Starting /dee2/code/volunteer_pipeline.sh SRR12671029 current disk space = 3050175397888 free memory = 1461127456 SRR12671029 SRAfilesize a25153ce705d822429a4d8533443b1a4 SRR12671029.sra SRR12671029.sra file validated SRR12671029 is paired end SRR12671029 is conventional basespace SRR12671029 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671029_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.415 37.0 37.0 37.0 37.0 37.0 2 36.364 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.507 37.0 37.0 37.0 37.0 37.0 5 36.5755 37.0 37.0 37.0 37.0 37.0 6 36.586 37.0 37.0 37.0 37.0 37.0 7 36.425 37.0 37.0 37.0 37.0 37.0 8 36.522 37.0 37.0 37.0 37.0 37.0 9 36.639 37.0 37.0 37.0 37.0 37.0 10-14 36.5978 37.0 37.0 37.0 37.0 37.0 15-19 36.553999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4821 37.0 37.0 37.0 37.0 37.0 25-29 36.4443 37.0 37.0 37.0 37.0 37.0 30-34 36.4062 37.0 37.0 37.0 37.0 37.0 35-39 36.3694 37.0 37.0 37.0 37.0 37.0 40-44 36.364599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3528 37.0 37.0 37.0 37.0 37.0 50-54 36.3275 37.0 37.0 37.0 37.0 37.0 55-59 36.29970000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.305 37.0 37.0 37.0 37.0 37.0 65-69 36.2734 37.0 37.0 37.0 37.0 37.0 70-74 36.282399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.1969 37.0 37.0 37.0 37.0 37.0 80-84 36.1696 37.0 37.0 37.0 37.0 37.0 85-89 36.1368 37.0 37.0 37.0 37.0 37.0 90-94 36.1207 37.0 37.0 37.0 37.0 37.0 95-99 36.09179999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.025 37.0 37.0 37.0 37.0 37.0 105-109 35.9664 37.0 37.0 37.0 37.0 37.0 110-114 35.977700000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8923 37.0 37.0 37.0 37.0 37.0 120-124 35.908699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8991 37.0 37.0 37.0 37.0 37.0 130-134 35.768100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.765100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7017 37.0 37.0 37.0 37.0 37.0 145-149 35.598299999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.474999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 4.0 23 5.0 24 3.0 25 4.0 26 4.0 27 12.0 28 16.0 29 24.0 30 39.0 31 44.0 32 63.0 33 90.0 34 123.0 35 265.0 36 2724.0 37 576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.725 11.575000000000001 7.025 37.675 2 19.400000000000002 11.55 36.55 32.5 3 16.025 17.0 26.900000000000002 40.075 4 21.975 22.875 25.6 29.549999999999997 5 25.074999999999996 28.599999999999998 24.825 21.5 6 19.675 34.55 23.200000000000003 22.575 7 15.35 26.200000000000003 42.75 15.7 8 15.65 24.65 35.35 24.349999999999998 9 16.525000000000002 23.849999999999998 36.05 23.575 10-14 19.75 29.315 28.26 22.675 15-19 19.625 28.415000000000003 27.450000000000003 24.51 20-24 19.48 28.849999999999998 27.705000000000002 23.965 25-29 19.805 28.065 28.389999999999997 23.74 30-34 19.900000000000002 28.73 27.63 23.74 35-39 19.785 28.294999999999998 28.599999999999998 23.32 40-44 20.215 28.685 27.55 23.549999999999997 45-49 19.77 28.994999999999997 27.075 24.16 50-54 19.564999999999998 29.12 27.265 24.05 55-59 20.025000000000002 28.71 27.839999999999996 23.425 60-64 20.405 28.095 27.900000000000002 23.599999999999998 65-69 20.375 28.455000000000002 27.689999999999998 23.48 70-74 21.345 27.73 27.445000000000004 23.48 75-79 18.775 29.425 28.24 23.56 80-84 20.16 28.16 28.03 23.65 85-89 20.285 28.67 27.815 23.23 90-94 20.244999999999997 28.134999999999998 27.83 23.79 95-99 20.29 28.499999999999996 27.615000000000002 23.595 100-104 20.330000000000002 28.705000000000002 27.755000000000003 23.21 105-109 20.544999999999998 27.67 28.13 23.655 110-114 20.435 27.97 28.155 23.44 115-119 20.865000000000002 27.939999999999998 27.750000000000004 23.445 120-124 20.03 28.96 27.375 23.635 125-129 20.86 27.839999999999996 27.845 23.455000000000002 130-134 20.185 28.360000000000003 27.77 23.685000000000002 135-139 20.84 28.63 27.18 23.35 140-144 20.085 28.58 27.544999999999998 23.79 145-149 20.835 27.79 27.560000000000002 23.815 150-151 20.962500000000002 28.499999999999996 26.400000000000002 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 1.0 7 2.0 8 1.5 9 0.5 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 1.0 16 1.5 17 1.0 18 2.0 19 1.