Starting /dee2/code/volunteer_pipeline.sh SRR12671027 current disk space = 2823812263936 free memory = 1577338112 SRR12671027 SRAfilesize 0b0c69b0b5a0bd6fe0107c28c435a1dd SRR12671027.sra SRR12671027.sra file validated SRR12671027 is paired end SRR12671027 is conventional basespace SRR12671027 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671027_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.5445 37.0 37.0 37.0 37.0 37.0 3 36.527 37.0 37.0 37.0 37.0 37.0 4 36.628 37.0 37.0 37.0 37.0 37.0 5 36.647 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.569 37.0 37.0 37.0 37.0 37.0 8 36.575 37.0 37.0 37.0 37.0 37.0 9 36.659 37.0 37.0 37.0 37.0 37.0 10-14 36.5689 37.0 37.0 37.0 37.0 37.0 15-19 36.5022 37.0 37.0 37.0 37.0 37.0 20-24 36.4776 37.0 37.0 37.0 37.0 37.0 25-29 36.4079 37.0 37.0 37.0 37.0 37.0 30-34 36.368399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.356700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.254200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.169799999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1937 37.0 37.0 37.0 37.0 37.0 55-59 36.1324 37.0 37.0 37.0 37.0 37.0 60-64 36.042500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0332 37.0 37.0 37.0 37.0 37.0 70-74 36.053200000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.055299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0595 37.0 37.0 37.0 37.0 37.0 85-89 35.9922 37.0 37.0 37.0 37.0 37.0 90-94 36.0317 37.0 37.0 37.0 37.0 37.0 95-99 35.9213 37.0 37.0 37.0 37.0 37.0 100-104 35.9436 37.0 37.0 37.0 37.0 37.0 105-109 35.8918 37.0 37.0 37.0 37.0 37.0 110-114 35.9069 37.0 37.0 37.0 37.0 37.0 115-119 35.785199999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7713 37.0 37.0 37.0 37.0 37.0 125-129 35.8099 37.0 37.0 37.0 37.0 37.0 130-134 35.6084 37.0 37.0 37.0 37.0 37.0 135-139 35.738 37.0 37.0 37.0 37.0 37.0 140-144 35.6676 37.0 37.0 37.0 37.0 37.0 145-149 35.5011 37.0 37.0 37.0 37.0 37.0 150-151 35.295500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 2.0 20 2.0 21 9.0 22 7.0 23 7.0 24 7.0 25 9.0 26 13.0 27 7.0 28 29.0 29 24.0 30 45.0 31 39.0 32 67.0 33 90.0 34 118.0 35 221.0 36 2627.0 37 674.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.65 13.4 9.025 35.925000000000004 2 19.15 11.375 39.35 30.125 3 16.2 15.075 30.3 38.425 4 20.3 20.200000000000003 26.525 32.975 5 23.674999999999997 27.150000000000002 27.325 21.85 6 21.275 33.125 23.474999999999998 22.125 7 15.425 29.2 39.35 16.025 8 14.274999999999999 28.599999999999998 34.5 22.625 9 15.575 24.85 37.625 21.95 10-14 18.13 32.185 28.82 20.865000000000002 15-19 18.735 30.049999999999997 28.000000000000004 23.215 20-24 19.470000000000002 29.659999999999997 28.025 22.845 25-29 19.495 30.06 27.765 22.68 30-34 19.0 29.459999999999997 27.845 23.695 35-39 19.035 30.305 27.595 23.064999999999998 40-44 19.509999999999998 29.849999999999998 27.615000000000002 23.025000000000002 45-49 19.965 28.854999999999997 27.375 23.805 50-54 20.075000000000003 29.385 27.325 23.215 55-59 19.54 29.385 27.735 23.34 60-64 19.7 29.5 27.224999999999998 23.575 65-69 19.775000000000002 29.205 27.91 23.11 70-74 20.66 29.770000000000003 26.96 22.61 75-79 19.919999999999998 28.925 27.205000000000002 23.95 80-84 19.595000000000002 28.925 27.529999999999998 23.95 85-89 20.175 29.830000000000002 26.775 23.22 90-94 20.395 28.92 26.950000000000003 23.735 95-99 20.13 28.64 27.685 23.544999999999998 100-104 20.365 29.020000000000003 26.845000000000002 23.77 105-109 20.485 29.165000000000003 27.29 23.06 110-114 20.49 28.804999999999996 26.96 23.745 115-119 20.549999999999997 28.53 27.279999999999998 23.64 120-124 20.64 28.815 26.884999999999998 23.66 125-129 20.02 29.01 27.16 23.810000000000002 130-134 20.560000000000002 28.73 26.779999999999998 23.93 135-139 21.135 28.87 26.009999999999998 23.985 140-144 20.5 29.04 26.615 23.845 145-149 20.335 28.49 27.229999999999997 23.945 150-151 21.05 27.8875 26.5125 24.