315 28.18 27.83 23.674999999999997 60-64 20.669999999999998 28.095 27.750000000000004 23.485 65-69 19.85 28.57 27.529999999999998 24.05 70-74 19.955000000000002 28.425 28.060000000000002 23.56 75-79 20.185 27.675 28.355000000000004 23.785 80-84 20.035 28.544999999999998 27.83 23.59 85-89 19.55 28.315 27.860000000000003 24.275 90-94 20.015 27.97 27.894999999999996 24.12 95-99 20.51 27.85 27.855 23.785 100-104 20.919999999999998 28.244999999999997 27.425 23.41 105-109 19.82 28.475 27.794999999999998 23.91 110-114 20.415 28.144999999999996 27.97 23.47 115-119 21.436071803590178 28.291414570728534 27.431371568578427 22.841142057102857 120-124 20.244999999999997 28.535 27.77 23.45 125-129 20.7 28.38 27.29 23.630000000000003 130-134 20.625 28.444999999999997 27.389999999999997 23.54 135-139 21.325 27.744999999999997 27.52 23.41 140-144 20.580000000000002 28.13 27.939999999999998 23.35 145-149 20.507050705070505 28.312831283128315 27.462746274627463 23.717371737173718 150-151 20.4875 28.512500000000003 27.6125 23.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 2.0 24 4.0 25 6.5 26 8.0 27 7.5 28 10.0 29 19.5 30 25.5 31 24.5 32 25.5 33 33.0 34 54.0 35 71.5 36 79.0 37 89.0 38 114.0 39 143.5 40 162.5 41 198.5 42 216.5 43 230.5 44 257.5 45 280.5 46 284.0 47 269.0 48 247.5 49 215.5 50 191.0 51 166.5 52 129.0 53 95.5 54 81.5 55 67.5 56 54.0 57 31.5 58 21.5 59 21.0 60 15.5 61 10.5 62 4.5 63 5.0 64 6.5 65 3.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.9 #Duplication Level Percentage of deduplicated Percentage of total 1 92.16539717083788 84.7 2 7.072905331882481 13.0 3 0.6256800870511425 1.725 4 0.08161044613710555 0.3 5 0.02720348204570185 0.125 6 0.02720348204570185 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGATCACAAATCATACGCTTGCTTGCCTGTGAACTTGACCTCAATTGGG 6 0.15 No Hit ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.6124999999999998 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTGA 10 0.006830828 145.0 9 TTCCAGC 10 0.006830828 145.0 145 GTGATTG 10 0.006830828 145.0 8 TTGTGAT 10 0.006830828 145.0 6 GCATTGT 10 0.006830828 145.0 3 TGTGATT 10 0.006830828 145.0 7 >>END_MODULE SRR12671020 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671020_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0295 37.0 37.0 37.0 37.0 37.0 2 36.14 37.0 37.0 37.0 37.0 37.0 3 36.1685 37.0 37.0 37.0 37.0 37.0 4 36.2055 37.0 37.0 37.0 37.0 37.0 5 36.3005 37.0 37.0 37.0 37.0 37.0 6 36.307 37.0 37.0 37.0 37.0 37.0 7 36.1595 37.0 37.0 37.0 37.0 37.0 8 36.2975 37.0 37.0 37.0 37.0 37.0 9 36.2905 37.0 37.0 37.0 37.0 37.0 10-14 36.289 37.0 37.0 37.0 37.0 37.0 15-19 36.197599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.14489999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1113 37.0 37.0 37.0 37.0 37.0 30-34 36.10430000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.0321 37.0 37.0 37.0 37.0 37.0 40-44 36.012299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0275 37.0 37.0 37.0 37.0 37.0 50-54 36.00899999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.9283 37.0 37.0 37.0 37.0 37.0 60-64 35.974900000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.93579999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.929 37.0 37.0 37.0 37.0 37.0 75-79 35.8701 37.0 37.0 37.0 37.0 37.0 