Starting /dee2/code/volunteer_pipeline.sh SRR12671022 current disk space = 3050181496832 free memory = 1102828780 SRR12671022 SRAfilesize f49bc552ab024801ee7a54e5ad094d07 SRR12671022.sra SRR12671022.sra file validated SRR12671022 is paired end SRR12671022 is conventional basespace SRR12671022 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671022_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.523 37.0 37.0 37.0 37.0 37.0 2 36.424 37.0 37.0 37.0 37.0 37.0 3 36.5635 37.0 37.0 37.0 37.0 37.0 4 36.658 37.0 37.0 37.0 37.0 37.0 5 36.628 37.0 37.0 37.0 37.0 37.0 6 36.5615 37.0 37.0 37.0 37.0 37.0 7 36.6215 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.631 37.0 37.0 37.0 37.0 37.0 10-14 36.632400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.628499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5684 37.0 37.0 37.0 37.0 37.0 25-29 36.5531 37.0 37.0 37.0 37.0 37.0 30-34 36.4721 37.0 37.0 37.0 37.0 37.0 35-39 36.4808 37.0 37.0 37.0 37.0 37.0 40-44 36.5062 37.0 37.0 37.0 37.0 37.0 45-49 36.457100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4029 37.0 37.0 37.0 37.0 37.0 55-59 36.4018 37.0 37.0 37.0 37.0 37.0 60-64 36.3586 37.0 37.0 37.0 37.0 37.0 65-69 36.382000000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.349000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2929 37.0 37.0 37.0 37.0 37.0 80-84 36.25789999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2435 37.0 37.0 37.0 37.0 37.0 90-94 36.276799999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.1961 37.0 37.0 37.0 37.0 37.0 100-104 36.2191 37.0 37.0 37.0 37.0 37.0 105-109 36.1658 37.0 37.0 37.0 37.0 37.0 110-114 36.16010000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0818 37.0 37.0 37.0 37.0 37.0 120-124 36.0017 37.0 37.0 37.0 37.0 37.0 125-129 35.9444 37.0 37.0 37.0 37.0 37.0 130-134 35.700900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6737 37.0 37.0 37.0 37.0 37.0 140-144 35.586 37.0 37.0 37.0 37.0 37.0 145-149 35.3981 37.0 37.0 37.0 37.0 37.0 150-151 35.21 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 5.0 26 3.0 27 10.0 28 16.0 29 19.0 30 28.0 31 53.0 32 59.0 33 84.0 34 134.0 35 289.0 36 2654.0 37 643.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 10.274999999999999 7.85 41.725 2 19.775000000000002 11.375 36.525 32.324999999999996 3 17.1 16.55 27.200000000000003 39.15 4 22.7 22.95 23.125 31.225 5 24.325 28.775000000000002 24.65 22.25 6 21.775 32.525 23.775 21.925 7 15.9 25.624999999999996 41.325 17.150000000000002 8 18.35 25.025 30.55 26.075 9 17.5 22.55 35.65 24.3 10-14 19.445 29.904999999999998 28.67 21.98 15-19 19.71 27.825 28.575 23.89 20-24 19.919999999999998 27.655 28.084999999999997 24.34 25-29 20.525 28.08 28.165000000000003 23.23 30-34 20.335 27.72 28.305000000000003 23.64 35-39 20.015 28.044999999999998 28.02 23.919999999999998 40-44 20.11 28.395 27.815 23.68 45-49 20.405 28.16 27.33 24.104999999999997 50-54 20.185 28.505000000000003 27.77 23.54 55-59 19.98 28.194999999999997 28.28 23.544999999999998 60-64 19.985 28.044999999999998 27.83 24.14 65-69 20.349999999999998 27.994999999999997 27.46 24.195 70-74 20.52 28.110000000000003 28.07 23.3 75-79 20.18 28.22 28.425 23.175 80-84 19.994999999999997 28.115000000000002 28.050000000000004 23.84 85-89 20.544999999999998 28.59 27.465 23.400000000000002 90-94 20.53 27.92 27.744999999999997 23.805 95-99 19.96 27.825 27.950000000000003 24.265 100-104 20.69 27.925 27.455000000000002 23.93 105-109 20.855 27.54 27.92 23.685000000000002 110-114 21.224999999999998 27.87 26.99 23.915 115-119 21.16 28.599999999999998 27.055 23.185 120-124 20.925 28.599999999999998 26.889999999999997 23.585 125-129 21.085 27.68 27.415 23.82 130-134 21.105 28.599999999999998 26.784999999999997 23.51 135-139 21.385 28.345 26.875 23.395 140-144 21.335 27.689999999999998 27.33 23.645 145-149 20.875 28.535 26.284999999999997 24.305 150-151 21.375 28.1 27.0125 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 1.0 22 0.5 23 1.5 24 