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 6.5 2 3.5 3 2.5 4 2.5 5 3.5 6 3.0 7 1.5 8 1.5 9 1.0 10 1.0 11 1.5 12 1.0 13 1.0 14 1.0 15 0.5 16 0.5 17 1.0 18 1.5 19 2.0 20 3.5 21 3.5 22 5.5 23 6.0 24 3.5 25 5.5 26 8.0 27 10.5 28 15.0 29 24.5 30 33.5 31 44.5 32 60.5 33 66.5 34 69.5 35 79.5 36 105.0 37 128.5 38 146.0 39 167.5 40 172.5 41 194.0 42 220.0 43 221.0 44 225.0 45 244.0 46 237.0 47 210.0 48 202.0 49 178.0 50 159.5 51 154.5 52 123.0 53 97.5 54 80.5 55 62.5 56 50.0 57 33.5 58 24.0 59 18.5 60 12.5 61 9.5 62 9.0 63 6.5 64 2.5 65 1.0 66 6.5 67 9.0 68 3.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.89955357142857 80.55 2 9.1796875 16.45 3 0.6417410714285714 1.725 4 0.2232142857142857 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027901785714285712 0.2 9 0.0 0.0 >10 0.027901785714285712 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGTTGTATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.362500000000001 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAATG 10 0.006830828 145.0 9 >>END_MODULE SRR12671027 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671027_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3155 37.0 37.0 37.0 37.0 37.0 2 36.318 37.0 37.0 37.0 37.0 37.0 3 36.309 37.0 37.0 37.0 37.0 37.0 4 36.327 37.0 37.0 37.0 37.0 37.0 5 36.4015 37.0 37.0 37.0 37.0 37.0 6 36.41 37.0 37.0 37.0 37.0 37.0 7 36.3815 37.0 37.0 37.0 37.0 37.0 8 36.4685 37.0 37.0 37.0 37.0 37.0 9 36.4435 37.0 37.0 37.0 37.0 37.0 10-14 36.396100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3816 37.0 37.0 37.0 37.0 37.0 20-24 36.3792 37.0 37.0 37.0 37.0 37.0 25-29 36.3304 37.0 37.0 37.0 37.0 37.0 30-34 36.3054 37.0 37.0 37.0 37.0 37.0 35-39 36.275000000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.2804 37.0 37.0 37.0 37.0 37.0 45-49 36.2445 37.0 37.0 37.0 37.0 37.0 50-54 36.218599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.232299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2142 37.0 37.0 37.0 37.0 37.0 65-69 36.1911 37.0 37.0 37.0 37.0 37.0 70-74 36.206 37.0 37.0 37.0 37.0 37.0 75-79 36.0972 37.0 37.0 37.0 37.0 37.0 80-84 36.1257 37.0 37.0 37.0 37.0 37.0 85-89 36.1053 37.0 37.0 37.0 37.0 37.0 90-94 36.1165 37.0 37.0 37.0 37.0 37.0 95-99 36.1312 37.0 37.0 37.0 37.0 37.0 100-104 36.1263 37.0 37.0 37.0 37.0 37.0 105-109 36.081 37.0 37.0 37.0 37.0 37.0 110-114 36.07790000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.062200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.92560000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.851 37.0 37.0 37.0 37.0 37.0 130-134 35.8442 37.0 37.0 37.0 37.0 37.0 135-139 35.8173 37.0 37.0 37.0 37.0 37.0 140-144 35.7225 37.0 37.0 37.0 37.0 37.0 145-149 35.5719 37.0 37.0 37.0 37.0 37.0 150-151 35.266999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 3.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 0.0 20 1.0 21 2.0 22 3.0 23 4.0 24 6.0 25 8.0 26 6.0 27 10.0 28 24.0 29 17.0 30 19.0 31 36.0 32 49.0 33 75.0 34 137.0 35 299.0 36 2659.0 37 632.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.975 26.400000000000002 8.975 25.650000000000002 2 29.425 25.575 30.125 14.875 3 20.75 27.700000000000003 34.5 17.05 4 25.55 32.35 23.575 18.525 5 27.425 37.775 19.425 15.375 6 22.650000000000002 39.15 19.75 18.45 7 20.849999999999998 24.7 36.225 18.224999999999998 8 21.475 25.7 27.900000000000002 24.925 9 22.3 23.7 30.3 23.7 10-14 24.48 28.804999999999996 26.305 20.41 15-19 24.610000000000003 28.46 26.765 20.165 20-24 24.345 29.020000000000003 26.52 20.115 25-29 23.974999999999998 28.095 27.51 20.419999999999998 30-34 24.01 27.26 27.834999999999997 20.895 35-39 24.46 28.09 27.150000000000002 20.3 40-44 24.055 28.485 26.950000000000003 20.51 45-49 23.974999999999998 27.625 27.66 20.74 50-54 23.855 28.725 27.38 20.04 55-59 24.44 27.555000000000003 26.99 21.015 60-64 24.675 27.58 27.765 19.98 65-69 24.87 27.400000000000002 