Starting /dee2/code/volunteer_pipeline.sh SRR12671024 current disk space = 3050196287488 free memory = 1456676844 SRR12671024 SRAfilesize 2f022fcf52cd2b2b4bc916d5c92bdd0c SRR12671024.sra SRR12671024.sra file validated SRR12671024 is paired end SRR12671024 is conventional basespace SRR12671024 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671024_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.345 37.0 37.0 37.0 37.0 37.0 2 36.3305 37.0 37.0 37.0 37.0 37.0 3 36.495 37.0 37.0 37.0 37.0 37.0 4 36.6575 37.0 37.0 37.0 37.0 37.0 5 36.6455 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.5505 37.0 37.0 37.0 37.0 37.0 8 36.574 37.0 37.0 37.0 37.0 37.0 9 36.5695 37.0 37.0 37.0 37.0 37.0 10-14 36.5974 37.0 37.0 37.0 37.0 37.0 15-19 36.588800000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.579 37.0 37.0 37.0 37.0 37.0 25-29 36.5395 37.0 37.0 37.0 37.0 37.0 30-34 36.499199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.476200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4927 37.0 37.0 37.0 37.0 37.0 45-49 36.400400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.434799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3941 37.0 37.0 37.0 37.0 37.0 60-64 36.4041 37.0 37.0 37.0 37.0 37.0 65-69 36.3603 37.0 37.0 37.0 37.0 37.0 70-74 36.3548 37.0 37.0 37.0 37.0 37.0 75-79 36.3141 37.0 37.0 37.0 37.0 37.0 80-84 36.2647 37.0 37.0 37.0 37.0 37.0 85-89 36.2714 37.0 37.0 37.0 37.0 37.0 90-94 36.2251 37.0 37.0 37.0 37.0 37.0 95-99 36.1779 37.0 37.0 37.0 37.0 37.0 100-104 36.2028 37.0 37.0 37.0 37.0 37.0 105-109 36.141 37.0 37.0 37.0 37.0 37.0 110-114 36.1525 37.0 37.0 37.0 37.0 37.0 115-119 36.0862 37.0 37.0 37.0 37.0 37.0 120-124 36.0519 37.0 37.0 37.0 37.0 37.0 125-129 36.0322 37.0 37.0 37.0 37.0 37.0 130-134 35.8555 37.0 37.0 37.0 37.0 37.0 135-139 35.8783 37.0 37.0 37.0 37.0 37.0 140-144 35.8284 37.0 37.0 37.0 37.0 37.0 145-149 35.72675 37.0 37.0 37.0 37.0 37.0 150-151 35.59525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 3.0 25 5.0 26 3.0 27 9.0 28 17.0 29 17.0 30 34.0 31 35.0 32 58.0 33 91.0 34 121.0 35 255.0 36 2654.0 37 696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.948974487243625 12.106053026513257 4.552276138069034 35.392696348174084 2 19.025 11.25 37.45 32.275 3 16.475 16.375 29.599999999999998 37.55 4 22.625 23.275000000000002 23.325000000000003 30.775000000000002 5 24.5 30.625000000000004 23.775 21.099999999999998 6 20.05 33.5 23.674999999999997 22.775000000000002 7 15.375 26.674999999999997 41.05 16.900000000000002 8 15.9 25.95 34.75 23.400000000000002 9 16.575 23.775 36.175000000000004 23.474999999999998 10-14 19.21 30.11 28.115000000000002 22.564999999999998 15-19 19.545 28.24 28.005000000000003 24.21 20-24 20.64 27.72 27.689999999999998 23.95 25-29 19.825 28.799999999999997 27.224999999999998 24.15 30-34 19.705000000000002 28.365000000000002 27.51 24.42 35-39 20.330000000000002 28.515 27.345000000000002 23.810000000000002 40-44 20.14 28.235 27.584999999999997 24.04 45-49 19.98 28.675 27.634999999999998 23.71 50-54 20.05 28.565 28.000000000000004 23.385 55-59 19.86 27.715 28.52 23.905 60-64 20.080000000000002 28.88 27.534999999999997 23.505000000000003 65-69 20.355 28.395 27.82 23.43 70-74 20.580000000000002 27.605 27.935 23.880000000000003 75-79 19.735 28.74 27.68 23.845 80-84 20.119999999999997 28.38 27.445000000000004 24.055 85-89 20.285 28.955 27.115000000000002 23.645 90-94 20.244999999999997 28.794999999999998 27.145000000000003 23.815 95-99 20.255000000000003 28.384999999999998 27.925 23.435 100-104 20.64 28.63 27.415 23.315 105-109 20.26 28.249999999999996 27.544999999999998 23.945 110-114 20.535 28.03 27.33 24.104999999999997 115-119 20.875 27.71 27.805000000000003 23.61 120-124 21.245 27.894999999999996 26.950000000000003 23.91 125-129 20.645 28.144999999999996 27.565 23.645 130-134 