Starting /dee2/code/volunteer_pipeline.sh SRR12671026 current disk space = 3050178199552 free memory = 1470895740 SRR12671026 SRAfilesize 967468b3b1081f73e53c03c94f7c234d SRR12671026.sra SRR12671026.sra file validated SRR12671026 is paired end SRR12671026 is conventional basespace SRR12671026 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671026_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45475 37.0 37.0 37.0 37.0 37.0 2 36.4325 37.0 37.0 37.0 37.0 37.0 3 36.5385 37.0 37.0 37.0 37.0 37.0 4 36.545 37.0 37.0 37.0 37.0 37.0 5 36.5595 37.0 37.0 37.0 37.0 37.0 6 36.687 37.0 37.0 37.0 37.0 37.0 7 36.517 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.635 37.0 37.0 37.0 37.0 37.0 10-14 36.5714 37.0 37.0 37.0 37.0 37.0 15-19 36.614 37.0 37.0 37.0 37.0 37.0 20-24 36.5399 37.0 37.0 37.0 37.0 37.0 25-29 36.522800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4581 37.0 37.0 37.0 37.0 37.0 35-39 36.4268 37.0 37.0 37.0 37.0 37.0 40-44 36.44449999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3321 37.0 37.0 37.0 37.0 37.0 50-54 36.3566 37.0 37.0 37.0 37.0 37.0 55-59 36.3284 37.0 37.0 37.0 37.0 37.0 60-64 36.3136 37.0 37.0 37.0 37.0 37.0 65-69 36.273399999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2453 37.0 37.0 37.0 37.0 37.0 75-79 36.235699999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.193 37.0 37.0 37.0 37.0 37.0 85-89 36.2124 37.0 37.0 37.0 37.0 37.0 90-94 36.123000000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1211 37.0 37.0 37.0 37.0 37.0 100-104 36.108799999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.0769 37.0 37.0 37.0 37.0 37.0 110-114 36.029199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0196 37.0 37.0 37.0 37.0 37.0 120-124 35.9621 37.0 37.0 37.0 37.0 37.0 125-129 35.9031 37.0 37.0 37.0 37.0 37.0 130-134 35.771 37.0 37.0 37.0 37.0 37.0 135-139 35.817 37.0 37.0 37.0 37.0 37.0 140-144 35.7586 37.0 37.0 37.0 37.0 37.0 145-149 35.673 37.0 37.0 37.0 37.0 37.0 150-151 35.477999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 3.0 22 4.0 23 6.0 24 2.0 25 5.0 26 9.0 27 14.0 28 17.0 29 17.0 30 36.0 31 46.0 32 59.0 33 70.0 34 112.0 35 230.0 36 2686.0 37 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.685671417854465 13.253313328332084 7.101775443860965 36.959239809952486 2 20.925 12.5 34.625 31.95 3 16.3 14.825 28.15 40.725 4 22.35 20.1 25.2 32.35 5 24.7 28.875 23.5 22.925 6 21.05 33.025 22.7 23.225 7 15.375 29.099999999999998 39.25 16.275000000000002 8 15.225 27.625 34.300000000000004 22.85 9 16.775000000000002 25.674999999999997 35.025 22.525000000000002 10-14 19.25 30.375000000000004 28.74 21.634999999999998 15-19 19.7 29.080000000000002 27.950000000000003 23.27 20-24 20.125 29.475 27.229999999999997 23.169999999999998 25-29 19.895 29.189999999999998 28.1 22.814999999999998 30-34 20.465 28.910000000000004 27.450000000000003 23.175 35-39 20.195 29.189999999999998 27.62 22.994999999999997 40-44 19.5 29.195 27.875 23.43 45-49 20.115 29.25 27.500000000000004 23.135 50-54 20.244999999999997 28.53 27.29 23.935000000000002 55-59 20.085 28.815 27.894999999999996 23.205000000000002 60-64 19.97 28.660000000000004 27.450000000000003 23.919999999999998 65-69 19.96 28.89 27.400000000000002 23.75 70-74 20.61 29.494999999999997 27.27 22.625 75-79 20.77 