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 5.0 26 4.5 27 4.5 28 5.5 29 11.0 30 20.0 31 28.5 32 47.5 33 49.5 34 47.5 35 67.0 36 81.5 37 109.5 38 142.0 39 159.0 40 170.0 41 198.0 42 246.5 43 253.5 44 264.0 45 285.5 46 255.5 47 246.5 48 230.0 49 184.0 50 163.5 51 144.0 52 121.0 53 93.5 54 76.5 55 67.0 56 52.0 57 39.5 58 28.5 59 23.5 60 17.5 61 11.0 62 8.0 63 5.5 64 3.5 65 3.5 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.23385545479528 83.0 2 7.7768617752129705 14.149999999999999 3 0.8518823852706787 2.325 4 0.10992030777686176 0.4 5 0.02748007694421544 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCACAATAAACATAAGTATGCGATTGGATGATGGTGTAAAGACCCGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATTG 10 0.006830828 145.0 1 >>END_MODULE SRR12671029 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671029_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.198 37.0 37.0 37.0 37.0 37.0 2 36.117 37.0 37.0 37.0 37.0 37.0 3 36.226 37.0 37.0 37.0 37.0 37.0 4 36.1275 37.0 37.0 37.0 37.0 37.0 5 36.2665 37.0 37.0 37.0 37.0 37.0 6 36.196 37.0 37.0 37.0 37.0 37.0 7 36.188 37.0 37.0 37.0 37.0 37.0 8 36.2755 37.0 37.0 37.0 37.0 37.0 9 36.282 37.0 37.0 37.0 37.0 37.0 10-14 36.313700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.27869999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2503 37.0 37.0 37.0 37.0 37.0 25-29 36.16420000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.163199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1845 37.0 37.0 37.0 37.0 37.0 40-44 36.168299999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1442 37.0 37.0 37.0 37.0 37.0 50-54 36.107299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.143299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0595 37.0 37.0 37.0 37.0 37.0 65-69 36.0894 37.0 37.0 37.0 37.0 37.0 70-74 36.0295 37.0 37.0 37.0 37.0 37.0 75-79 36.0189 37.0 37.0 37.0 37.0 37.0 80-84 35.9952 37.0 37.0 37.0 37.0 37.0 85-89 35.9282 37.0 37.0 37.0 37.0 37.0 90-94 35.9083 37.0 37.0 37.0 37.0 37.0 95-99 36.0055 37.0 37.0 37.0 37.0 37.0 100-104 35.90369999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.8257 37.0 37.0 37.0 37.0 37.0 110-114 35.8141 37.0 37.0 37.0 37.0 37.0 115-119 35.77120000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6969 37.0 37.0 37.0 37.0 37.0 125-129 35.6528 37.0 37.0 37.0 37.0 37.0 130-134 35.7465 37.0 37.0 37.0 37.0 37.0 135-139 35.6573 37.0 37.0 37.0 37.0 37.0 140-144 35.57899999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.4332 37.0 37.0 37.0 37.0 37.0 150-151 35.208 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 3.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 3.0 23 4.0 24 9.0 25 9.0 26 8.0 27 18.0 28 12.0 29 27.0 30 40.0 31 45.0 32 60.0 33 98.0 34 147.0 35 408.0 36 2623.0 37 476.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.175 23.375 9.55 25.900000000000002 2 27.650000000000002 26.025 30.125 16.2 3 18.975 27.725 32.75 20.549999999999997 4 24.575 35.25 22.325 17.849999999999998 5 24.95 36.525 21.325 17.2 6 19.025 39.525 23.275000000000002 18.175 7 20.225 21.7 40.45 17.625 8 19.900000000000002 27.175 28.599999999999998 24.325 9 23.05 23.849999999999998 29.5 23.599999999999998 10-14 23.005 29.715000000000003 26.384999999999998 20.895 15-19 22.66 28.34 28.165000000000003 20.835 20-24 22.625 28.910000000000004 27.365000000000002 21.099999999999998 25-29 22.985 27.755000000000003 28.055000000000003 21.205 30-34 22.54 28.53 28.249999999999996 20.68 35-39 22.07 28.439999999999998 28.065 21.425 40-44 22.509999999999998 28.265 28.08 21.145 45-49 21.715 28.27 28.775000000000002 21.240000000000002 50-54 22.400000000000002 27.915 28.33 