Starting /dee2/code/volunteer_pipeline.sh SRR12671021 current disk space = 3050378412032 free memory = 1481087756 SRR12671021 SRAfilesize 41ac76b59b2c53b62bd7709e0e81f8ad SRR12671021.sra SRR12671021.sra file validated SRR12671021 is paired end SRR12671021 is conventional basespace SRR12671021 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671021_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3825 37.0 37.0 37.0 37.0 37.0 2 36.3525 37.0 37.0 37.0 37.0 37.0 3 36.4985 37.0 37.0 37.0 37.0 37.0 4 36.557 37.0 37.0 37.0 37.0 37.0 5 36.4795 37.0 37.0 37.0 37.0 37.0 6 36.6905 37.0 37.0 37.0 37.0 37.0 7 36.544 37.0 37.0 37.0 37.0 37.0 8 36.6145 37.0 37.0 37.0 37.0 37.0 9 36.6465 37.0 37.0 37.0 37.0 37.0 10-14 36.6451 37.0 37.0 37.0 37.0 37.0 15-19 36.581399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5689 37.0 37.0 37.0 37.0 37.0 25-29 36.564 37.0 37.0 37.0 37.0 37.0 30-34 36.466 37.0 37.0 37.0 37.0 37.0 35-39 36.479600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4619 37.0 37.0 37.0 37.0 37.0 45-49 36.4437 37.0 37.0 37.0 37.0 37.0 50-54 36.407599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4062 37.0 37.0 37.0 37.0 37.0 60-64 36.3817 37.0 37.0 37.0 37.0 37.0 65-69 36.3444 37.0 37.0 37.0 37.0 37.0 70-74 36.3645 37.0 37.0 37.0 37.0 37.0 75-79 36.293899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2759 37.0 37.0 37.0 37.0 37.0 85-89 36.2059 37.0 37.0 37.0 37.0 37.0 90-94 36.2406 37.0 37.0 37.0 37.0 37.0 95-99 36.158500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.185199999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1445 37.0 37.0 37.0 37.0 37.0 110-114 36.1068 37.0 37.0 37.0 37.0 37.0 115-119 36.01685 37.0 37.0 37.0 37.0 37.0 120-124 35.9562 37.0 37.0 37.0 37.0 37.0 125-129 35.9533 37.0 37.0 37.0 37.0 37.0 130-134 35.822 37.0 37.0 37.0 37.0 37.0 135-139 35.8733 37.0 37.0 37.0 37.0 37.0 140-144 35.8541 37.0 37.0 37.0 37.0 37.0 145-149 35.6804 37.0 37.0 37.0 37.0 37.0 150-151 35.6365 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 2.0 25 2.0 26 4.0 27 14.0 28 13.0 29 17.0 30 40.0 31 33.0 32 59.0 33 72.0 34 138.0 35 258.0 36 2694.0 37 650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.57178589294647 10.355177588794398 5.327663831915959 40.745372686343174 2 18.375 11.3 38.45 31.874999999999996 3 17.05 14.575 28.975 39.4 4 22.375 21.85 26.3 29.475 5 25.7 28.975 24.3 21.025 6 20.349999999999998 32.5 24.75 22.400000000000002 7 15.950000000000001 26.0 40.9 17.150000000000002 8 15.9 24.425 34.5 25.174999999999997 9 17.275 23.45 36.05 23.225 10-14 19.155 29.630000000000003 28.435 22.78 15-19 19.869999999999997 28.005000000000003 28.544999999999998 23.580000000000002 20-24 19.13 28.12 28.22 24.529999999999998 25-29 18.94 28.325 28.335 24.4 30-34 19.509999999999998 28.51 27.529999999999998 24.45 35-39 19.89 27.88 28.32 23.91 40-44 19.67 28.655 27.785 23.89 45-49 19.99 27.955000000000002 28.09 23.965 50-54 20.005 28.095 27.794999999999998 24.104999999999997 55-59 19.62 28.84 28.08 23.46 60-64 20.13 28.515 27.675 23.68 65-69 19.86 27.900000000000002 28.09 24.15 70-74 20.200000000000003 28.355000000000004 28.115000000000002 23.330000000000002 75-79 20.119999999999997 27.49 28.54 23.849999999999998 80-84 19.675 28.075 28.17 24.08 85-89 20.41 28.675 27.735 23.18 90-94 19.985 28.59 27.925 23.5 95-99 20.119999999999997 27.815 28.494999999999997 23.57 100-104 20.535 27.76 28.199999999999996 23.505000000000003 105-109 20.330000000000002 28.360000000000003 27.985 23.325000000000003 110-114 19.785 28.084999999999997 28.115000000000002 24.015 115-119 20.48602430121506 28.086404320216012 28.106405320266013 23.321166058302914 120-124 19.93 28.155 28.065 23.849999999999998 125-129 20.195 28.705000000000002 27.57 23.53 130-134 19.955000000000002 28.799999999999997 27.555000000000003 23.69 