28.310000000000002 27.445000000000004 23.474999999999998 80-84 20.485 28.42 27.634999999999998 23.46 85-89 20.945 28.970000000000002 26.845000000000002 23.24 90-94 20.535 28.975 26.825 23.665 95-99 20.424999999999997 28.585 27.435 23.555 100-104 20.86 29.23 26.58 23.330000000000002 105-109 20.46 29.175 26.790000000000003 23.575 110-114 20.905 28.335 26.545 24.215 115-119 20.830000000000002 28.625 26.784999999999997 23.76 120-124 20.285 28.92 27.0 23.794999999999998 125-129 20.724999999999998 28.744999999999997 26.415 24.115000000000002 130-134 20.380000000000003 28.355000000000004 26.87 24.395 135-139 20.880000000000003 27.48 27.029999999999998 24.610000000000003 140-144 21.32 28.29 26.834999999999997 23.555 145-149 21.435000000000002 28.410000000000004 26.534999999999997 23.62 150-151 20.724999999999998 27.737499999999997 27.224999999999998 24.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.5 22 3.0 23 2.5 24 2.5 25 4.5 26 9.0 27 11.0 28 11.5 29 11.5 30 16.5 31 29.5 32 45.0 33 61.0 34 76.5 35 91.5 36 101.5 37 118.5 38 144.0 39 152.5 40 164.0 41 177.5 42 219.5 43 240.5 44 219.5 45 242.5 46 247.0 47 241.5 48 228.5 49 209.5 50 187.0 51 144.5 52 126.0 53 108.0 54 82.0 55 66.0 56 53.5 57 35.0 58 25.0 59 23.5 60 15.0 61 9.0 62 8.0 63 5.0 64 2.5 65 3.0 66 4.0 67 3.5 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 90.98653476229734 82.775 2 8.216543006320418 14.95 3 0.7144820005496015 1.95 4 0.05496015388843088 0.2 5 0.02748007694421544 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGTTACATCTCGTAT 5 0.125 TruSeq Adapter, Index 10 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.375 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTAT 10 0.006830828 145.0 1 CGCTGCT 10 0.006830828 145.0 3 ATGGAGC 10 0.006830828 145.0 8 >>END_MODULE SRR12671026 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671026_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.331 37.0 37.0 37.0 37.0 37.0 2 36.4045 37.0 37.0 37.0 37.0 37.0 3 36.3635 37.0 37.0 37.0 37.0 37.0 4 36.46 37.0 37.0 37.0 37.0 37.0 5 36.575 37.0 37.0 37.0 37.0 37.0 6 36.536 37.0 37.0 37.0 37.0 37.0 7 36.461 37.0 37.0 37.0 37.0 37.0 8 36.525 37.0 37.0 37.0 37.0 37.0 9 36.569 37.0 37.0 37.0 37.0 37.0 10-14 36.4906 37.0 37.0 37.0 37.0 37.0 15-19 36.456 37.0 37.0 37.0 37.0 37.0 20-24 36.4365 37.0 37.0 37.0 37.0 37.0 25-29 36.3722 37.0 37.0 37.0 37.0 37.0 30-34 36.3294 37.0 37.0 37.0 37.0 37.0 35-39 36.337399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.296499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3239 37.0 37.0 37.0 37.0 37.0 50-54 36.229200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.225 37.0 37.0 37.0 37.0 37.0 60-64 36.236999999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2927 37.0 37.0 37.0 37.0 37.0 70-74 36.2099 37.0 37.0 37.0 37.0 37.0 75-79 36.2004 37.0 37.0 37.0 37.0 37.0 80-84 36.175599999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1199 37.0 37.0 37.0 37.0 37.0 90-94 36.168099999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1773 37.0 37.0 37.0 37.0 37.0 100-104 36.13289999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.0342 37.0 37.0 37.0 37.0 37.0 110-114 