21.355 55-59 22.755 28.325 27.865000000000002 21.055 60-64 23.075000000000003 27.195000000000004 28.544999999999998 21.185000000000002 65-69 23.26 28.21 27.365000000000002 21.165 70-74 22.795 28.105000000000004 28.285 20.815 75-79 23.04 27.71 27.62 21.63 80-84 23.31 28.810000000000002 26.815 21.065 85-89 23.06 28.83 27.42 20.69 90-94 22.994999999999997 28.244999999999997 27.465 21.295 95-99 22.470000000000002 28.18 28.16 21.19 100-104 23.96 27.925 27.894999999999996 20.22 105-109 22.795 28.465 27.505000000000003 21.235 110-114 23.14 28.48 27.675 20.705000000000002 115-119 23.555 28.255000000000003 27.67 20.52 120-124 23.445 27.99 27.639999999999997 20.925 125-129 23.705000000000002 28.444999999999997 27.675 20.175 130-134 23.244999999999997 28.43 27.255000000000003 21.07 135-139 24.0 27.61 28.075 20.315 140-144 23.755000000000003 27.91 27.595 20.74 145-149 24.375 27.900000000000002 26.91 20.815 150-151 24.4375 28.8625 26.787499999999998 19.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 2.5 23 3.0 24 2.5 25 3.0 26 4.0 27 7.0 28 11.5 29 14.5 30 21.5 31 27.0 32 27.0 33 34.5 34 50.0 35 68.0 36 87.5 37 101.0 38 133.0 39 168.5 40 208.0 41 249.0 42 269.0 43 268.5 44 263.0 45 255.5 46 255.0 47 244.5 48 217.5 49 193.5 50 160.5 51 139.0 52 112.5 53 88.5 54 78.0 55 65.0 56 44.5 57 24.5 58 21.5 59 21.0 60 10.5 61 6.0 62 5.0 63 5.0 64 5.5 65 3.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.4647577092511 83.05 2 7.544052863436123 13.700000000000001 3 0.7433920704845814 2.025 4 0.16519823788546256 0.6 5 0.027533039647577095 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027533039647577095 0.2 9 0.0 0.0 >10 0.027533039647577095 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit GTTCACAAAAGCTCAAAGGTTCTGCATTTAACTCGCATTGGTGGAACTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCAT 10 0.006830828 145.0 9 ACACATT 10 0.006830828 145.0 6 ACATTCA 10 0.006830828 145.0 8 AGAACAC 10 0.006830828 145.0 3 GAACACA 10 0.006830828 145.0 4 GCTCAGT 10 0.006830828 145.0 5 AACACAT 10 0.006830828 145.0 5 ATCAATC 20 0.00593511 29.0 50-54 >>END_MODULE Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626717 spots for SRR12671029.sra Written 626717 spots for SRR12671029.sra Read 626734 spots for SRR12671029.sra Written 626734 spots for SRR12671029.sra SRR ids: ['SRR12671029.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_033w60yn SRR12671029.sra spots: 12534357 blocks: [[1, 626717], [626718, 1253434], [1253435, 1880151], [1880152, 2506868], [2506869, 3133585], [3133586, 3760302], [3760303, 4387019], [4387020, 5013736], [5013737, 5640453], [5640454, 6267170], [6267171, 6893887], [6893888, 7520604], [7520605, 8147321], [8147322, 8774038], [8774039, 9400755], [9400756, 10027472], [10027473, 10654189], [10654190, 11280906], [11280907, 11907623], [11907624, 12534357]] SRR12671029 file size 4238022 SRR12671029 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671029 SRR12671029_1.fastq SRR12671029_2.fastq Input file: SRR12671029_1.fastq Paired file: SRR12671029_2.fastq trimmed: SRR12671029-trimmed-pair1.fastq, SRR12671029-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:16:14 2025 >> started Tue Feb 11 14:16:28 2025 >> done (14.521s) 12534357 read pairs processed; of these: 61 ( 0.00%) short read pairs filtered out after trimming by size control 1480 ( 0.01%) empty read pairs filtered out after trimming by size control 12532816 (99.99%) read pairs available; of these: 567528 ( 4.53%) trimmed read pairs available after processing 11965288 (95.