Starting /dee2/code/volunteer_pipeline.sh SRR12671028 current disk space = 3050332901376 free memory = 1435744336 SRR12671028 SRAfilesize b5b89baaf36fda2ec6678e7b5307af13 SRR12671028.sra SRR12671028.sra file validated SRR12671028 is paired end SRR12671028 is conventional basespace SRR12671028 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671028_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37675 37.0 37.0 37.0 37.0 37.0 2 36.326 37.0 37.0 37.0 37.0 37.0 3 36.5645 37.0 37.0 37.0 37.0 37.0 4 36.6055 37.0 37.0 37.0 37.0 37.0 5 36.636 37.0 37.0 37.0 37.0 37.0 6 36.532 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.588 37.0 37.0 37.0 37.0 37.0 10-14 36.592 37.0 37.0 37.0 37.0 37.0 15-19 36.5698 37.0 37.0 37.0 37.0 37.0 20-24 36.540499999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.509100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4572 37.0 37.0 37.0 37.0 37.0 35-39 36.4584 37.0 37.0 37.0 37.0 37.0 40-44 36.411500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4286 37.0 37.0 37.0 37.0 37.0 50-54 36.3686 37.0 37.0 37.0 37.0 37.0 55-59 36.333299999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3092 37.0 37.0 37.0 37.0 37.0 65-69 36.277100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2963 37.0 37.0 37.0 37.0 37.0 75-79 36.2553 37.0 37.0 37.0 37.0 37.0 80-84 36.2414 37.0 37.0 37.0 37.0 37.0 85-89 36.2071 37.0 37.0 37.0 37.0 37.0 90-94 36.2111 37.0 37.0 37.0 37.0 37.0 95-99 36.1682 37.0 37.0 37.0 37.0 37.0 100-104 36.1884 37.0 37.0 37.0 37.0 37.0 105-109 36.0669 37.0 37.0 37.0 37.0 37.0 110-114 36.1145 37.0 37.0 37.0 37.0 37.0 115-119 36.01155 37.0 37.0 37.0 37.0 37.0 120-124 35.9853 37.0 37.0 37.0 37.0 37.0 125-129 35.9847 37.0 37.0 37.0 37.0 37.0 130-134 35.7949 37.0 37.0 37.0 37.0 37.0 135-139 35.902 37.0 37.0 37.0 37.0 37.0 140-144 35.8204 37.0 37.0 37.0 37.0 37.0 145-149 35.6515 37.0 37.0 37.0 37.0 37.0 150-151 35.55375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 3.0 22 2.0 23 4.0 24 3.0 25 5.0 26 6.0 27 9.0 28 5.0 29 18.0 30 31.0 31 42.0 32 60.0 33 79.0 34 135.0 35 263.0 36 2649.0 37 682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.18754688672168 10.802700675168792 4.776194048512128 34.2335583895974 2 18.85 10.65 40.0 30.5 3 17.75 15.625 28.95 37.675 4 21.6 22.95 26.674999999999997 28.775000000000002 5 23.599999999999998 29.299999999999997 25.025 22.075 6 19.825 32.550000000000004 25.575 22.05 7 15.375 28.025 41.275 15.325 8 16.225 24.5 34.1 25.174999999999997 9 16.400000000000002 23.724999999999998 36.4 23.474999999999998 10-14 19.245 29.86 28.294999999999998 22.6 15-19 19.96 27.615000000000002 29.025000000000002 23.400000000000002 20-24 20.305 27.915 27.99 23.79 25-29 19.61 28.849999999999998 28.235 23.305 30-34 19.675 28.075 28.025 24.224999999999998 35-39 19.915 27.805000000000003 28.249999999999996 24.03 40-44 19.97 28.515 28.49 23.025000000000002 45-49 19.939999999999998 28.389999999999997 27.66 24.01 50-54 20.165 27.889999999999997 28.21 23.735 55-59 19.77 28.939999999999998 28.185 23.105 60-64 19.46 28.799999999999997 28.375 23.365 65-69 19.955000000000002 28.935 27.605 23.505000000000003 70-74 20.235 28.98 27.189999999999998 23.595 75-79 19.68 28.095 28.349999999999998 23.875 80-84 20.23 28.015 27.525 24.23 85-89 20.18 29.125 27.12 23.575 90-94 20.34 28.595 27.32 23.745 95-99 19.97 28.804999999999996 27.505000000000003 23.72 100-104 20.23 28.52 27.845 23.405 105-109 20.73 28.055000000000003 27.915 23.3 110-114 19.97 27.85 28.084999999999997 24.095 115-119 20.721036051802592 27.646382319115958 28.206410320516024 23.426171308565426 120-124 20.44 27.839999999999996 28.17 23.549999999999997 125-129 21.34 27.83 27.16 23.669999999999998 130-134 20.205000000000002 28.625 27.57 23.599999999999998 135-139 20.919999999999998 27.82 27.544999999999998 23.715 140-144 21.0 28.505000000000003 26.85 23.645 145-149 20.779155831166232 28.42068413682737 27.440488097619525 23.359671934386878 150-151 20.7875 28.5625 27.187499999999996 23.