36.063900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.032399999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.02720000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.89020000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.9119 37.0 37.0 37.0 37.0 37.0 135-139 35.8087 37.0 37.0 37.0 37.0 37.0 140-144 35.7935 37.0 37.0 37.0 37.0 37.0 145-149 35.5687 37.0 37.0 37.0 37.0 37.0 150-151 35.31375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 3.0 16 4.0 17 2.0 18 2.0 19 3.0 20 1.0 21 1.0 22 1.0 23 2.0 24 6.0 25 8.0 26 9.0 27 11.0 28 16.0 29 16.0 30 18.0 31 30.0 32 46.0 33 54.0 34 117.0 35 276.0 36 2657.0 37 709.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 26.525 9.825000000000001 24.85 2 30.175 26.174999999999997 27.474999999999998 16.175 3 22.225 28.199999999999996 31.4 18.175 4 24.8 33.125 23.200000000000003 18.875 5 27.800000000000004 36.725 20.325 15.15 6 21.925 39.725 20.925 17.424999999999997 7 20.1 24.3 37.974999999999994 17.625 8 21.675 25.95 28.199999999999996 24.175 9 22.225 23.75 31.374999999999996 22.650000000000002 10-14 24.490000000000002 28.999999999999996 25.895000000000003 20.615 15-19 24.195 27.935 26.87 21.0 20-24 24.38 28.215 26.779999999999998 20.625 25-29 24.51 27.73 27.474999999999998 20.285 30-34 24.09 28.01 27.22 20.68 35-39 24.02 27.67 27.544999999999998 20.765 40-44 23.775 27.595 27.74 20.89 45-49 23.905 27.47 28.055000000000003 20.57 50-54 24.04 27.52 27.37 21.07 55-59 24.14 27.800000000000004 27.55 20.51 60-64 23.915 27.615000000000002 27.735 20.735 65-69 24.315 26.745 27.575 21.365000000000002 70-74 24.33 27.455000000000002 27.965 20.25 75-79 23.575 27.3 28.035 21.09 80-84 23.74 27.634999999999998 27.22 21.404999999999998 85-89 23.345 28.225 27.18 21.25 90-94 23.745 27.97 27.534999999999997 20.75 95-99 23.84 28.235 27.435 20.49 100-104 23.565 28.395 27.35 20.69 105-109 24.3 27.58 27.42 20.7 110-114 23.89 27.505000000000003 28.17 20.435 115-119 24.315 27.47 27.675 20.54 120-124 25.245 27.935 26.85 19.97 125-129 24.29 28.000000000000004 26.924999999999997 20.785 130-134 24.37 27.750000000000004 27.560000000000002 20.32 135-139 23.880000000000003 28.15 27.650000000000002 20.32 140-144 25.0 27.725 27.860000000000003 19.415 145-149 25.385 27.62 26.884999999999998 20.11 150-151 25.4625 27.35 27.487499999999997 19.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 2.0 25 2.5 26 3.0 27 7.5 28 7.5 29 5.0 30 10.0 31 16.5 32 30.5 33 47.0 34 55.5 35 68.0 36 89.0 37 100.0 38 106.5 39 138.5 40 189.0 41 213.5 42 216.5 43 235.5 44 264.5 45 271.5 46 261.5 47 245.0 48 227.0 49 214.5 50 195.5 51 156.0 52 125.5 53 115.0 54 88.5 55 63.5 56 50.0 57 38.0 58 24.5 59 19.0 60 18.0 61 12.0 62 11.0 63 9.0 64 3.5 65 2.5 66 3.0 67 2.0 68 1.5 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.5 99 1.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.12213950923629 82.625 2 7.995588640749932 14.499999999999998 3 0.6892748828232699 1.875 4 0.11028398125172319 0.4 5 0.027570995312930797 0.125 6 0.0 0.0 7 0.027570995312930797 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027570995312930797 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0125 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0125 0.0 0.0 0.025 0.0 64-65 0.037500000000000006 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.1125 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.15 0.0 0.0 0.025 0.0 86-87 0.225 0.0 