80-84 35.8784 37.0 37.0 37.0 37.0 37.0 85-89 35.78245 37.0 37.0 37.0 37.0 37.0 90-94 35.7969 37.0 37.0 37.0 37.0 37.0 95-99 35.7903 37.0 37.0 37.0 37.0 37.0 100-104 35.8155 37.0 37.0 37.0 37.0 37.0 105-109 35.6878 37.0 37.0 37.0 37.0 37.0 110-114 35.7123 37.0 37.0 37.0 37.0 37.0 115-119 35.68885 37.0 37.0 37.0 37.0 37.0 120-124 35.5818 37.0 37.0 37.0 37.0 37.0 125-129 35.5355 37.0 37.0 37.0 37.0 37.0 130-134 35.4577 37.0 37.0 37.0 37.0 37.0 135-139 35.5316 37.0 37.0 37.0 37.0 37.0 140-144 35.510949999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.3252 37.0 37.0 37.0 37.0 37.0 150-151 35.06425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 6.0 15 4.0 16 7.0 17 4.0 18 3.0 19 4.0 20 6.0 21 5.0 22 8.0 23 7.0 24 9.0 25 7.0 26 12.0 27 14.0 28 19.0 29 15.0 30 33.0 31 30.0 32 50.0 33 83.0 34 153.0 35 374.0 36 2618.0 37 521.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.725 26.625 7.625 20.025000000000002 2 27.750000000000004 26.275 29.475 16.5 3 21.65 27.525 33.025 17.8 4 22.8 34.375 22.825 20.0 5 26.174999999999997 35.825 21.325 16.675 6 21.9 39.025 21.375 17.7 7 21.025 22.2 38.074999999999996 18.7 8 20.474999999999998 25.775 28.725 25.025 9 21.825 24.099999999999998 30.325000000000003 23.75 10-14 23.52 29.335 26.57 20.575 15-19 23.025000000000002 28.29 27.445000000000004 21.240000000000002 20-24 23.715 27.825 27.68 20.78 25-29 23.015 28.655 27.79 20.54 30-34 22.645 28.29 27.750000000000004 21.315 35-39 22.295 28.825 27.99 20.89 40-44 23.32 27.900000000000002 28.32 20.46 45-49 23.135 28.265 27.905 20.695 50-54 23.02 28.59 27.744999999999997 20.645 55-59 22.775000000000002 27.994999999999997 28.084999999999997 21.145 60-64 23.165 27.994999999999997 27.375 21.465 65-69 23.34 27.584999999999997 28.115000000000002 20.96 70-74 23.1 28.055000000000003 27.810000000000002 21.035 75-79 22.915 28.77 27.24 21.075 80-84 22.935 28.515 27.415 21.135 85-89 23.45117255862793 27.996399819990998 27.121356067803394 21.43107155357768 90-94 23.525 28.08 27.43 20.965 95-99 23.244999999999997 28.189999999999998 27.805000000000003 20.76 100-104 23.755000000000003 27.955000000000002 27.305 20.985 105-109 23.115 28.32 27.750000000000004 20.815 110-114 23.36 28.144999999999996 27.46 21.035 115-119 23.491174558727938 28.151407570378517 27.706385319265962 20.651032551627583 120-124 23.78 28.610000000000003 27.310000000000002 20.3 125-129 23.26 28.76 27.08 20.9 130-134 23.23 29.14 26.93 20.7 135-139 24.060000000000002 28.549999999999997 27.284999999999997 20.105 140-144 23.60118005900295 28.521426071303562 27.13635681784089 20.741037051852594 145-149 24.52 28.215 26.779999999999998 20.485 150-151 24.8125 28.487499999999997 26.687499999999996 20.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 1.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 2.5 14 2.5 15 1.0 16 2.0 17 2.5 18 1.5 19 1.5 20 2.5 21 3.0 22 4.5 23 4.0 24 3.5 25 4.0 26 9.5 27 9.5 28 11.0 29 16.5 30 17.5 31 23.5 32 34.5 33 44.0 34 52.5 35 55.0 36 75.0 37 118.0 38 146.5 39 165.0 40 182.0 41 212.5 42 236.0 43 262.0 44 290.5 45 268.5 46 249.0 47 255.5 48 221.5 49 187.0 50 161.0 51 131.5 52 110.5 53 75.5 54 61.5 55 56.5 56 50.0 57 43.5 58 30.0 59 19.5 60 11.0 61 8.0 62 6.5 63 5.0 64 3.0 65 1.0 66 2.5 67 4.0 68 2.