27.43 20.3 70-74 23.990000000000002 28.375 27.33 20.305 75-79 24.72 27.889999999999997 26.840000000000003 20.549999999999997 80-84 24.445 27.775 27.605 20.175 85-89 23.974999999999998 27.51 27.66 20.855 90-94 24.085 27.875 27.534999999999997 20.505000000000003 95-99 24.279999999999998 27.765 27.525 20.43 100-104 24.69 27.939999999999998 27.55 19.82 105-109 24.529999999999998 28.005000000000003 27.839999999999996 19.625 110-114 24.445 27.915 27.155 20.485 115-119 24.735 27.900000000000002 27.68 19.685 120-124 25.009999999999998 27.465 27.21 20.315 125-129 24.905 27.68 27.685 19.73 130-134 25.61 27.255000000000003 27.565 19.57 135-139 25.285000000000004 27.785 27.295 19.634999999999998 140-144 25.795 28.199999999999996 26.845000000000002 19.16 145-149 25.585 27.200000000000003 27.839999999999996 19.375 150-151 25.95 27.150000000000002 28.249999999999996 18.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 1.0 6 1.5 7 1.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 2.5 26 2.5 27 3.0 28 5.5 29 7.5 30 9.5 31 19.5 32 28.0 33 35.0 34 47.0 35 71.5 36 88.5 37 95.5 38 117.5 39 137.0 40 172.5 41 208.5 42 245.5 43 278.0 44 260.5 45 249.5 46 265.5 47 261.5 48 251.0 49 229.0 50 189.5 51 146.5 52 104.5 53 96.0 54 88.0 55 64.0 56 44.5 57 34.5 58 32.5 59 23.5 60 12.0 61 9.5 62 10.5 63 7.5 64 4.0 65 2.0 66 2.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.5 80 1.0 81 0.5 82 0.5 83 0.0 84 1.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 2.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.20260893699694 81.25 2 8.992506244796003 16.2 3 0.6383569247849015 1.725 4 0.08326394671107411 0.3 5 0.0 0.0 6 0.05550929780738274 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02775464890369137 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.925 0.0 0.0 0.0 0.0 128-129 4.387499999999999 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.699999999999999 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTTT 10 0.006830828 145.0 4 TAATGAG 10 0.006830828 145.0 6 >>END_MODULE Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614580 spots for SRR12671027.sra Written 614580 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra Read 614579 spots for SRR12671027.sra Written 614579 spots for SRR12671027.sra SRR ids: ['SRR12671027.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qhqhmctg SRR12671027.sra spots: 12291581 blocks: [[1, 614579], [614580, 1229158], [1229159, 1843737], [1843738, 2458316], [2458317, 3072895], [3072896, 3687474], [3687475, 4302053], [4302054, 4916632], [4916633, 5531211], [5531212, 6145790], [6145791, 6760369], [6760370, 7374948], [7374949, 7989527], [7989528, 8604106], [8604107, 9218685], [9218686, 9833264], [9833265, 10447843], [10447844, 11062422], [11062423, 11677001], [11677002, 12291581]] SRR12671027 file size 4155516 SRR12671027 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671027 SRR12671027_1.fastq SRR12671027_2.fastq Input file: SRR12671027_1.fastq Paired file: SRR12671027_2.fastq trimmed: SRR12671027-trimmed-pair1.fastq, SRR12671027-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:55:29 2025 >> started Thu Apr 10 12:55:42 2025 >> done (12.938s) 12291581 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 28725 ( 0.23%) empty read pairs filtered out after trimming by size control 12262812 (99.77%) read pairs available; of these: 1078121 ( 8.79%) trimmed read pairs available after processing 11184691 (91.