0.0 0.025 0.0 88-89 0.3 0.0 0.0 0.025 0.0 90-91 0.35 0.0 0.0 0.025 0.0 92-93 0.4375 0.0 0.0 0.025 0.0 94-95 0.625 0.0 0.0 0.025 0.0 96-97 0.7250000000000001 0.0 0.0 0.025 0.0 98-99 0.975 0.0 0.0 0.025 0.0 100-101 1.1 0.0 0.0 0.025 0.0 102-103 1.3624999999999998 0.0 0.0 0.025 0.0 104-105 1.5375 0.0 0.0 0.025 0.0 106-107 1.7125 0.0 0.0 0.025 0.0 108-109 1.875 0.0 0.0 0.025 0.0 110-111 2.0125 0.0 0.0 0.025 0.0 112-113 2.2875 0.0 0.0 0.025 0.0 114-115 2.4000000000000004 0.0 0.0 0.025 0.0 116-117 2.7 0.0 0.0 0.025 0.0 118-119 2.95 0.0 0.0 0.025 0.0 120-121 3.2750000000000004 0.0 0.0 0.025 0.0 122-123 3.5375 0.0 0.0 0.025 0.0 124-125 3.7875 0.0 0.0 0.025 0.0 126-127 4.1375 0.0 0.0 0.025 0.0 128-129 4.35 0.0 0.0 0.025 0.0 130-131 4.512499999999999 0.0 0.0 0.025 0.0 132-133 4.762499999999999 0.0 0.0 0.025 0.0 134-135 5.0625 0.0 0.0 0.025 0.0 136-137 5.5 0.0 0.0 0.025 0.0 138-139 6.050000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 50-54 >>END_MODULE Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra Read 619550 spots for SRR12671026.sra Written 619550 spots for SRR12671026.sra Read 619544 spots for SRR12671026.sra Written 619544 spots for SRR12671026.sra SRR ids: ['SRR12671026.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_wuefm2 SRR12671026.sra spots: 12390886 blocks: [[1, 619544], [619545, 1239088], [1239089, 1858632], [1858633, 2478176], [2478177, 3097720], [3097721, 3717264], [3717265, 4336808], [4336809, 4956352], [4956353, 5575896], [5575897, 6195440], [6195441, 6814984], [6814985, 7434528], [7434529, 8054072], [8054073, 8673616], [8673617, 9293160], [9293161, 9912704], [9912705, 10532248], [10532249, 11151792], [11151793, 11771336], [11771337, 12390886]] SRR12671026 file size 4189264 SRR12671026 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671026 SRR12671026_1.fastq SRR12671026_2.fastq Input file: SRR12671026_1.fastq Paired file: SRR12671026_2.fastq trimmed: SRR12671026-trimmed-pair1.fastq, SRR12671026-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:13:41 2025 >> started Tue Feb 11 14:13:55 2025 >> done (13.908s) 12390886 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 13767 ( 0.11%) empty read pairs filtered out after trimming by size control 12377083 (99.89%) read pairs available; of these: 1075493 ( 8.69%) trimmed read pairs available after processing 11301590 (91.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 9 0.00% 28 5 0.00% 29 12 0.00% 30 11 0.00% 31 12 0.00% 32 7 0.00% 33 8 0.00% 34 7 0.00% 35 15 0.00% 36 11 0.00% 37 13 0.00% 38 21 0.00% 39 25 0.00% 40 22 0.00% 41 11 0.00% 42 13 0.00% 43 20 0.00% 44 14 0.00% 45 8 0.00% 46 23 0.00% 47 18 0.00% 48 25 0.00% 49 40 0.00% 50 40 0.00% 51 49 0.00% 52 49 0.00% 53 56 0.00% 54 58 0.00% 55 67 0.00% 56 87 0.00% 57 102 0.00% 58 101 0.00% 59 113 0.00% 60 152 0.00% 61 190 0.00% 62 188 0.00% 63 213 0.00% 64 233 0.00% 65 277 0.00% 66 301 0.00% 67 377 0.00% 68 431 0.00% 69 488 0.00% 70 524 0.00% 71 612 0.00% 72 772 0.01% 73 823 0.01% 74 968 0.01% 75 985 0.01% 76 1144 0.01% 77 1262 0.01% 78 1331 0.01% 79 1497 0.01% 80 1632 0.01% 81 1878 0.02% 82 2103 0.02% 83 2291 0.02% 84 2573 0.02% 85 2806 0.02% 86 3048 0.02% 87 3278 0.03% 88 3444 0.03% 89 3696 0.03% 90 4004 0.03% 91 4240 0.03% 92 4599 0.04% 93 4904 0.04% 94 5274 0.04% 95 5744 0.05% 