Starting /dee2/code/volunteer_pipeline.sh SRR12671025 current disk space = 3050060124160 free memory = 1469945632 SRR12671025 SRAfilesize c7368e136e74ec47079b9b4bf7a58816 SRR12671025.sra SRR12671025.sra file validated SRR12671025 is paired end SRR12671025 is conventional basespace SRR12671025 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671025_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32475 37.0 37.0 37.0 37.0 37.0 2 36.4105 37.0 37.0 37.0 37.0 37.0 3 36.5085 37.0 37.0 37.0 37.0 37.0 4 36.6225 37.0 37.0 37.0 37.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 36.62 37.0 37.0 37.0 37.0 37.0 7 36.514 37.0 37.0 37.0 37.0 37.0 8 36.5435 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.6479 37.0 37.0 37.0 37.0 37.0 15-19 36.5571 37.0 37.0 37.0 37.0 37.0 20-24 36.503499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.51950000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4729 37.0 37.0 37.0 37.0 37.0 35-39 36.425599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4642 37.0 37.0 37.0 37.0 37.0 45-49 36.3862 37.0 37.0 37.0 37.0 37.0 50-54 36.3788 37.0 37.0 37.0 37.0 37.0 55-59 36.38009999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3555 37.0 37.0 37.0 37.0 37.0 65-69 36.292 37.0 37.0 37.0 37.0 37.0 70-74 36.3281 37.0 37.0 37.0 37.0 37.0 75-79 36.239700000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.21169999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2408 37.0 37.0 37.0 37.0 37.0 90-94 36.20219999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1435 37.0 37.0 37.0 37.0 37.0 100-104 36.173899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.076 37.0 37.0 37.0 37.0 37.0 110-114 36.1002 37.0 37.0 37.0 37.0 37.0 115-119 36.059900000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.005700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9791 37.0 37.0 37.0 37.0 37.0 130-134 35.86469999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9269 37.0 37.0 37.0 37.0 37.0 140-144 35.871300000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.692499999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.56525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 4.0 23 1.0 24 6.0 25 4.0 26 3.0 27 13.0 28 17.0 29 17.0 30 29.0 31 40.0 32 49.0 33 91.0 34 122.0 35 239.0 36 2731.0 37 632.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.435858964741186 10.077519379844961 6.476619154788697 40.010002500625156 2 19.125 10.725 38.05 32.1 3 16.7 16.625 27.800000000000004 38.875 4 22.35 23.974999999999998 23.575 30.099999999999998 5 23.849999999999998 31.924999999999997 23.9 20.325 6 20.8 33.45 22.925 22.825 7 14.05 25.924999999999997 42.65 17.375 8 15.475 25.825 33.95 24.75 9 16.3 23.7 35.35 24.65 10-14 19.005 29.759999999999998 28.68 22.555 15-19 19.805 28.494999999999997 27.834999999999997 23.865 20-24 19.89 28.54 27.985 23.585 25-29 19.725 28.050000000000004 28.444999999999997 23.78 30-34 19.53 29.04 27.634999999999998 23.794999999999998 35-39 19.495 28.48 27.48 24.545 40-44 20.11 28.7 27.495000000000005 23.695 45-49 19.265 28.705000000000002 27.689999999999998 24.34 50-54 19.6 28.49 28.18 23.73 55-59 19.634999999999998 28.044999999999998 28.42 23.9 60-64 20.119999999999997 27.925 27.965 23.990000000000002 65-69 19.865 28.810000000000002 28.29 23.035 70-74 19.79 28.03 28.410000000000004 23.77 75-79 19.869999999999997 28.055000000000003 28.055000000000003 24.02 80-84 20.405 28.035 27.894999999999996 23.665 85-89 19.835 28.884999999999998 27.250000000000004 24.03 90-94 19.935 29.134999999999998 27.365000000000002 23.565 95-99 20.135 28.249999999999996 27.855 23.76 100-104 20.06 28.735 27.62 23.585 105-109 20.119999999999997 28.189999999999998 27.925 23.765 110-114 20.119999999999997 28.189999999999998 27.634999999999998 24.055 115-119 20.755000000000003 28.249999999999996 27.46 23.535 120-124 20.415 28.360000000000003 27.98 23.244999999999997 125-129 20.169999999999998 27.595 28.21 24.025 130-134 20.369999999999997 28.625 27.71 23.294999999999998 135-139 20.424999999999997 28.310000000000002 27.575 23.69 140-144 20.015 28.044999999999998 27.72 24.22 145-149 20.22202220222022 28.852885288528853 27.782778277827784 23.142314231423143 150-151 20.837500000000002 28.549999999999997 27.525 23.