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 2.5 2 2.5 3 0.5 4 0.5 5 1.5 6 1.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 4.0 23 3.0 24 4.0 25 4.5 26 6.0 27 10.0 28 14.0 29 16.5 30 17.0 31 28.5 32 37.0 33 50.5 34 58.5 35 58.5 36 72.5 37 87.5 38 113.5 39 169.5 40 208.5 41 214.0 42 244.0 43 250.0 44 243.0 45 252.5 46 267.5 47 261.0 48 229.5 49 217.5 50 185.5 51 143.0 52 113.5 53 94.0 54 74.0 55 54.5 56 42.0 57 30.5 58 27.0 59 24.0 60 18.0 61 11.5 62 8.5 63 5.0 64 2.0 65 2.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 89.68011126564673 80.60000000000001 2 9.485396383866481 17.05 3 0.7510431154381085 2.025 4 0.055632823365785816 0.2 5 0.027816411682892908 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.2874999999999996 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTAGA 10 0.006830828 145.0 7 >>END_MODULE SRR12671028 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671028_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.307 37.0 37.0 37.0 37.0 37.0 2 36.213 37.0 37.0 37.0 37.0 37.0 3 36.375 37.0 37.0 37.0 37.0 37.0 4 36.341 37.0 37.0 37.0 37.0 37.0 5 36.3665 37.0 37.0 37.0 37.0 37.0 6 36.3815 37.0 37.0 37.0 37.0 37.0 7 36.299 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.4645 37.0 37.0 37.0 37.0 37.0 10-14 36.397400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.41330000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.405199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.315999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3007 37.0 37.0 37.0 37.0 37.0 35-39 36.2479 37.0 37.0 37.0 37.0 37.0 40-44 36.2298 37.0 37.0 37.0 37.0 37.0 45-49 36.2108 37.0 37.0 37.0 37.0 37.0 50-54 36.175799999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1819 37.0 37.0 37.0 37.0 37.0 60-64 36.19690000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1672 37.0 37.0 37.0 37.0 37.0 70-74 36.1714 37.0 37.0 37.0 37.0 37.0 75-79 36.1143 37.0 37.0 37.0 37.0 37.0 80-84 36.0994 37.0 37.0 37.0 37.0 37.0 85-89 35.99355 37.0 37.0 37.0 37.0 37.0 90-94 36.017199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.049400000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.0949 37.0 37.0 37.0 37.0 37.0 105-109 35.96470000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.9342 37.0 37.0 37.0 37.0 37.0 115-119 35.8961 37.0 37.0 37.0 37.0 37.0 120-124 35.8297 37.0 37.0 37.0 37.0 37.0 125-129 35.73819999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8 37.0 37.0 37.0 37.0 37.0 135-139 35.789300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7242 37.0 37.0 37.0 37.0 37.0 145-149 35.4187 37.0 37.0 37.0 34.6 37.0 150-151 35.19925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 3.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 0.0 22 4.0 23 5.0 24 7.0 25 7.0 26 8.0 27 14.0 28 15.0 29 18.0 30 23.0 31 37.0 32 48.0 33 88.0 34 151.0 35 376.0 36 2679.0 37 509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.550000000000004 24.325 7.049999999999999 22.075 2 26.724999999999998 24.825 31.95 16.5 3 19.875 28.15 33.95 18.025 4 23.7 35.6 23.175 17.525 5 26.025 37.225 20.175 16.575 6 19.675 40.45 22.025 17.849999999999998 7 21.15 22.475 37.9 18.475 8 19.475 25.924999999999997 30.85 23.75 9 22.05 23.35 31.2 23.400000000000002 10-14 22.515 29.099999999999998 27.485 20.9 15-19 22.78 27.875 28.04 21.305 20-24 22.715 28.794999999999998 27.41 21.08 25-29 22.335 28.305000000000003 28.115000000000002 21.245 30-34 22.835 27.68 28.299999999999997 21.185000000000002 35-39 23.105 28.1 27.889999999999997 20.905 40-44 22.695 27.785 28.634999999999998 20.885 45-49 22.66 27.944999999999997 27.785 21.61 50-54 22.735 28.83 27.685 20.75 55-59 23.055 28.015 27.439999999999998 21.490000000000002 60-64 23.21 27.92 28.155 