135-139 20.72 27.815 28.285 23.18 140-144 20.375 27.450000000000003 28.04 24.135 145-149 20.392039203920394 28.84788478847885 27.39273927392739 23.367336733673366 150-151 19.725 28.9375 27.4125 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 1.5 23 3.0 24 1.5 25 0.5 26 5.0 27 10.5 28 12.5 29 15.5 30 18.0 31 24.5 32 29.5 33 39.0 34 55.5 35 68.5 36 79.0 37 99.5 38 128.5 39 149.0 40 178.5 41 231.5 42 245.0 43 251.0 44 266.5 45 265.5 46 261.0 47 247.5 48 240.5 49 222.5 50 179.0 51 141.5 52 120.5 53 102.0 54 82.5 55 62.5 56 46.5 57 32.0 58 23.0 59 16.0 60 13.0 61 6.5 62 3.0 63 2.0 64 1.0 65 1.5 66 2.5 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.34845132743364 81.675 2 8.738938053097344 15.8 3 0.8573008849557522 2.325 4 0.05530973451327434 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.2999999999999998 0.0 0.0 0.0 0.0 128-129 1.4249999999999998 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.75 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGTTA 10 0.006830828 145.0 4 AAGTTAC 10 0.006830828 145.0 5 >>END_MODULE SRR12671021 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671021_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1975 37.0 37.0 37.0 37.0 37.0 2 36.1355 37.0 37.0 37.0 37.0 37.0 3 36.3315 37.0 37.0 37.0 37.0 37.0 4 36.313 37.0 37.0 37.0 37.0 37.0 5 36.3705 37.0 37.0 37.0 37.0 37.0 6 36.345 37.0 37.0 37.0 37.0 37.0 7 36.405 37.0 37.0 37.0 37.0 37.0 8 36.4755 37.0 37.0 37.0 37.0 37.0 9 36.322 37.0 37.0 37.0 37.0 37.0 10-14 36.409499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.375099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3794 37.0 37.0 37.0 37.0 37.0 25-29 36.277499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.2687 37.0 37.0 37.0 37.0 37.0 35-39 36.2581 37.0 37.0 37.0 37.0 37.0 40-44 36.2134 37.0 37.0 37.0 37.0 37.0 45-49 36.2257 37.0 37.0 37.0 37.0 37.0 50-54 36.190999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1739 37.0 37.0 37.0 37.0 37.0 60-64 36.1493 37.0 37.0 37.0 37.0 37.0 65-69 36.1558 37.0 37.0 37.0 37.0 37.0 70-74 36.122699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.1186 37.0 37.0 37.0 37.0 37.0 80-84 36.072900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.00045 37.0 37.0 37.0 37.0 37.0 90-94 36.0242 37.0 37.0 37.0 37.0 37.0 95-99 36.0119 37.0 37.0 37.0 37.0 37.0 100-104 35.9957 37.0 37.0 37.0 37.0 37.0 105-109 35.9018 37.0 37.0 37.0 37.0 37.0 110-114 35.912 37.0 37.0 37.0 37.0 37.0 115-119 35.885149999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7706 37.0 37.0 37.0 37.0 37.0 125-129 35.71640000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.7878 37.0 37.0 37.0 37.0 37.0 135-139 35.7406 37.0 37.0 37.0 37.0 37.0 140-144 35.71195 37.0 37.0 37.0 37.0 37.0 145-149 35.5412 37.0 37.0 37.0 37.0 37.0 150-151 35.3095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 0.0 21 3.0 22 2.0 23 4.0 24 4.0 25 10.0 26 5.0 27 21.0 28 14.0 29 19.0 30 26.0 31 44.0 32 50.0 33 82.0 34 147.0 35 406.0 36 2676.0 37 480.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0 23.225 9.6 26.174999999999997 2 25.025 26.05 34.125 14.799999999999999 3 19.85 26.825 34.625 18.7 4 23.05 34.5 24.0 18.45 5 26.200000000000003 36.625 21.5 15.675 6 19.225 40.1 23.05 17.625 7 18.625 23.5 38.65 19.225 8 18.075 26.424999999999997 30.8 24.7 9 21.75 23.425 30.725 24.099999999999998 10-14 22.08 29.645 27.35 20.925 15-19 22.3 27.455000000000002 28.749999999999996 21.495 20-24 22.865 28.43 27.939999999999998 20.765 25-29 22.405 28.435 27.935 21.224999999999998 30-34 22.46 28.18 28.37 20.990000000000002 35-39 22.400000000000002 28.835 27.565 21.2 40-44 22.195 28.475 28.139999999999997 21.19 45-49 22.259999999999998 28.515 27.715 21.51 50-54 22.145 28.915000000000003 27.97 20.97 55-59 22.15 28.315 28.665000000000003 20.87 60-64 22.509999999999998 