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 2.5 23 5.0 24 6.5 25 5.0 26 6.0 27 10.5 28 12.5 29 14.0 30 20.0 31 26.0 32 44.0 33 52.5 34 42.0 35 62.0 36 96.5 37 116.0 38 125.5 39 142.0 40 175.5 41 206.0 42 239.0 43 264.0 44 271.0 45 245.5 46 247.5 47 243.0 48 226.5 49 227.0 50 189.0 51 142.0 52 107.0 53 95.5 54 74.5 55 55.5 56 49.5 57 34.0 58 23.0 59 22.5 60 19.0 61 13.0 62 7.0 63 4.5 64 5.0 65 4.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 89.96952064283735 81.175 2 9.282349681352176 16.75 3 0.6927126627874758 1.875 4 0.05541701302299806 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.4875 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.7375 0.0 0.0 0.0 0.0 138-139 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCAAC 10 0.006830828 145.0 1 AACTTCT 10 0.006830828 145.0 5 TTTAGTT 10 0.006830828 145.0 7 TCTTTAA 10 0.006830828 145.0 9 >>END_MODULE SRR12671025 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671025_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.177 37.0 37.0 37.0 37.0 37.0 2 36.252 37.0 37.0 37.0 37.0 37.0 3 36.344 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.259 37.0 37.0 37.0 37.0 37.0 6 36.3985 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.489 37.0 37.0 37.0 37.0 37.0 9 36.396 37.0 37.0 37.0 37.0 37.0 10-14 36.39 37.0 37.0 37.0 37.0 37.0 15-19 36.4 37.0 37.0 37.0 37.0 37.0 20-24 36.4091 37.0 37.0 37.0 37.0 37.0 25-29 36.3035 37.0 37.0 37.0 37.0 37.0 30-34 36.290099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.281400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.2547 37.0 37.0 37.0 37.0 37.0 45-49 36.2624 37.0 37.0 37.0 37.0 37.0 50-54 36.233900000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.2297 37.0 37.0 37.0 37.0 37.0 60-64 36.179899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1971 37.0 37.0 37.0 37.0 37.0 70-74 36.1206 37.0 37.0 37.0 37.0 37.0 75-79 36.0689 37.0 37.0 37.0 37.0 37.0 80-84 36.1224 37.0 37.0 37.0 37.0 37.0 85-89 36.002700000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0961 37.0 37.0 37.0 37.0 37.0 95-99 36.008799999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.0341 37.0 37.0 37.0 37.0 37.0 105-109 35.9523 37.0 37.0 37.0 37.0 37.0 110-114 35.9602 37.0 37.0 37.0 37.0 37.0 115-119 35.91975 37.0 37.0 37.0 37.0 37.0 120-124 35.855900000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.777 37.0 37.0 37.0 37.0 37.0 130-134 35.7577 37.0 37.0 37.0 37.0 37.0 135-139 35.73870000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.67325 37.0 37.0 37.0 37.0 37.0 145-149 35.4777 37.0 37.0 37.0 37.0 37.0 150-151 35.070750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 2.0 16 3.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 8.0 24 4.0 25 7.0 26 10.0 27 9.0 28 18.0 29 20.0 30 19.0 31 27.0 32 54.0 33 75.0 34 178.0 35 357.0 36 2697.0 37 502.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 22.175 11.3 23.775 2 28.475 23.599999999999998 31.674999999999997 16.25 3 20.7 27.250000000000004 33.300000000000004 18.75 4 24.5 33.725 23.849999999999998 17.925 5 24.625 38.7 21.25 15.425 6 19.375 38.925 23.1 18.6 7 19.650000000000002 22.400000000000002 38.45 19.5 8 21.099999999999998 25.124999999999996 29.675 24.099999999999998 9 20.925 24.55 30.725 23.799999999999997 10-14 22.495 29.555 27.08 20.87 15-19 23.005 28.575 27.77 20.65 20-24 22.685 29.220000000000002 27.700000000000003 20.395 25-29 22.735 28.01 28.16 21.095 30-34 22.525000000000002 28.194999999999997 27.915 21.365000000000002 