20.715 65-69 23.27 27.839999999999996 27.474999999999998 21.415 70-74 23.27 27.860000000000003 27.439999999999998 21.43 75-79 22.945 27.634999999999998 28.305000000000003 21.115000000000002 80-84 22.86 28.055000000000003 27.310000000000002 21.775 85-89 23.28116405820291 28.32641632081604 27.40137006850343 20.991049552477623 90-94 22.74 28.515 26.915 21.83 95-99 23.34 28.03 27.62 21.01 100-104 23.244999999999997 28.720000000000002 26.810000000000002 21.224999999999998 105-109 23.635 28.095 27.715 20.555 110-114 23.5 27.91 27.775 20.815 115-119 23.602360236023603 28.512851285128516 26.897689768976896 20.98709870987099 120-124 24.22 28.194999999999997 27.474999999999998 20.11 125-129 24.02 28.21 27.33 20.44 130-134 24.605 28.189999999999998 26.805 20.4 135-139 24.07 28.115000000000002 27.38 20.435 140-144 24.312431243124312 27.11271127112711 28.102810281028102 20.47204720472047 145-149 24.67 27.950000000000003 27.165 20.215 150-151 24.5125 28.599999999999998 27.200000000000003 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 1.0 7 1.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 0.0 19 0.5 20 2.0 21 2.0 22 2.5 23 3.0 24 2.0 25 3.0 26 5.5 27 8.0 28 12.0 29 14.0 30 14.5 31 24.5 32 32.5 33 40.5 34 56.5 35 66.0 36 71.5 37 99.5 38 131.0 39 166.0 40 199.0 41 230.5 42 261.0 43 266.5 44 258.0 45 242.5 46 258.0 47 263.0 48 213.0 49 194.0 50 187.5 51 150.0 52 116.5 53 86.5 54 64.0 55 51.5 56 42.0 57 31.5 58 28.0 59 30.5 60 24.5 61 12.0 62 6.5 63 3.0 64 1.0 65 1.0 66 0.5 67 1.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 89.98330550918196 80.85 2 8.95937673900946 16.1 3 0.8903728436282694 2.4 4 0.13912075681691707 0.5 5 0.0 0.0 6 0.02782415136338342 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTCTA 10 0.006830828 145.0 5 >>END_MODULE Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747379 spots for SRR12671028.sra Written 747379 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra Read 747374 spots for SRR12671028.sra Written 747374 spots for SRR12671028.sra SRR ids: ['SRR12671028.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vcx73vuf SRR12671028.sra spots: 14947485 blocks: [[1, 747374], [747375, 1494748], [1494749, 2242122], [2242123, 2989496], [2989497, 3736870], [3736871, 4484244], [4484245, 5231618], [5231619, 5978992], [5978993, 6726366], [6726367, 7473740], [7473741, 8221114], [8221115, 8968488], [8968489, 9715862], [9715863, 10463236], [10463237, 11210610], [11210611, 11957984], [11957985, 12705358], [12705359, 13452732], [13452733, 14200106], [14200107, 14947485]] SRR12671028 file size 5058108 SRR12671028 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671028 SRR12671028_1.fastq SRR12671028_2.fastq Input file: SRR12671028_1.fastq Paired file: SRR12671028_2.fastq trimmed: SRR12671028-trimmed-pair1.fastq, SRR12671028-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:56:28 2025 >> started Tue Feb 11 13:56:45 2025 >> done (17.217s) 14947485 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 3418 ( 0.02%) empty read pairs filtered out after trimming by size control 14943942 (99.98%) read pairs available; of these: 814535 ( 5.45%) trimmed read pairs available after processing 14129407 (94.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 12 0.00% 21 24 0.00% 22 9 0.00% 23 28 0.00% 24 23 0.00% 25 30 0.00% 26 24 0.00% 27 40 0.00% 28 28 0.00% 29 22 0.00% 30 26 0.00% 31 27 0.00% 32 32 0.00% 33 28 0.00% 34 33 0.00% 35 31 0.00% 36 29 0.00% 37 21 0.00% 38 28 0.00% 39 34 0.00% 40 25 0.00% 41 19 0.00% 42 20 0.00% 43 25 0.00% 44 30 0.00% 45 32 0.00% 46 25 0.00% 47 29 0.00% 48 46 0.00% 49 44 0.00% 50 54 0.00% 51 45 0.00% 52 55 0.00% 53 55 0.00% 54 73 0.00% 55 44 0.00% 56 63 0.00% 57 72 0.00% 58 72 0.00% 59 107 0.00% 60 120 0.00% 61 114 0.00% 62 149 0.00% 63 177 0.00% 64 174 0.00% 65 229 0.00% 66 197 0.00% 67 237 0.00% 68 288 0.00% 69 282 