28.68 28.12 20.69 65-69 22.869999999999997 28.15 27.865000000000002 21.115000000000002 70-74 22.865 28.134999999999998 27.725 21.275 75-79 22.425 28.15 27.810000000000002 21.615000000000002 80-84 22.61 28.765 27.68 20.945 85-89 22.906145307265362 28.15640782039102 27.701385069253465 21.236061803090152 90-94 23.265 28.155 27.839999999999996 20.74 95-99 22.89 29.145 27.51 20.455000000000002 100-104 22.395 28.634999999999998 27.800000000000004 21.17 105-109 22.795 27.834999999999997 28.549999999999997 20.82 110-114 23.22 28.455000000000002 27.71 20.615 115-119 23.476173808690433 28.181409070453523 27.69638481924096 20.64603230161508 120-124 23.580000000000002 28.24 27.560000000000002 20.62 125-129 23.52 28.21 27.415 20.855 130-134 23.715 27.73 27.889999999999997 20.665 135-139 23.415 28.03 27.82 20.735 140-144 23.326166308315415 28.961448072403623 27.35136756837842 20.361018050902548 145-149 23.885 28.325 27.284999999999997 20.505000000000003 150-151 23.7 28.000000000000004 28.037499999999998 20.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 1.0 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 2.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 5.0 25 7.0 26 6.5 27 10.0 28 14.0 29 15.0 30 19.0 31 25.0 32 34.5 33 44.0 34 53.5 35 72.0 36 85.5 37 125.0 38 153.5 39 160.5 40 201.0 41 230.5 42 247.0 43 272.0 44 284.5 45 262.5 46 252.0 47 264.5 48 229.5 49 193.0 50 163.5 51 121.5 52 103.0 53 89.0 54 66.5 55 43.5 56 36.0 57 25.0 58 11.5 59 14.0 60 17.0 61 10.5 62 4.5 63 3.0 64 3.0 65 1.5 66 0.5 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.43261231281198 81.525 2 8.541320022185246 15.4 3 0.8596783139212423 2.325 4 0.13865779256794233 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027731558513588467 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.8250000000000002 0.0 0.0 0.0 0.0 138-139 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTGGG 10 0.006830828 145.0 145 >>END_MODULE Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672927 spots for SRR12671021.sra Written 672927 spots for SRR12671021.sra Read 672946 spots for SRR12671021.sra Written 672946 spots for SRR12671021.sra SRR ids: ['SRR12671021.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gfueh0i6 SRR12671021.sra spots: 13458559 blocks: [[1, 672927], [672928, 1345854], [1345855, 2018781], [2018782, 2691708], [2691709, 3364635], [3364636, 4037562], [4037563, 4710489], [4710490, 5383416], [5383417, 6056343], [6056344, 6729270], [6729271, 7402197], [7402198, 8075124], [8075125, 8748051], [8748052, 9420978], [9420979, 10093905], [10093906, 10766832], [10766833, 11439759], [11439760, 12112686], [12112687, 12785613], [12785614, 13458559]] SRR12671021 file size 4552106 SRR12671021 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671021 SRR12671021_1.fastq SRR12671021_2.fastq Input file: SRR12671021_1.fastq Paired file: SRR12671021_2.fastq trimmed: SRR12671021-trimmed-pair1.fastq, SRR12671021-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:41:09 2025 >> started Tue Feb 11 13:41:25 2025 >> done (15.710s) 13458559 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 3289 ( 0.02%) empty read pairs filtered out after trimming by size control 13455201 (99.98%) read pairs available; of these: 507378 ( 3.77%) trimmed read pairs available after processing 12947823 (96.