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.5 87 1.0 88 2.0 89 2.0 90 1.0 91 0.5 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 1.5 99 1.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53812636165577 84.95 2 6.699346405228758 12.3 3 0.5991285403050108 1.6500000000000001 4 0.08169934640522876 0.3 5 0.0 0.0 6 0.054466230936819175 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027233115468409588 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CTCCAATTCCTCGTGGCCATGGCAGCTCAAGCCTCTCTCTTTACTCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.3875000000000002 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.5999999999999996 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGAA 10 0.006830828 145.0 145 AGGCTCA 10 0.006830828 145.0 6 CAAGGCT 10 0.006830828 145.0 4 ATTCAAG 10 0.006830828 145.0 1 CTCAACG 10 0.006830828 145.0 9 >>END_MODULE Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647920 spots for SRR12671020.sra Written 647920 spots for SRR12671020.sra Read 647934 spots for SRR12671020.sra Written 647934 spots for SRR12671020.sra SRR ids: ['SRR12671020.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_470somg3 SRR12671020.sra spots: 12958414 blocks: [[1, 647920], [647921, 1295840], [1295841, 1943760], [1943761, 2591680], [2591681, 3239600], [3239601, 3887520], [3887521, 4535440], [4535441, 5183360], [5183361, 5831280], [5831281, 6479200], [6479201, 7127120], [7127121, 7775040], [7775041, 8422960], [8422961, 9070880], [9070881, 9718800], [9718801, 10366720], [10366721, 11014640], [11014641, 11662560], [11662561, 12310480], [12310481, 12958414]] SRR12671020 file size 4382135 SRR12671020 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671020 SRR12671020_1.fastq SRR12671020_2.fastq Input file: SRR12671020_1.fastq Paired file: SRR12671020_2.fastq trimmed: SRR12671020-trimmed-pair1.fastq, SRR12671020-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:24:40 2025 >> started Tue Feb 11 13:25:03 2025 >> done (22.277s) 12958414 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 4788 ( 0.04%) empty read pairs filtered out after trimming by size control 12953549 (99.96%) read pairs available; of these: 591261 ( 4.56%) trimmed read pairs available after processing 12362288 (95.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 10 0.00% 21 25 0.00% 22 9 0.00% 23 17 0.00% 24 17 0.00% 25 9 0.00% 26 17 0.00% 27 17 0.00% 28 24 0.00% 29 22 0.00% 30 16 0.00% 31 18 0.00% 32 20 0.00% 33 17 0.00% 34 17 0.00% 35 14 0.00% 36 13 0.00% 37 25 0.00% 38 15 0.00% 39 14 0.00% 40 21 0.00% 41 9 0.00% 42 24 0.00% 43 20 0.00% 44 25 0.00% 45 20 0.00% 46 15 0.00% 47 25 0.00% 48 12 0.00% 49 24 0.00% 50 32 0.00% 51 26 0.00% 52 33 0.00% 53 32 0.00% 54 34 0.00% 55 36 0.00% 56 42 0.00% 57 35 0.00% 58 46 0.00% 59 58 0.00% 60 53 0.00% 61 62 0.00% 62 87 0.00% 63 90 0.00% 64 99 0.00% 65 105 0.00% 66 134 0.00% 67 137 0.00% 68 136 0.00% 69 176 0.00% 70 204 0.00% 71 224 0.00% 72 234 0.00% 73 289 0.00% 74 303 0.00% 75 351 0.00% 76 360 0.00% 77 365 0.00% 78 425 0.00% 79 525 0.00% 80 573 0.00% 81 665 0.01% 82 703 0.01% 83 785 0.01% 84 873 0.01% 85 960 0.01% 86 1059 0.01% 87 1167 0.01% 88 1258 0.01% 89 1323 0.01% 90 1510 0.01% 91 1612 0.01% 92 1759 0.01% 93 2019 0.02% 94 2260 0.02% 95 2369 0.02% 96 2463 0.02% 97 2700 0.02% 98 2742 0.02% 99 2967 