0.00% 70 333 0.00% 71 391 0.00% 72 450 0.00% 73 498 0.00% 74 563 0.00% 75 715 0.00% 76 675 0.00% 77 732 0.00% 78 896 0.01% 79 981 0.01% 80 1080 0.01% 81 1127 0.01% 82 1289 0.01% 83 1472 0.01% 84 1610 0.01% 85 1781 0.01% 86 1932 0.01% 87 2115 0.01% 88 2152 0.01% 89 2485 0.02% 90 2674 0.02% 91 2832 0.02% 92 3000 0.02% 93 3374 0.02% 94 3593 0.02% 95 3900 0.03% 96 4192 0.03% 97 4305 0.03% 98 4672 0.03% 99 4964 0.03% 100 5125 0.03% 101 5101 0.03% 102 5646 0.04% 103 5831 0.04% 104 6259 0.04% 105 6660 0.04% 106 6766 0.05% 107 7276 0.05% 108 7479 0.05% 109 7645 0.05% 110 7781 0.05% 111 8274 0.06% 112 8670 0.06% 113 9015 0.06% 114 9309 0.06% 115 9752 0.07% 116 10055 0.07% 117 10661 0.07% 118 11010 0.07% 119 11325 0.08% 120 11894 0.08% 121 12257 0.08% 122 12738 0.09% 123 13282 0.09% 124 13459 0.09% 125 13842 0.09% 126 14586 0.10% 127 14850 0.10% 128 15560 0.10% 129 15879 0.11% 130 16301 0.11% 131 16207 0.11% 132 17280 0.12% 133 17442 0.12% 134 17863 0.12% 135 18576 0.12% 136 19351 0.13% 137 19522 0.13% 138 20472 0.14% 139 21334 0.14% 140 21384 0.14% 141 22119 0.15% 142 22273 0.15% 143 22815 0.15% 144 24003 0.16% 145 24032 0.16% 146 24843 0.17% 147 25425 0.17% 148 26489 0.18% 149 26164 0.18% 150 28421 0.19% 151 14129407 94.55% 14943942 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=43.25 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCTTCGGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAGCCCAGATGGCCAAGATGCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAGATCTGGGCTCCAGCCTTGAACCATACAGCCTCGCCGAACTTGACACCGTTGCGGGACAAGAGCTCGGGGAAGACGCATCCAAGAGC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=25 prefix-density=0.94 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.14 sequence-density-rank=24 fanout-score=33.84 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.7 sequence=AAAGAAAAGAAAA SRR12671028 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:57:53 Started mapping on | Feb 11 13:57:53 Finished on | Feb 11 13:59:42 Mapping speed, Million of reads per hour | 493.56 Number of input reads | 14943942 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13776926 Uniquely mapped reads % | 92.19% Average mapped length | 297.91 Number of splices: Total | 13828260 Number of splices: Annotated (sjdb) | 13535638 Number of splices: GT/AG | 13558389 Number of splices: GC/AG | 221565 Number of splices: AT/AC | 8785 Number of splices: Non-canonical | 39521 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357826 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 162674 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 809190 809190 809190 N_multimapping 357826 357826 357826 N_noFeature 602634 13538682 671033 N_ambiguous 258278 965 87910 UnstrandedReadsAssigned:12916014 PositiveStrandReadsAssigned:237279 NegativeStrandReadsAssigned:13017983 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671028 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671028-trimmed-pair1.fastq SRR12671028-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,943,942 reads, 13,075,176 reads pseudoaligned [quant] estimated average fragment length: 284.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR12671028.ke.tsv 34699 SRR12671028.se.tsv 87100 total ==> SRR12671028.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.35 503 17.7055 Potri.005G024800.1.v4.1 1035 751.355 291 23.6442 Potri.004G059700.1.v4.1 961 677.649 4 0.360356 Potri.007G009000.2.v4.1 1416 1132.35 0 0 Potri.003G141000.2.v4.1 2943 2659.35 668 15.3348 Potri.016G087400.1.v4.1 270 73.1337 635 530.07 Potri.015G069301.1.v4.1 564 298.263 0 0 Potri.010G195200.1.v4.1 1773 1489.35 48 1.96752 Potri.012G127500.1.v4.1 977 693.496 113 9.94744 ==> SRR12671028.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 197 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR12671028 completed mapping pipeline successfully