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 15 0.00% 27 8 0.00% 28 11 0.00% 29 5 0.00% 30 4 0.00% 31 12 0.00% 32 16 0.00% 33 12 0.00% 34 6 0.00% 35 11 0.00% 36 4 0.00% 37 6 0.00% 38 10 0.00% 39 5 0.00% 40 12 0.00% 41 13 0.00% 42 23 0.00% 43 18 0.00% 44 19 0.00% 45 18 0.00% 46 24 0.00% 47 21 0.00% 48 11 0.00% 49 24 0.00% 50 27 0.00% 51 31 0.00% 52 29 0.00% 53 40 0.00% 54 39 0.00% 55 39 0.00% 56 40 0.00% 57 50 0.00% 58 59 0.00% 59 47 0.00% 60 53 0.00% 61 76 0.00% 62 74 0.00% 63 103 0.00% 64 102 0.00% 65 105 0.00% 66 109 0.00% 67 159 0.00% 68 151 0.00% 69 181 0.00% 70 194 0.00% 71 242 0.00% 72 275 0.00% 73 297 0.00% 74 353 0.00% 75 351 0.00% 76 426 0.00% 77 436 0.00% 78 497 0.00% 79 569 0.00% 80 644 0.01% 81 666 0.01% 82 775 0.01% 83 859 0.01% 84 1009 0.01% 85 1090 0.01% 86 1191 0.01% 87 1233 0.01% 88 1402 0.01% 89 1444 0.01% 90 1626 0.01% 91 1706 0.01% 92 1793 0.01% 93 1994 0.02% 94 2222 0.02% 95 2363 0.02% 96 2591 0.02% 97 2772 0.02% 98 2910 0.02% 99 3054 0.02% 100 3293 0.03% 101 3358 0.03% 102 3584 0.03% 103 3699 0.03% 104 3932 0.03% 105 4285 0.03% 106 4494 0.04% 107 4699 0.04% 108 4923 0.04% 109 5130 0.04% 110 5216 0.04% 111 5684 0.05% 112 5886 0.05% 113 6025 0.05% 114 6275 0.05% 115 6618 0.05% 116 6922 0.06% 117 7338 0.06% 118 7607 0.06% 119 7879 0.06% 120 8309 0.07% 121 8328 0.07% 122 8783 0.07% 123 9081 0.07% 124 9541 0.08% 125 9766 0.08% 126 10220 0.08% 127 10364 0.08% 128 10817 0.09% 129 10919 0.09% 130 11474 0.09% 131 11826 0.09% 132 11990 0.10% 133 12430 0.10% 134 12733 0.10% 135 13309 0.11% 136 13458 0.11% 137 14094 0.11% 138 14281 0.11% 139 15308 0.12% 140 15303 0.12% 141 15820 0.13% 142 16474 0.13% 143 16366 0.13% 144 17220 0.14% 145 17635 0.14% 146 18085 0.14% 147 18336 0.15% 148 19407 0.15% 149 19535 0.16% 150 20630 0.16% 151 11965288 95.47% 12532816 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=19.48 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.8 sequence=ATCGCCAGTTGGGGACCATTCATCAGTGTTGTAGATAGGGCTGTAGCCATCCACATTAGCACCATATTTGTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.43 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=81.63 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.9 sequence=AGAAAAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCACAACTCCACCGCCACGTTAGTCCTCCTCTAT SRR12671029 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:17:11 Started mapping on | Feb 11 14:17:11 Finished on | Feb 11 14:18:54 Mapping speed, Million of reads per hour | 438.04 Number of input reads | 12532816 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11612193 Uniquely mapped reads % | 92.65% Average mapped length | 298.58 Number of splices: Total | 11751333 Number of splices: Annotated (sjdb) | 11504168 Number of splices: GT/AG | 11530133 Number of splices: GC/AG | 180319 Number of splices: AT/AC | 6490 Number of splices: Non-canonical | 34391 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279501 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 96663 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641122 641122 641122 N_multimapping 279501 279501 279501 N_noFeature 476628 11400823 529796 N_ambiguous 233070 738 74491 UnstrandedReadsAssigned:10902495 PositiveStrandReadsAssigned:210632 NegativeStrandReadsAssigned:11007906 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671029 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671029-trimmed-pair1.fastq SRR12671029-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,532,816 reads, 10,976,280 reads pseudoaligned [quant] estimated average fragment length: 291.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR12671029.ke.tsv 34699 SRR12671029.se.tsv 87100 total ==> SRR12671029.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.37 497 20.0547 Potri.005G024800.1.v4.1 1035 744.369 185 17.3232 Potri.004G059700.1.v4.1 961 670.632 2 0.20787 Potri.007G009000.2.v4.1 1416 1125.37 0 0 Potri.003G141000.2.v4.1 2943 2652.37 626.499 16.4638 Potri.016G087400.1.v4.1 270 69.7119 465 464.934 Potri.015G069301.1.v4.1 564 291.526 0 0 Potri.010G195200.1.v4.1 1773 1482.37 78 3.66761 Potri.012G127500.1.v4.1 977 686.521 99 10.0514 ==> SRR12671029.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 111 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 131 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671029 completed mapping pipeline successfully