35-39 22.425 28.605000000000004 27.655 21.315 40-44 22.689999999999998 28.494999999999997 27.889999999999997 20.925 45-49 22.8 28.694999999999997 27.685 20.82 50-54 22.64 29.01 27.915 20.435 55-59 22.925 27.650000000000002 28.22 21.205 60-64 22.955000000000002 27.825 27.85 21.37 65-69 23.145 28.215 27.67 20.97 70-74 23.48 28.565 27.42 20.535 75-79 22.835 28.235 27.735 21.195 80-84 23.044999999999998 28.09 27.815 21.05 85-89 23.355 28.249999999999996 27.655 20.74 90-94 23.555 27.975 27.605 20.865000000000002 95-99 22.655 27.935 28.01 21.4 100-104 23.630000000000003 27.925 28.189999999999998 20.255000000000003 105-109 23.615 28.265 26.99 21.13 110-114 22.89 28.265 28.139999999999997 20.705000000000002 115-119 23.67118355917796 28.601430071503575 27.336366818340917 20.39101955097755 120-124 23.925 28.205000000000002 26.97 20.9 125-129 23.445 27.99 27.944999999999997 20.62 130-134 23.400000000000002 28.28 27.450000000000003 20.87 135-139 23.9 27.805000000000003 27.815 20.48 140-144 23.241162058102905 28.266413320666032 27.816390819540977 20.676033801690085 145-149 24.135 28.335 27.284999999999997 20.244999999999997 150-151 25.374999999999996 27.1625 27.5625 19.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 1.0 24 2.0 25 5.5 26 7.5 27 10.0 28 16.5 29 18.0 30 19.0 31 27.0 32 33.5 33 37.0 34 56.0 35 84.5 36 93.5 37 105.0 38 124.5 39 156.5 40 206.5 41 235.0 42 263.5 43 273.5 44 269.5 45 279.0 46 271.5 47 251.0 48 204.0 49 172.5 50 153.0 51 124.5 52 113.0 53 89.5 54 68.5 55 50.0 56 26.0 57 18.5 58 25.5 59 24.0 60 19.5 61 15.0 62 8.5 63 8.5 64 5.5 65 4.0 66 3.5 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 89.99721370855391 80.75 2 8.999721370855392 16.150000000000002 3 0.8080245193647256 2.175 4 0.16717748676511562 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02786291446085261 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAACA 10 0.006830828 145.0 2 TATATAT 10 0.006830828 145.0 145 CTAAGCT 10 0.006830828 145.0 2 CTTGCCT 10 0.006830828 145.0 7 TTGCCTC 10 0.006830828 145.0 8 GACTAAC 10 0.006830828 145.0 1 >>END_MODULE Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621267 spots for SRR12671025.sra Written 621267 spots for SRR12671025.sra Read 621284 spots for SRR12671025.sra Written 621284 spots for SRR12671025.sra SRR ids: ['SRR12671025.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_plro3kov SRR12671025.sra spots: 12425357 blocks: [[1, 621267], [621268, 1242534], [1242535, 1863801], [1863802, 2485068], [2485069, 3106335], [3106336, 3727602], [3727603, 4348869], [4348870, 4970136], [4970137, 5591403], [5591404, 6212670], [6212671, 6833937], [6833938, 7455204], [7455205, 8076471], [8076472, 8697738], [8697739, 9319005], [9319006, 9940272], [9940273, 10561539], [10561540, 11182806], [11182807, 11804073], [11804074, 12425357]] SRR12671025 file size 4200979 SRR12671025 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671025 SRR12671025_1.fastq SRR12671025_2.fastq Input file: SRR12671025_1.fastq Paired file: SRR12671025_2.fastq trimmed: SRR12671025-trimmed-pair1.fastq, SRR12671025-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:12:46 2025 >> started Tue Feb 11 14:13:06 2025 >> done (20.770s) 12425357 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 2775 ( 0.02%) empty read pairs filtered out after trimming by size control 12422507 (99.98%) read pairs available; of these: 618359 ( 4.98%) trimmed read pairs available after processing 11804148 (95.