4.0 25 5.0 26 5.0 27 10.0 28 12.0 29 10.0 30 15.5 31 22.5 32 26.5 33 34.0 34 42.5 35 62.0 36 86.5 37 118.0 38 128.5 39 137.5 40 174.0 41 201.5 42 240.0 43 262.5 44 272.5 45 268.0 46 261.5 47 257.0 48 240.5 49 217.5 50 176.0 51 146.5 52 123.5 53 101.0 54 79.5 55 53.0 56 37.5 57 37.5 58 35.5 59 29.5 60 20.5 61 11.0 62 6.0 63 3.5 64 3.0 65 3.0 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 1.5 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.18374073056853 83.0 2 7.964844822850865 14.499999999999998 3 0.6591595715462785 1.7999999999999998 4 0.19225487503433122 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.2000000000000002 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.15 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.425 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 4.0625 0.0 0.0 0.0 0.0 116-117 4.5 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.025 0.0 120-121 5.175000000000001 0.0 0.0 0.025 0.0 122-123 5.625 0.0 0.0 0.025 0.0 124-125 6.2 0.0 0.0 0.025 0.0 126-127 6.7375 0.0 0.0 0.025 0.0 128-129 7.3625 0.0 0.0 0.025 0.0 130-131 7.9625 0.0 0.0 0.025 0.0 132-133 8.725000000000001 0.0 0.0 0.025 0.0 134-135 9.45 0.0 0.0 0.025 0.0 136-137 10.125 0.0 0.0 0.025 0.0 138-139 10.95 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671022 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671022_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.143 37.0 37.0 37.0 37.0 37.0 2 36.3925 37.0 37.0 37.0 37.0 37.0 3 36.2925 37.0 37.0 37.0 37.0 37.0 4 36.337 37.0 37.0 37.0 37.0 37.0 5 36.425 37.0 37.0 37.0 37.0 37.0 6 36.441 37.0 37.0 37.0 37.0 37.0 7 36.359 37.0 37.0 37.0 37.0 37.0 8 36.4705 37.0 37.0 37.0 37.0 37.0 9 36.485 37.0 37.0 37.0 37.0 37.0 10-14 36.4615 37.0 37.0 37.0 37.0 37.0 15-19 36.4356 37.0 37.0 37.0 37.0 37.0 20-24 36.45909999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.3557 37.0 37.0 37.0 37.0 37.0 30-34 36.3032 37.0 37.0 37.0 37.0 37.0 35-39 36.312400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2718 37.0 37.0 37.0 37.0 37.0 45-49 36.2456 37.0 37.0 37.0 37.0 37.0 50-54 36.2054 37.0 37.0 37.0 37.0 37.0 55-59 36.1818 37.0 37.0 37.0 37.0 37.0 60-64 36.233 37.0 37.0 37.0 37.0 37.0 65-69 36.162800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1502 37.0 37.0 37.0 37.0 37.0 75-79 36.1235 37.0 37.0 37.0 37.0 37.0 80-84 36.1499 37.0 37.0 37.0 37.0 37.0 85-89 36.0831 37.0 37.0 37.0 37.0 37.0 90-94 36.1091 37.0 37.0 37.0 37.0 37.0 95-99 36.1144 37.0 37.0 37.0 37.0 37.0 100-104 36.0843 37.0 37.0 37.0 37.0 37.0 105-109 36.007099999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.0111 37.0 37.0 37.0 37.0 37.0 115-119 36.0176 37.0 37.0 37.0 37.0 37.0 120-124 35.811899999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.751200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.7482 37.0 37.0 37.0 37.0 37.0 135-139 35.655199999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.6095 37.0 37.0 37.0 37.0 37.0 145-149 35.2976 37.0 37.0 37.0 37.0 37.0 150-151 34.89825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 2.0 22 5.0 23 8.0 24 11.0 25 7.0 26 8.0 27 10.0 28 13.0 29 20.0 30 20.0 31 31.0 32 50.0 33 89.0 34 142.0 35 337.0 36 2603.0 37 632.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 22.2 11.975 25.825 2 27.125 25.95 29.15 17.775 3 21.099999999999998 28.375 30.875000000000004 19.650000000000002 4 24.075 34.8 22.25 18.875 5 25.324999999999996 37.625 20.65 16.400000000000002 6 20.25 39.1 22.5 18.15 7 18.525 22.7 39.425 19.35 8 20.05 26.575 27.525 25.85 9 22.55 24.925 30.125 22.400000000000002 10-14 22.98 29.975 26.25 20.794999999999998 15-19 23.630000000000003 28.785 26.805 20.78 20-24 22.18 29.56 27.16 21.099999999999998 25-29 22.55 28.355000000000004 27.96 21.135 30-34 22.595000000000002 28.71 27.544999999999998 21.15 35-39 23.205000000000002 28.76 27.089999999999996 20.945 40-44 22.36 28.444999999999997 27.894999999999996 21.3 45-49 23.630000000000003 28.255000000000003 27.450000000000003 20.665 50-54 22.66 