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 10 0.00% 21 8 0.00% 22 18 0.00% 23 24 0.00% 24 18 0.00% 25 21 0.00% 26 19 0.00% 27 27 0.00% 28 31 0.00% 29 26 0.00% 30 32 0.00% 31 43 0.00% 32 30 0.00% 33 31 0.00% 34 32 0.00% 35 22 0.00% 36 41 0.00% 37 31 0.00% 38 27 0.00% 39 24 0.00% 40 34 0.00% 41 30 0.00% 42 28 0.00% 43 31 0.00% 44 18 0.00% 45 37 0.00% 46 31 0.00% 47 45 0.00% 48 41 0.00% 49 46 0.00% 50 55 0.00% 51 65 0.00% 52 87 0.00% 53 60 0.00% 54 74 0.00% 55 79 0.00% 56 88 0.00% 57 89 0.00% 58 110 0.00% 59 107 0.00% 60 132 0.00% 61 177 0.00% 62 188 0.00% 63 174 0.00% 64 257 0.00% 65 297 0.00% 66 284 0.00% 67 301 0.00% 68 338 0.00% 69 406 0.00% 70 489 0.00% 71 559 0.00% 72 673 0.01% 73 721 0.01% 74 771 0.01% 75 857 0.01% 76 1001 0.01% 77 1091 0.01% 78 1184 0.01% 79 1343 0.01% 80 1463 0.01% 81 1631 0.01% 82 1775 0.01% 83 1946 0.02% 84 2378 0.02% 85 2475 0.02% 86 2834 0.02% 87 3006 0.02% 88 3354 0.03% 89 3356 0.03% 90 3857 0.03% 91 4110 0.03% 92 4368 0.04% 93 4703 0.04% 94 4970 0.04% 95 5513 0.04% 96 5896 0.05% 97 6227 0.05% 98 6432 0.05% 99 6667 0.05% 100 6998 0.06% 101 7200 0.06% 102 7776 0.06% 103 8089 0.07% 104 8881 0.07% 105 9201 0.08% 106 9762 0.08% 107 10034 0.08% 108 10388 0.08% 109 10848 0.09% 110 10901 0.09% 111 11407 0.09% 112 11960 0.10% 113 12410 0.10% 114 13024 0.11% 115 13994 0.11% 116 14363 0.12% 117 14746 0.12% 118 15216 0.12% 119 15607 0.13% 120 16260 0.13% 121 16668 0.14% 122 17271 0.14% 123 17657 0.14% 124 18436 0.15% 125 18419 0.15% 126 19583 0.16% 127 20385 0.17% 128 20514 0.17% 129 21649 0.18% 130 21426 0.17% 131 21966 0.18% 132 22574 0.18% 133 23260 0.19% 134 23978 0.20% 135 24528 0.20% 136 25372 0.21% 137 25949 0.21% 138 26835 0.22% 139 27508 0.22% 140 27301 0.22% 141 28329 0.23% 142 28879 0.24% 143 29282 0.24% 144 29420 0.24% 145 30380 0.25% 146 31133 0.25% 147 31376 0.26% 148 32206 0.26% 149 32904 0.27% 150 33986 0.28% 151 11184691 91.21% 12262812 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.42 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=20.78 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=1.06 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=35.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.6 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAG SRR12671027 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:56:23 Started mapping on | Apr 10 12:56:23 Finished on | Apr 10 12:57:57 Mapping speed, Million of reads per hour | 469.64 Number of input reads | 12262812 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11431401 Uniquely mapped reads % | 93.22% Average mapped length | 296.32 Number of splices: Total | 10321639 Number of splices: Annotated (sjdb) | 10097882 Number of splices: GT/AG | 10098325 Number of splices: GC/AG | 183321 Number of splices: AT/AC | 6453 Number of splices: Non-canonical | 33540 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.03% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303204 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 86281 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 528207 528207 528207 N_multimapping 303204 303204 303204 N_noFeature 348304 11170623 410685 N_ambiguous 277122 1001 78308 UnstrandedReadsAssigned:10805975 PositiveStrandReadsAssigned:259777 NegativeStrandReadsAssigned:10942408 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671027 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671027-trimmed-pair1.fastq SRR12671027-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,262,812 reads, 10,986,548 reads pseudoaligned [quant] estimated average fragment length: 248.814 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR12671027.ke.tsv 34699 SRR12671027.se.tsv 87100 total ==> SRR12671027.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.19 317 11.84 Potri.005G024800.1.v4.1 1035 787.186 213 17.8902 Potri.004G059700.1.v4.1 961 713.213 6 0.556217 Potri.007G009000.2.v4.1 1416 1168.19 0 0 Potri.003G141000.2.v4.1 2943 2695.19 552 13.5414 Potri.016G087400.1.v4.1 270 78.4063 561 473.068 Potri.015G069301.1.v4.1 564 322.664 0 0 Potri.010G195200.1.v4.1 1773 1525.19 44 1.9074 Potri.012G127500.1.v4.1 977 729.2 66 5.98425 ==> SRR12671027.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 129 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 36 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671027 completed mapping pipeline successfully