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 6 0.00% 21 10 0.00% 22 4 0.00% 23 6 0.00% 24 8 0.00% 25 5 0.00% 26 4 0.00% 27 7 0.00% 28 14 0.00% 29 11 0.00% 30 6 0.00% 31 5 0.00% 32 12 0.00% 33 12 0.00% 34 5 0.00% 35 8 0.00% 36 10 0.00% 37 10 0.00% 38 14 0.00% 39 14 0.00% 40 11 0.00% 41 15 0.00% 42 6 0.00% 43 15 0.00% 44 7 0.00% 45 17 0.00% 46 14 0.00% 47 19 0.00% 48 18 0.00% 49 16 0.00% 50 18 0.00% 51 15 0.00% 52 23 0.00% 53 25 0.00% 54 28 0.00% 55 44 0.00% 56 30 0.00% 57 52 0.00% 58 42 0.00% 59 51 0.00% 60 43 0.00% 61 50 0.00% 62 67 0.00% 63 67 0.00% 64 98 0.00% 65 110 0.00% 66 93 0.00% 67 119 0.00% 68 144 0.00% 69 142 0.00% 70 184 0.00% 71 189 0.00% 72 234 0.00% 73 241 0.00% 74 273 0.00% 75 345 0.00% 76 312 0.00% 77 366 0.00% 78 382 0.00% 79 437 0.00% 80 500 0.00% 81 597 0.00% 82 608 0.00% 83 701 0.01% 84 866 0.01% 85 898 0.01% 86 937 0.01% 87 1099 0.01% 88 1163 0.01% 89 1254 0.01% 90 1286 0.01% 91 1505 0.01% 92 1589 0.01% 93 1757 0.01% 94 1965 0.01% 95 2078 0.02% 96 2213 0.02% 97 2282 0.02% 98 2373 0.02% 99 2597 0.02% 100 2825 0.02% 101 3015 0.02% 102 3130 0.02% 103 3383 0.03% 104 3527 0.03% 105 3769 0.03% 106 3911 0.03% 107 4209 0.03% 108 4281 0.03% 109 4495 0.03% 110 4663 0.03% 111 4971 0.04% 112 5159 0.04% 113 5345 0.04% 114 5637 0.04% 115 5785 0.04% 116 6213 0.05% 117 6465 0.05% 118 6583 0.05% 119 6824 0.05% 120 7230 0.05% 121 7607 0.06% 122 7659 0.06% 123 8206 0.06% 124 8401 0.06% 125 8608 0.06% 126 9070 0.07% 127 9235 0.07% 128 9527 0.07% 129 10145 0.08% 130 10240 0.08% 131 10403 0.08% 132 10927 0.08% 133 11147 0.08% 134 11607 0.09% 135 11730 0.09% 136 12233 0.09% 137 12789 0.10% 138 13145 0.10% 139 13573 0.10% 140 14048 0.10% 141 14120 0.10% 142 14890 0.11% 143 14830 0.11% 144 15792 0.12% 145 16074 0.12% 146 16474 0.12% 147 16755 0.12% 148 17622 0.13% 149 17839 0.13% 150 18457 0.14% 151 12947823 96.23% 13455201 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=27 prefix-density=0.51 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=14.52 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.6 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=28 prefix-density=0.66 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=53.06 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAG SRR12671021 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:42:13 Started mapping on | Feb 11 13:42:13 Finished on | Feb 11 13:43:49 Mapping speed, Million of reads per hour | 504.57 Number of input reads | 13455201 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12579068 Uniquely mapped reads % | 93.49% Average mapped length | 298.90 Number of splices: Total | 12839852 Number of splices: Annotated (sjdb) | 12572065 Number of splices: GT/AG | 12584796 Number of splices: GC/AG | 213144 Number of splices: AT/AC | 7263 Number of splices: Non-canonical | 34649 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306909 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 74548 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 569224 569224 569224 N_multimapping 306909 306909 306909 N_noFeature 520084 12421112 567374 N_ambiguous 196606 677 85597 UnstrandedReadsAssigned:11862378 PositiveStrandReadsAssigned:157279 NegativeStrandReadsAssigned:11926097 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671021 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671021-trimmed-pair1.fastq SRR12671021-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,455,201 reads, 11,945,211 reads pseudoaligned [quant] estimated average fragment length: 304.571 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR12671021.ke.tsv 34699 SRR12671021.se.tsv 87100 total ==> SRR12671021.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.43 402 18.3254 Potri.005G024800.1.v4.1 1035 731.429 244 26.0715 Potri.004G059700.1.v4.1 961 657.838 2 0.237607 Potri.007G009000.2.v4.1 1416 1112.43 0 0 Potri.003G141000.2.v4.1 2943 2639.43 681 20.1644 Potri.016G087400.1.v4.1 270 68.5596 519 591.625 Potri.015G069301.1.v4.1 564 284.626 0 0 Potri.010G195200.1.v4.1 1773 1469.43 80 4.2549 Potri.012G127500.1.v4.1 977 673.677 85 9.86086 ==> SRR12671021.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 104 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671021 completed mapping pipeline successfully