28.82 27.544999999999998 20.974999999999998 55-59 23.22 28.000000000000004 27.57 21.21 60-64 23.24 27.71 27.865000000000002 21.185000000000002 65-69 22.935 28.305000000000003 27.689999999999998 21.07 70-74 23.07 28.685 27.415 20.830000000000002 75-79 23.715 27.705000000000002 27.175 21.404999999999998 80-84 23.185 27.63 27.944999999999997 21.240000000000002 85-89 23.59 27.905 27.62 20.885 90-94 24.32 27.544999999999998 27.88 20.255000000000003 95-99 23.66 28.335 27.245 20.76 100-104 23.885 27.155 27.644999999999996 21.315 105-109 23.549999999999997 28.765 27.435 20.25 110-114 24.36 28.765 27.029999999999998 19.845 115-119 24.64 28.76 26.900000000000002 19.7 120-124 23.919999999999998 28.815 26.995 20.27 125-129 24.79 27.955000000000002 26.945000000000004 20.31 130-134 25.135 28.144999999999996 27.200000000000003 19.52 135-139 25.855 27.985 26.405 19.755 140-144 26.275 28.29 26.06 19.375 145-149 26.724999999999998 27.93 26.435 18.91 150-151 26.5875 28.037499999999998 25.9625 19.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 1.0 19 3.0 20 3.0 21 2.5 22 3.0 23 2.0 24 3.5 25 5.5 26 5.0 27 5.0 28 5.0 29 11.5 30 20.5 31 19.0 32 24.0 33 35.0 34 47.0 35 68.5 36 85.5 37 115.5 38 145.0 39 161.0 40 192.0 41 219.0 42 259.0 43 262.0 44 256.0 45 285.0 46 278.0 47 232.0 48 205.0 49 195.5 50 163.5 51 144.0 52 124.0 53 89.5 54 73.0 55 54.0 56 43.0 57 39.0 58 19.0 59 14.5 60 17.0 61 15.5 62 12.0 63 6.0 64 1.5 65 1.5 66 2.0 67 1.5 68 1.0 69 2.0 70 2.0 71 1.0 72 1.5 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.425 #Duplication Level Percentage of deduplicated Percentage of total 1 90.98700580591651 82.27499999999999 2 7.851810893005252 14.2 3 0.8570638650815593 2.325 4 0.2211777716339508 0.8 5 0.0552944429084877 0.25 6 0.02764722145424385 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.225 0.0 0.0 0.0 0.0 106-107 2.65 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.825 0.0 0.0 0.0 0.0 114-115 4.15 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.275 0.0 0.0 0.0 0.0 122-123 5.75 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.5125 0.0 0.0 0.0 0.0 130-131 8.0875 0.0 0.0 0.0 0.0 132-133 8.8375 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.225 0.0 0.0 0.0 0.0 138-139 11.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 20 0.00593511 29.0 95-99 >>END_MODULE Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594134 spots for SRR12671022.sra Written 594134 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra Read 594131 spots for SRR12671022.sra Written 594131 spots for SRR12671022.sra SRR ids: ['SRR12671022.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3q0bipis SRR12671022.sra spots: 11882623 blocks: [[1, 594131], [594132, 1188262], [1188263, 1782393], [1782394, 2376524], [2376525, 2970655], [2970656, 3564786], [3564787, 4158917], [4158918, 4753048], [4753049, 5347179], [5347180, 5941310], [5941311, 6535441], [6535442, 7129572], [7129573, 7723703], [7723704, 8317834], [8317835, 8911965], [8911966, 9506096], [9506097, 10100227], [10100228, 10694358], [10694359, 11288489], [11288490, 11882623]] SRR12671022 file size 4016534 SRR12671022 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671022 SRR12671022_1.fastq SRR12671022_2.fastq Input file: SRR12671022_1.fastq Paired file: SRR12671022_2.fastq trimmed: SRR12671022-trimmed-pair1.fastq, SRR12671022-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:05:50 2025 >> started Tue Feb 11 14:06:03 2025 >> done (12.989s) 11882623 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 5703 ( 0.05%) empty read pairs filtered out after trimming by size control 11876870 (99.95%) read pairs available; of these: 1751631 (14.75%) trimmed read pairs available after processing 10125239 (85.