96 6055 0.05% 97 6618 0.05% 98 6629 0.05% 99 7104 0.06% 100 7229 0.06% 101 7610 0.06% 102 8010 0.06% 103 8362 0.07% 104 8772 0.07% 105 9224 0.07% 106 9573 0.08% 107 10283 0.08% 108 10629 0.09% 109 11055 0.09% 110 11188 0.09% 111 11485 0.09% 112 11880 0.10% 113 12071 0.10% 114 13054 0.11% 115 13609 0.11% 116 14132 0.11% 117 14749 0.12% 118 14894 0.12% 119 15412 0.12% 120 16065 0.13% 121 16409 0.13% 122 16895 0.14% 123 17487 0.14% 124 17926 0.14% 125 18238 0.15% 126 19133 0.15% 127 19737 0.16% 128 20328 0.16% 129 20941 0.17% 130 21825 0.18% 131 21540 0.17% 132 22060 0.18% 133 22928 0.19% 134 23357 0.19% 135 23970 0.19% 136 24504 0.20% 137 25261 0.20% 138 26012 0.21% 139 27138 0.22% 140 27348 0.22% 141 28194 0.23% 142 28451 0.23% 143 28924 0.23% 144 29874 0.24% 145 30250 0.24% 146 31009 0.25% 147 31254 0.25% 148 32471 0.26% 149 32589 0.26% 150 34351 0.28% 151 11301590 91.31% 12377083 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.68 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=36.65 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=28 prefix-density=0.60 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=116.74 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.7 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12671026 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:14:41 Started mapping on | Feb 11 14:14:42 Finished on | Feb 11 14:16:38 Mapping speed, Million of reads per hour | 384.12 Number of input reads | 12377083 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11329557 Uniquely mapped reads % | 91.54% Average mapped length | 296.50 Number of splices: Total | 10498616 Number of splices: Annotated (sjdb) | 10295921 Number of splices: GT/AG | 10275117 Number of splices: GC/AG | 186220 Number of splices: AT/AC | 5888 Number of splices: Non-canonical | 31391 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289577 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 113707 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 757949 757949 757949 N_multimapping 289577 289577 289577 N_noFeature 364888 11105802 421584 N_ambiguous 252878 992 85368 UnstrandedReadsAssigned:10711791 PositiveStrandReadsAssigned:222763 NegativeStrandReadsAssigned:10822605 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671026 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671026-trimmed-pair1.fastq SRR12671026-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,377,083 reads, 10,904,088 reads pseudoaligned [quant] estimated average fragment length: 252.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52401 SRR12671026.ke.tsv 34699 SRR12671026.se.tsv 87100 total ==> SRR12671026.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.41 306 12.1805 Potri.005G024800.1.v4.1 1035 783.408 160 14.3604 Potri.004G059700.1.v4.1 961 709.469 25 2.47766 Potri.007G009000.2.v4.1 1416 1164.41 0 0 Potri.003G141000.2.v4.1 2943 2691.41 297 7.75912 Potri.016G087400.1.v4.1 270 78.8906 433 385.921 Potri.015G069301.1.v4.1 564 320.441 0 0 Potri.010G195200.1.v4.1 1773 1521.41 19 0.878099 Potri.012G127500.1.v4.1 977 725.427 239 23.1654 ==> SRR12671026.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 545 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671026 completed mapping pipeline successfully