0.02% 100 3190 0.02% 101 3309 0.03% 102 3698 0.03% 103 3780 0.03% 104 4019 0.03% 105 4291 0.03% 106 4580 0.04% 107 4657 0.04% 108 4955 0.04% 109 5120 0.04% 110 5252 0.04% 111 5697 0.04% 112 6008 0.05% 113 6182 0.05% 114 6464 0.05% 115 6928 0.05% 116 7095 0.05% 117 7381 0.06% 118 7730 0.06% 119 8016 0.06% 120 8862 0.07% 121 8503 0.07% 122 9194 0.07% 123 9502 0.07% 124 9995 0.08% 125 10016 0.08% 126 10806 0.08% 127 11048 0.09% 128 11429 0.09% 129 11667 0.09% 130 12056 0.09% 131 12367 0.10% 132 12780 0.10% 133 13271 0.10% 134 13406 0.10% 135 14076 0.11% 136 14592 0.11% 137 14928 0.12% 138 15231 0.12% 139 16202 0.13% 140 16463 0.13% 141 16793 0.13% 142 17253 0.13% 143 17593 0.14% 144 18088 0.14% 145 18761 0.14% 146 18997 0.15% 147 19728 0.15% 148 20452 0.16% 149 20289 0.16% 150 21523 0.17% 151 12362288 95.44% 12953549 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=59.11 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.9 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=23 prefix-density=0.90 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=18.35 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATA SRR12671020 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:25:52 Started mapping on | Feb 11 13:25:52 Finished on | Feb 11 13:29:05 Mapping speed, Million of reads per hour | 241.62 Number of input reads | 12953549 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11897752 Uniquely mapped reads % | 91.85% Average mapped length | 298.52 Number of splices: Total | 12128165 Number of splices: Annotated (sjdb) | 11878527 Number of splices: GT/AG | 11888660 Number of splices: GC/AG | 200349 Number of splices: AT/AC | 6803 Number of splices: Non-canonical | 32353 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306099 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 116710 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.58% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 749698 749698 749698 N_multimapping 306099 306099 306099 N_noFeature 488883 11727175 528858 N_ambiguous 206339 593 75548 UnstrandedReadsAssigned:11202530 PositiveStrandReadsAssigned:169984 NegativeStrandReadsAssigned:11293346 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671020 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671020-trimmed-pair1.fastq SRR12671020-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,953,549 reads, 11,447,296 reads pseudoaligned [quant] estimated average fragment length: 299.488 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12671020.ke.tsv 34699 SRR12671020.se.tsv 87100 total ==> SRR12671020.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.51 301 12.7897 Potri.005G024800.1.v4.1 1035 736.512 172 17.0627 Potri.004G059700.1.v4.1 961 662.903 2 0.220434 Potri.007G009000.2.v4.1 1416 1117.51 0 0 Potri.003G141000.2.v4.1 2943 2644.51 735.075 20.3088 Potri.016G087400.1.v4.1 270 71.8133 441 448.674 Potri.015G069301.1.v4.1 564 290.477 0 0 Potri.010G195200.1.v4.1 1773 1474.51 23 1.13967 Potri.012G127500.1.v4.1 977 678.685 114 12.2725 ==> SRR12671020.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 185 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 81 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671020 completed mapping pipeline successfully