20.84 28.64 27.250000000000004 23.27 135-139 21.044999999999998 28.410000000000004 26.985 23.56 140-144 21.145 27.58 27.425 23.849999999999998 145-149 21.14317147572136 28.049207381107166 27.36910536580487 23.438515777366607 150-151 20.875 27.537499999999998 26.924999999999997 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 1.5 22 2.5 23 3.0 24 2.5 25 3.5 26 4.5 27 7.0 28 10.0 29 21.0 30 25.5 31 25.0 32 35.5 33 51.0 34 63.0 35 70.5 36 95.5 37 112.5 38 128.0 39 151.5 40 164.5 41 200.0 42 224.0 43 231.0 44 242.5 45 251.0 46 248.5 47 238.5 48 237.0 49 209.0 50 173.0 51 153.5 52 128.5 53 114.0 54 91.5 55 70.5 56 63.5 57 40.0 58 26.5 59 22.0 60 15.0 61 11.0 62 8.5 63 5.5 64 3.5 65 2.5 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.54351395730707 83.625 2 7.498631636562671 13.700000000000001 3 0.9031198686371099 2.475 4 0.05473453749315819 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.9125 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGTTC 10 0.006830828 145.0 3 >>END_MODULE SRR12671024 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671024_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2935 37.0 37.0 37.0 37.0 37.0 2 36.094 37.0 37.0 37.0 37.0 37.0 3 36.225 37.0 37.0 37.0 37.0 37.0 4 36.271 37.0 37.0 37.0 37.0 37.0 5 36.3965 37.0 37.0 37.0 37.0 37.0 6 36.3295 37.0 37.0 37.0 37.0 37.0 7 36.356 37.0 37.0 37.0 37.0 37.0 8 36.4025 37.0 37.0 37.0 37.0 37.0 9 36.334 37.0 37.0 37.0 37.0 37.0 10-14 36.33579999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.393600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.355999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.243300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.271499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1991 37.0 37.0 37.0 37.0 37.0 40-44 36.189099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2186 37.0 37.0 37.0 37.0 37.0 50-54 36.1696 37.0 37.0 37.0 37.0 37.0 55-59 36.113 37.0 37.0 37.0 37.0 37.0 60-64 36.0817 37.0 37.0 37.0 37.0 37.0 65-69 36.141600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.108799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0612 37.0 37.0 37.0 37.0 37.0 80-84 36.035199999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9951 37.0 37.0 37.0 37.0 37.0 90-94 36.0096 37.0 37.0 37.0 37.0 37.0 95-99 35.9798 37.0 37.0 37.0 37.0 37.0 100-104 35.971199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.85289999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.913799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.82770000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7531 37.0 37.0 37.0 37.0 37.0 125-129 35.7147 37.0 37.0 37.0 37.0 37.0 130-134 35.6723 37.0 37.0 37.0 37.0 37.0 135-139 35.6304 37.0 37.0 37.0 37.0 37.0 140-144 35.5324 37.0 37.0 37.0 37.0 37.0 145-149 35.2796 37.0 37.0 37.0 34.6 37.0 150-151 35.034 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 2.0 16 2.0 17 1.0 18 1.0 19 1.0 20 1.0 21 3.0 22 3.0 23 7.0 24 6.0 25 3.0 26 10.0 27 12.0 28 17.0 29 16.0 30 26.0 31 41.0 32 51.0 33 90.0 34 174.0 35 398.0 36 2681.0 37 447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.025000000000006 27.200000000000003 7.575 22.2 2 28.95 24.85 31.4 14.799999999999999 3 19.45 26.85 34.150000000000006 19.55 4 24.0 34.025 24.474999999999998 17.5 5 25.624999999999996 36.85 21.45 16.075 6 19.875 39.425 22.575 18.125 7 21.275 23.425 36.775000000000006 18.525 8 19.325 26.3 29.075 25.3 9 20.225 25.674999999999997 31.424999999999997 22.675 10-14 22.845 28.865000000000002 27.42 20.87 15-19 23.13 28.444999999999997 27.805000000000003 20.62 20-24 23.150000000000002 28.610000000000003 27.345000000000002 20.895 25-29 22.935 28.46 27.79 20.815 30-34 23.375 27.500000000000004 28.465 20.66 35-39 22.41 28.549999999999997 28.095 20.945 40-44 23.48 27.894999999999996 27.839999999999996 