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 5 0.00% 21 3 0.00% 22 14 0.00% 23 10 0.00% 24 5 0.00% 25 12 0.00% 26 10 0.00% 27 9 0.00% 28 14 0.00% 29 9 0.00% 30 15 0.00% 31 11 0.00% 32 4 0.00% 33 6 0.00% 34 9 0.00% 35 8 0.00% 36 6 0.00% 37 12 0.00% 38 22 0.00% 39 14 0.00% 40 15 0.00% 41 26 0.00% 42 14 0.00% 43 11 0.00% 44 16 0.00% 45 20 0.00% 46 24 0.00% 47 15 0.00% 48 22 0.00% 49 20 0.00% 50 25 0.00% 51 37 0.00% 52 29 0.00% 53 44 0.00% 54 30 0.00% 55 34 0.00% 56 46 0.00% 57 50 0.00% 58 62 0.00% 59 75 0.00% 60 86 0.00% 61 87 0.00% 62 126 0.00% 63 92 0.00% 64 132 0.00% 65 124 0.00% 66 132 0.00% 67 190 0.00% 68 173 0.00% 69 208 0.00% 70 258 0.00% 71 295 0.00% 72 319 0.00% 73 340 0.00% 74 418 0.00% 75 450 0.00% 76 503 0.00% 77 548 0.00% 78 663 0.01% 79 710 0.01% 80 750 0.01% 81 912 0.01% 82 1004 0.01% 83 1109 0.01% 84 1254 0.01% 85 1326 0.01% 86 1419 0.01% 87 1563 0.01% 88 1733 0.01% 89 1796 0.01% 90 2003 0.02% 91 2089 0.02% 92 2159 0.02% 93 2529 0.02% 94 2653 0.02% 95 2836 0.02% 96 3029 0.02% 97 3299 0.03% 98 3528 0.03% 99 3537 0.03% 100 3749 0.03% 101 4018 0.03% 102 4320 0.03% 103 4599 0.04% 104 4848 0.04% 105 4957 0.04% 106 5184 0.04% 107 5384 0.04% 108 5558 0.04% 109 5869 0.05% 110 5936 0.05% 111 6318 0.05% 112 6478 0.05% 113 7111 0.06% 114 7241 0.06% 115 7474 0.06% 116 7622 0.06% 117 8112 0.07% 118 8457 0.07% 119 8636 0.07% 120 8905 0.07% 121 9357 0.08% 122 9542 0.08% 123 10021 0.08% 124 10437 0.08% 125 10821 0.09% 126 11052 0.09% 127 11380 0.09% 128 11536 0.09% 129 11965 0.10% 130 12275 0.10% 131 12609 0.10% 132 13069 0.11% 133 13669 0.11% 134 13456 0.11% 135 14271 0.11% 136 14803 0.12% 137 15088 0.12% 138 15460 0.12% 139 15988 0.13% 140 16040 0.13% 141 16873 0.14% 142 17304 0.14% 143 17465 0.14% 144 18031 0.15% 145 18384 0.15% 146 18815 0.15% 147 19501 0.16% 148 20072 0.16% 149 20099 0.16% 150 20990 0.17% 151 11804148 95.02% 12422507 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=23.90 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=71.87 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.7 sequence=AGAAAAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCA SRR12671025 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:14:25 Started mapping on | Feb 11 14:14:26 Finished on | Feb 11 14:16:31 Mapping speed, Million of reads per hour | 357.77 Number of input reads | 12422507 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11033110 Uniquely mapped reads % | 88.82% Average mapped length | 294.93 Number of splices: Total | 11240938 Number of splices: Annotated (sjdb) | 10983529 Number of splices: GT/AG | 11026104 Number of splices: GC/AG | 173270 Number of splices: AT/AC | 7268 Number of splices: Non-canonical | 34296 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291627 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 102660 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.77% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1097770 1097770 1097770 N_multimapping 291627 291627 291627 N_noFeature 458189 10857116 509414 N_ambiguous 209961 1040 84638 UnstrandedReadsAssigned:10364960 PositiveStrandReadsAssigned:174954 NegativeStrandReadsAssigned:10439058 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671025 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671025-trimmed-pair1.fastq SRR12671025-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,422,507 reads, 10,837,377 reads pseudoaligned [quant] estimated average fragment length: 286.789 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR12671025.ke.tsv 34699 SRR12671025.se.tsv 87100 total ==> SRR12671025.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.21 474.549 22.0898 Potri.005G024800.1.v4.1 1035 749.211 225 24.2153 Potri.004G059700.1.v4.1 961 675.526 3 0.358088 Potri.007G009000.2.v4.1 1416 1130.21 0 0 Potri.003G141000.2.v4.1 2943 2657.21 885 26.8552 Potri.016G087400.1.v4.1 270 73.7412 546 597.026 Potri.015G069301.1.v4.1 564 297.049 0 0 Potri.010G195200.1.v4.1 1773 1487.21 154 8.34947 Potri.012G127500.1.v4.1 977 691.383 68 7.9305 ==> SRR12671025.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 178 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 139 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671025 completed mapping pipeline successfully