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 3 0.00% 27 8 0.00% 28 4 0.00% 29 3 0.00% 30 5 0.00% 31 3 0.00% 32 7 0.00% 33 6 0.00% 34 8 0.00% 35 12 0.00% 36 14 0.00% 37 9 0.00% 38 16 0.00% 39 21 0.00% 40 16 0.00% 41 20 0.00% 42 16 0.00% 43 21 0.00% 44 19 0.00% 45 29 0.00% 46 26 0.00% 47 30 0.00% 48 50 0.00% 49 53 0.00% 50 64 0.00% 51 66 0.00% 52 78 0.00% 53 106 0.00% 54 86 0.00% 55 94 0.00% 56 108 0.00% 57 136 0.00% 58 168 0.00% 59 187 0.00% 60 275 0.00% 61 294 0.00% 62 352 0.00% 63 362 0.00% 64 411 0.00% 65 428 0.00% 66 492 0.00% 67 578 0.00% 68 693 0.01% 69 822 0.01% 70 916 0.01% 71 1053 0.01% 72 1199 0.01% 73 1446 0.01% 74 1550 0.01% 75 1718 0.01% 76 1952 0.02% 77 2212 0.02% 78 2471 0.02% 79 2641 0.02% 80 2996 0.03% 81 3495 0.03% 82 3912 0.03% 83 4327 0.04% 84 4933 0.04% 85 5312 0.04% 86 5833 0.05% 87 6084 0.05% 88 6704 0.06% 89 7135 0.06% 90 7579 0.06% 91 8368 0.07% 92 8827 0.07% 93 9597 0.08% 94 10491 0.09% 95 11208 0.09% 96 11732 0.10% 97 12423 0.10% 98 12904 0.11% 99 13460 0.11% 100 14355 0.12% 101 14741 0.12% 102 15669 0.13% 103 16451 0.14% 104 17392 0.15% 105 17972 0.15% 106 18506 0.16% 107 19287 0.16% 108 19772 0.17% 109 20387 0.17% 110 20827 0.18% 111 21715 0.18% 112 22643 0.19% 113 23050 0.19% 114 24151 0.20% 115 24989 0.21% 116 25818 0.22% 117 26512 0.22% 118 27265 0.23% 119 27688 0.23% 120 28163 0.24% 121 29246 0.25% 122 29877 0.25% 123 30501 0.26% 124 31222 0.26% 125 31895 0.27% 126 32978 0.28% 127 33611 0.28% 128 34072 0.29% 129 34444 0.29% 130 35230 0.30% 131 35067 0.30% 132 35845 0.30% 133 36020 0.30% 134 36501 0.31% 135 37490 0.32% 136 38050 0.32% 137 38238 0.32% 138 38960 0.33% 139 40032 0.34% 140 39924 0.34% 141 40582 0.34% 142 41058 0.35% 143 41168 0.35% 144 41973 0.35% 145 42108 0.35% 146 42657 0.36% 147 43361 0.37% 148 43656 0.37% 149 43266 0.36% 150 44538 0.37% 151 10125239 85.25% 11876870 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.43 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=473.30 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=28 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=71.58 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=9.6 sequence=AAAAGAAAAGAAAA SRR12671022 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:06:46 Started mapping on | Feb 11 14:06:46 Finished on | Feb 11 14:08:01 Mapping speed, Million of reads per hour | 570.09 Number of input reads | 11876870 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11216519 Uniquely mapped reads % | 94.44% Average mapped length | 293.07 Number of splices: Total | 11084598 Number of splices: Annotated (sjdb) | 10854718 Number of splices: GT/AG | 10867623 Number of splices: GC/AG | 177768 Number of splices: AT/AC | 6616 Number of splices: Non-canonical | 32591 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267078 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 35271 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 393273 393273 393273 N_multimapping 267078 267078 267078 N_noFeature 441656 11060712 498791 N_ambiguous 164546 759 65423 UnstrandedReadsAssigned:10610317 PositiveStrandReadsAssigned:155048 NegativeStrandReadsAssigned:10652305 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671022 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671022-trimmed-pair1.fastq SRR12671022-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,876,870 reads, 10,664,778 reads pseudoaligned [quant] estimated average fragment length: 246.234 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 972 rounds 52401 SRR12671022.ke.tsv 34699 SRR12671022.se.tsv 87100 total ==> SRR12671022.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.77 396 19.5511 Potri.005G024800.1.v4.1 1035 789.766 187 20.7238 Potri.004G059700.1.v4.1 961 715.963 1 0.122246 Potri.007G009000.2.v4.1 1416 1170.77 0 0 Potri.003G141000.2.v4.1 2943 2697.77 650.483 21.1037 Potri.016G087400.1.v4.1 270 92.8652 487 458.989 Potri.015G069301.1.v4.1 564 333.173 0 0 Potri.010G195200.1.v4.1 1773 1527.77 89 5.0987 Potri.012G127500.1.v4.1 977 731.876 59 7.05572 ==> SRR12671022.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 142 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671022 completed mapping pipeline successfully