20.785 45-49 22.965 27.97 28.275 20.79 50-54 22.98 28.09 27.500000000000004 21.43 55-59 23.425 27.455000000000002 28.005000000000003 21.115000000000002 60-64 23.150000000000002 27.46 28.13 21.26 65-69 22.770000000000003 28.265 27.825 21.14 70-74 23.61 27.950000000000003 26.974999999999998 21.465 75-79 23.565 27.36 27.845 21.23 80-84 23.57 27.765 27.36 21.305 85-89 23.14 27.675 27.384999999999998 21.8 90-94 23.77 27.395000000000003 27.82 21.015 95-99 22.98 28.17 27.105 21.745 100-104 24.044999999999998 27.860000000000003 27.32 20.775 105-109 23.685000000000002 28.32 27.415 20.580000000000002 110-114 24.04 28.294999999999998 27.250000000000004 20.415 115-119 23.78237823782378 28.582858285828582 27.2977297729773 20.337033703370334 120-124 24.03 27.63 27.595 20.745 125-129 24.3 28.105000000000004 27.139999999999997 20.455000000000002 130-134 24.445 27.51 27.735 20.31 135-139 24.16 26.724999999999998 28.4 20.715 140-144 24.352435243524354 27.27272727272727 27.912791279127912 20.462046204620464 145-149 25.235000000000003 27.589999999999996 26.72 20.455000000000002 150-151 25.7 27.775 27.3125 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.5 20 1.5 21 0.5 22 2.0 23 2.5 24 3.0 25 3.0 26 4.5 27 8.5 28 13.5 29 15.0 30 17.0 31 24.5 32 29.0 33 42.0 34 51.0 35 64.0 36 95.5 37 121.5 38 140.5 39 163.5 40 191.5 41 214.0 42 230.5 43 248.0 44 262.0 45 254.5 46 246.5 47 247.5 48 233.5 49 206.0 50 166.0 51 148.5 52 128.0 53 94.0 54 75.0 55 60.0 56 49.5 57 36.0 58 25.0 59 18.0 60 12.0 61 8.5 62 6.0 63 3.0 64 4.0 65 2.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.39547710976282 82.85 2 7.501378929950358 13.600000000000001 3 0.882515168229454 2.4 4 0.13789299503585217 0.5 5 0.0 0.0 6 0.0 0.0 7 0.05515719801434087 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.027578599007170437 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.4000000000000004 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGGT 10 0.006830828 145.0 2 >>END_MODULE Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736753 spots for SRR12671024.sra Written 736753 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra Read 736743 spots for SRR12671024.sra Written 736743 spots for SRR12671024.sra SRR ids: ['SRR12671024.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g8qe00b0 SRR12671024.sra spots: 14734870 blocks: [[1, 736743], [736744, 1473486], [1473487, 2210229], [2210230, 2946972], [2946973, 3683715], [3683716, 4420458], [4420459, 5157201], [5157202, 5893944], [5893945, 6630687], [6630688, 7367430], [7367431, 8104173], [8104174, 8840916], [8840917, 9577659], [9577660, 10314402], [10314403, 11051145], [11051146, 11787888], [11787889, 12524631], [12524632, 13261374], [13261375, 13998117], [13998118, 14734870]] SRR12671024 file size 4985853 SRR12671024 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671024 SRR12671024_1.fastq SRR12671024_2.fastq Input file: SRR12671024_1.fastq Paired file: SRR12671024_2.fastq trimmed: SRR12671024-trimmed-pair1.fastq, SRR12671024-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:05:53 2025 >> started Tue Feb 11 14:06:09 2025 >> done (16.091s) 14734870 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 3718 ( 0.03%) empty read pairs filtered out after trimming by size control 14731070 (99.97%) read pairs available; of these: 962568 ( 6.53%) trimmed read pairs available after processing 13768502 (93.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 13 0.00% 20 12 0.00% 21 11 0.00% 22 16 0.00% 23 14 0.00% 24 10 0.00% 25 14 0.00% 26 16 0.00% 27 20 0.00% 28 15 0.00% 29 15 0.00% 30 33 0.00% 31 17 0.00% 32 26 0.00% 33 20 0.00% 34 20 0.00% 35 21 0.00% 36 24 0.00% 37 30 0.00% 38 26 0.00% 39 23 0.00% 40 24 0.00% 41 33 0.00% 42 32 0.00% 43 28 0.00% 44 41 0.00% 45 20 0.00% 46 36 0.00% 47 47 0.00% 48 33 0.00% 49 50 0.00% 50 56 0.00% 51 54 0.00% 52 72 0.00% 53 79 0.00% 54 72 0.00% 55 87 0.00% 56 100 0.00% 57 110 0.00% 58 122 0.00% 59 139 0.00% 60 166 0.00% 61 196 0.00% 62 253 0.00% 63 294 0.00% 64 291 0.00% 65 316 0.00% 66 357 0.00% 67 365 0.00% 68 470 0.00% 69 539 0.00% 70 581 0.00% 71 694 0.00% 72 749 0.01% 73 864 0.01% 74 1010 0.01% 75 1002 0.01% 76 1165 0.01% 77 1230 0.01% 78 1405 0.01% 79 1425 0.01% 80 1668 0.01% 81 1952 0.01% 82 2134 0.01% 83 2294 0.02% 84 2551 0.02% 85 2854 0.02% 86 3004 0.02% 87 3170 0.02% 88 3439 0.02% 89 3498 0.02% 90 3780 0.03% 91 4032 0.03% 92 4349 0.03% 93 4537 0.03% 94 4911 0.03% 95 5196 0.04% 96 5579 0.04% 97 5864 0.04% 98 5992 0.04% 99 6478 0.04% 100 6728 0.05% 101 6718 0.05% 102 7066 0.05% 103 7432 0.05% 104 7906 0.05% 105 8316 0.06% 106 8748 0.06% 107 8919 0.06% 108 9381 0.06% 109 9536 0.06% 110 9672 0.07% 111 10115 0.07% 112 10507 0.07% 113 10936 0.07% 114 11314 0.08% 115 11745 0.08% 116 12239 0.08% 117 12656 0.09% 118 13121 0.09% 119 13448 0.09% 120 13879 0.09% 121 14220 0.10% 122 14634 0.10% 123 15276 0.10% 124 15875 0.11% 125 16188 0.11% 126 16895 0.11% 127 17350 0.12% 128 17789 0.12% 129 18163 0.12% 130 19226 0.13% 131 18946 0.13% 132 19770 0.13% 133 20379 0.14% 134 21011 0.14% 135 21352 0.14% 136 21567 0.15% 137 22253 0.15% 138 23117 0.16% 139 24357 0.17% 140 24247 0.16% 141 24795 0.17% 142 25644 0.17% 143 26177 0.18% 144 27186 0.18% 145 27058 0.18% 146 27495 0.19% 147 28273 0.19% 148 29559 0.20% 149 29535 0.20% 150 31559 0.21% 151 13768502 93.47% 14731070 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=508.95 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=0.63 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=39.09 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=13.4 sequence=AAAGAAAAGAAAA SRR12671024 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:06:56 Started mapping on | Feb 11 14:06:56 Finished on | Feb 11 14:08:50 Mapping speed, Million of reads per hour | 465.19 Number of input reads | 14731070 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13767351 Uniquely mapped reads % | 93.46% Average mapped length | 297.40 Number of splices: Total | 13784231 Number of splices: Annotated (sjdb) | 13496603 Number of splices: GT/AG | 13518452 Number of splices: GC/AG | 216311 Number of splices: AT/AC | 9252 Number of splices: Non-canonical | 40216 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357883 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 53324 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605836 605836 605836 N_multimapping 357883 357883 357883 N_noFeature 555004 13530859 625456 N_ambiguous 252752 1021 86177 UnstrandedReadsAssigned:12959595 PositiveStrandReadsAssigned:235471 NegativeStrandReadsAssigned:13055718 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671024 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671024-trimmed-pair1.fastq SRR12671024-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,731,070 reads, 13,013,524 reads pseudoaligned [quant] estimated average fragment length: 274.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12671024.ke.tsv 34699 SRR12671024.se.tsv 87100 total ==> SRR12671024.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.75 683 23.7804 Potri.005G024800.1.v4.1 1035 761.75 496 39.5549 Potri.004G059700.1.v4.1 961 687.994 3 0.264891 Potri.007G009000.2.v4.1 1416 1142.75 0 0 Potri.003G141000.2.v4.1 2943 2669.75 620 14.1076 Potri.016G087400.1.v4.1 270 75.6968 752.697 604.052 Potri.015G069301.1.v4.1 564 305.37 0 0 Potri.010G195200.1.v4.1 1773 1499.75 281 11.382 Potri.012G127500.1.v4.1 977 703.907 232 20.0218 ==> SRR12671024.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 164 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 250 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671024 completed mapping pipeline successfully